A fish quantification method based on environmental DNA macro barcoding technology

Abstract

The application discloses a fish quantitative method based on environmental DNA macro-barcode technology, and belongs to the fish diversity research field. The method adds E. coli transformed by single copy plasmid in the DNA extraction step on the basis of the prior art, corrects the error of DNA extraction by the extraction efficiency of the single copy plasmid, and makes the DNA copy number in the obtained sample more accurate. Gradient reference is added in the PCR amplification step, the reads number of the gradient reference is obtained after sequencing, the linear slope between the DNA copy number and the reads number is fitted, the reads number of the sample DNA obtained by sequencing is combined, and the DNA copy number in the sample is calculated. Through the joint correction of DNA extraction, PCR amplification and sequencing, the deficiency that the error of the DNA extraction process and the PCR process is not considered in the prior art is made up, the sequencing data can better reflect the absolute abundance of the fish, and the method has the potential for large-scale popularization and application.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of fish diversity research, and particularly relates to a fish quantitative method based on environmental DNA macro-barcoding technology. BACKGROUND

[0002] Fish, as an important part of aquatic ecosystems, can reflect the biodiversity level of aquatic ecosystems, so it is of great significance to evaluate fish biomass. At present, the methods for evaluating fish biomass mainly include marking recapture method, acoustic detection method and molecular biology method, etc. The marking recapture method is to mark the fish in the water body and then recapture it to count the number of fish species. This method has the following problems: (a) the selection and placement of the marker require a lot of manpower and material resources, (b) it requires a large enough number, which has a large cost and is difficult to ensure accuracy, (c) it is difficult to ensure the survival of the captured fish, which has a certain damage to fish resources, (d) for rare species and alien species, it is difficult to effectively mark and recapture due to their small number, so it is difficult to achieve good results, and the survey results are prone to deviation. The acoustic detection method uses an echo sounder to evaluate the fish resources in each water body, which can achieve environment-friendly and efficient research on fish population number, density, etc. However, this technology is limited by water physical and chemical indicators and weather conditions, and it still has great limitations for large-area water investigation. In terms of species identification, this method cannot achieve accurate and effective species identification and community structure analysis. The molecular biology method is based on environmental DNA (eDNA) technology, which extracts environmental DNA from water, soil, sediment and other environmental media, uses universal primers for fish to perform PCR amplification, uses high-throughput sequencing technology to sequence the PCR amplification results, and completes the DNA abundance, species diversity composition or quantitative research of fish in water through comparison with gene library or by constructing a standard curve, such as the invention patents with publication numbers CN105154564A, CN109825563A or CN109593829A.

[0003] The fish evaluation technology based on environmental DNA obtains the sequencing data of the PCR amplification results through analysis, but PCR amplification and sequencing are affected by templates, reagents, operation methods, etc. The PCR amplification and sequencing results of different samples will have great deviations. In addition, the template of PCR amplification is the extracted environmental DNA, and the extraction of environmental DNA is greatly affected by samples, reagents, operation methods, etc., especially for complex samples, the extraction efficiency of different samples may have great differences.

[0004] Therefore, the analysis of fish species diversity based on the above data, especially the analysis of fish biomass, may not accurately reflect the objective results. For example, if two samples with the same copy number have extraction efficiencies of 30% and 60% respectively, and assuming that PCR amplification and sequencing are completely consistent, then the absolute abundance of the former is only 50% of that of the latter, which does not conform to objective facts. Summary of the Invention

[0005] 1. The problem to be solved

[0006] This invention addresses the problem that differences in DNA extraction efficiency between different samples and the potential for significant deviations during PCR amplification and sequencing in quantifying fish biomass using environmental DNA technology, which can affect the accuracy of quantification. It proposes a fish quantification method based on environmental DNA macrobarcoding technology, including methods for correcting DNA extraction, PCR amplification, and sequencing results, thereby improving the accuracy of quantification.

[0007] 2. Technical Solution

[0008] To solve the above problems, the technical solution adopted by the present invention is as follows:

[0009] This invention provides a method for fish quantification based on environmental DNA macrobarcoding technology. The quantification refers to quantitatively comparing the absolute abundance of fish biomass among different samples, that is, determining whether the biomass of a certain fish is greater in one sample than in another. The method includes the following steps:

[0010] (1) Extract DNA from the sample to obtain DNA extract. Add a reference DNA with a known copy number during extraction. After extraction, detect the copy number of the reference DNA in the DNA extract.

[0011] (2) PCR amplification: using the DNA extract from step (1) as a template, amplification was performed using fish 12S universal primers.

[0012] (3) Sequencing of PCR amplification results: The PCR amplification results in step (2) are purified, library constructed, and sequenced to obtain the number of original reads;

[0013] (4) DNA extraction efficiency correction, including the following methods:

[0014] a) Calculate the DNA extraction efficiency of the sample using the following formula:

[0015] η = D 提取后 ÷D0

[0016] Where η is the DNA extraction efficiency of a certain sample; D 提取后copy number of the reference DNA in the DNA extract after extraction, D0 — copy number of the reference DNA added in the sample during DNA extraction;

[0017] b) calculate the corrected sample reads number according to the following formula:

[0018] R D = R0 ÷ η

[0019] Wherein, η — DNA extraction efficiency of a certain sample; R D — reads number of the sample after DNA extraction efficiency correction, R0 — original reads number of the sample;

[0020] Through DNA extraction efficiency correction, the influence of various factors in the DNA extraction process can be excluded, and the DNA copy number in the original sample can be accurately reflected.

[0021] Preferably, the reference DNA with known copy number added in step (1) is E. coli with known bacterial concentration, the above-mentioned E. coli is transformed with single copy plasmid containing target gene fragment A, the above-mentioned target gene fragment A includes specific fragments that can be subjected to qPCR, and the single copy plasmid is a plasmid that has only one copy in one cell after transformation, so the number of bacteria after transformation is equal to the number of plasmids contained therein, so the number of plasmids contained therein can be detected by measuring the number of bacteria, that is, the concentration of single copy plasmid (copy number D0 of reference DNA) can be known through the concentration of E. coli.

[0022] Preferably, the above-mentioned detection of the copy number of the reference DNA in the DNA extract includes detection of the copy number of the single copy plasmid after extraction by qPCR technology, and the target gene fragment A in the single copy plasmid includes specific fragments that can be subjected to qPCR, so the concentration (copy number) of the single copy plasmid after extraction can be detected by qPCR technology after extraction, and the copy number (D 提取后 ) of the reference DNA in the DNA extract is obtained, so as to obtain the DNA extraction efficiency and further complete the DNA extraction correction.

[0023] Preferably, the preparation of the above-mentioned E. coli includes: connecting the target gene fragment A to the single copy plasmid; transforming the connected single copy plasmid into E. coli and expanding the culture; and determining the concentration of the bacterial solution and calculating the number of bacterial bodies.

[0024] Preferably, the above-mentioned single copy plasmid is pCC1BAC.

[0025] Preferably, the above-mentioned E. coli is Escherichia coli EPI300.

[0026] Preferably, the sequence of the above-mentioned gene fragment A comprises:

[0027] GTCTTACAGTGTTCACCGTAGGCGCTGTGCAATATTAGTTTCTGACCTCCATTAGGTAGTTTCCCATAGTGCAAGGTCATACAAGGCGAGGCTAT.

[0028] Preferably, the primers of the above-mentioned qPCR are:

[0029] pCC1F, GTCTTACAGTGTTCACCGTAGGC;

[0030] pCC1R, ATAGCCTCGCCTTGTATGACCTT.

[0031] Preferably, the reaction system of the above-mentioned qPCR is 20 μL, including: POWRUP SYBR MASTER MIX (ThermoFisher Scientific, USA) 10 μL, pCC1F 1 μL, pCC1R 1 μL, DNA template 8 μL.

[0032] Preferably, the reaction conditions of the above-mentioned qPCR include: 50 ℃ for 2 min, 95 ℃ for 2 min, 40 cycles (95 ℃ for 15 s, 60 ℃ for 15 s, 72 ℃ for 1 min), 95 ℃ for 15 s, 60 ℃ for 1 min, 95 ℃ for 15 s.

[0033] Preferably, the fish quantification method based on the environmental DNA macro-barcode technology further comprises PCR amplification and sequencing process correction, which comprises:

[0034] In step (2), different concentrations of three internal standard DNA fragment mixtures are added during PCR amplification, both ends of the three internal standard DNA fragments are the same and are designed for fish universal primers, and the difference is that the three internal standard DNA fragments include 12-20 bp long random sequences with the same length but different sequences inserted at the same position of the above-mentioned fish universal primer design region, and the above-mentioned position is located between the designed fish 12S universal primer sequence in PCR amplification, and the three internal standard DNA fragments can be amplified using fish 12S universal primers for PCR amplification;

[0035] In step (3), after sequencing, the three internal standard DNA fragments can be identified by random sequences, and the reads number of the three internal standard DNA fragments is obtained;

[0036] Further comprising step (5), PCR amplification and sequencing process correction, comprising the following method:

[0037] a) The reads number of the three internal standard DNA fragments added in step (2) PCR amplification of each sample is aggregated, and linear fitting is performed with the initial copy number of the three internal standard DNA fragments to obtain the fitting slope slope;

[0038] b) The sample reads number after PCR process correction is calculated according to the following formula:

[0039] C = R0 ÷ slope

[0040] Wherein, C is the copy number of a certain sample after PCR process correction; R0 is the original reads number of the sample, and slope is the slope obtained by linear fitting of the internal standard DNA fragments in the sample.

[0041] Preferably, the above-mentioned addition of three internal standard DNA fragments includes connecting the three DNA fragments to a plasmid vector.

[0042] Preferably, the above-mentioned plasmid is a commonly used plasmid in the art, such as pUC57 plasmid.

[0043] Preferably, the concentration of the above-mentioned three internal standard DNA fragments forms a certain gradient, such as 22 copies / μL, 65.5 copies / μL, and 134 copies / μL, respectively.

[0044] Preferably, the above-mentioned three internal standard DNA fragments are:

[0045] The internal standard DNA fragment 1 comprises:

[0046] TCGTGCCAGCCACCGCGGTTAAACCTAGGGGAAAGCTCGAATTATGCCTACACCGCCCGTCACTCTTGCGGAGGGACTTCGCACTCACG ATCTCTGGCATA GCCAGACGTTGATTAAGCTTAGTTAACCCCCATGGTAAGTGTACCGGAAGTGCGTGCACGGTTCCTGCACTGATCGACATATATGATACTGGGATTAGATACCCCACTAT;

[0047] And the internal standard DNA fragment 2 comprises:

[0048] TCGTGCCAGCCACCGCGGTTAAACCTAGGGGAAAGCTCGAATTATGCCTACACCGCCCGTCACTCTTGCGGAGGGACTTCGCACTCACG ATGGATACGCTCGCCAGACGTTGATTAAGCTTAGTTAACCCCCATGGTAAGTGTACCGGAAGTGCGTGCACGGTTCCTGCACTGATCGACATATATGATACTGGGATTAGATACCCCACTAT

[0049] and the internal standard DNA fragment 3 comprises:

[0050] TCGTGCCAGCCACCGCGGTTAAACCTAGGGGAAAGCTCGAATTATGCCTACACCGCCCGTCACTCTTGCGGAGGGACTTCGCACTCACG CAACTCATCGTA GCCAGACGTTGATTAAGCTTAGTTAACCCCCATGGTAAGTGTACCGGAAGTGCGTGCACGGTTCCTGCACTGATCGACATATATGATACTGGGATTAGATACCCCACTAT.

[0051] Preferably, the primers of the PCR are:

[0052] a 12S universal upstream primer, TCGTGCCAGCCACCGCGGTTA;

[0053] a 12S universal downstream primer, ATAGTGGGGTATCTAATCCCAG.

[0054] Preferably, the reaction system of the PCR is 30 μL, comprising: 2x Taq Plus Master Mix II (Vazyme Biotech, Nanjing, China) 15 μL, 12S universal upstream primer 1 μL, 12S universal downstream primer 1 μL, ddH2O 10 μL, DNA template 2 μL, standard plasmid mixture 1 μL.

[0055] Preferably, the reaction conditions of the PCR comprise: 95 ℃ for 3 min, 30 cycles (95 ℃ for 15 s, 62.4 ℃ for 30 s, 72 ℃ for 15 s), 72 ℃ for 5 min, 4 ℃.

[0056] Preferably, the fish quantification method based on the environmental DNA macro barcode technology, combined with the DNA extraction process and the PCR process correction, comprises the following method:

[0057] η = D 提取后 ÷ D0

[0058] C = R0 ÷ (slope x η)

[0059] Wherein, C-the copy number of a sample after joint correction; R0-the original reads number of the sample, slope-the slope of the linear fitting of the standard plasmid in the sample; η-the DNA extraction efficiency of the sample; D 提取后 D0-the copy number of the reference DNA in the DNA extract after extraction, D0-the copy number of the reference DNA added in the sample during DNA extraction.

[0060] 3. Beneficial effects

[0061] Compared with the prior art, the present application has the beneficial effects that:

[0062] (1) The present application provides a fish quantification method based on environmental DNA macro-barcode technology. By adding a known copy number of reference DNA during DNA extraction, the DNA extraction efficiency is determined by the copy number of the reference DNA before and after extraction, and then the reads number of the sample after DNA extraction efficiency correction is calculated. This reads number can effectively exclude the influence of various factors in the DNA extraction process and accurately reflect the copy number of DNA in the original sample.

[0063] (2) The present application provides a fish quantification method based on environmental DNA macro-barcode technology. By adding E. coli transformed with single-copy plasmid containing the target gene fragment A at a known bacterial concentration, the concentration (copy number) of the single-copy plasmid can be determined by the concentration of E. coli, and the concentration (copy number) of the single-copy plasmid after extraction can be detected by qPCR technology. The operation is simple and the result is accurate.

[0064] (3) The present application provides a fish quantification method based on environmental DNA macro-barcode technology. By adding different concentrations of three internal standard DNA fragment mixtures or three plasmids containing the above three internal standard DNA fragments during PCR amplification, the slope of the linear fitting of the reads number of the three internal standard DNA fragments and the initial added copy number is corrected, and the copy number in the original sample is corrected. The error caused by different influencing factors in the PCR process can be overcome, and the copy number of DNA in the original sample can be accurately reflected.

[0065] (4) The present application provides a fish quantification method based on environmental DNA macro-barcode technology. The DNA extraction process and the PCR process are jointly corrected, which makes up for the shortcomings of previous methods that do not consider the errors in the DNA extraction process and the PCR process. The sequencing data can better reflect the absolute abundance of species to a certain extent, and has the potential for large-scale popularization and application. BRIEF DESCRIPTION OF DRAWINGS

[0066] Figure 1 is the DNA extraction efficiency of the sample calculated by the qPCR method in Example 1;

[0067] Figure 2 is the reads number of four kinds of fish before and after the DNA extraction process correction by qPCR method in Example 1;

[0068] Figure 3 is the correlation analysis between the reads number of four kinds of fish before and after the DNA extraction process correction by qPCR method and the biomass in Example 1;

[0069] Figure 4 is the linear fitting graph between the sequencing reads of standard plasmid and the initial copy number in Example 2;

[0070] Figure 5 is the reads number of four kinds of fish before and after the joint correction in Example 2;

[0071] Figure 6 is the correlation analysis between the reads number of four kinds of fish before and after the joint correction and the actual biomass in Example 2;

[0072] Figure 7 is the DNA extraction efficiency of each sample obtained in the comparative example;

[0073] Figure 8 is the reads number of four kinds of fish before and after the DNA extraction process correction by the sequencing reads of plasmid D in the comparative example.

[0074] Figure 9 is the correlation analysis between the reads number of four kinds of fish before and after the DNA extraction process correction by the sequencing reads of plasmid D and the biomass in the comparative example. DETAILED DESCRIPTION

[0075] The present application will be further described below in conjunction with specific examples.

[0076] Example 1

[0077] This example provides a method for DNA extraction correction.

[0078] Table 1 Fish release situation in three experimental groups

[0079]

[0080] As shown in Table 1, three barrels were set up in this experiment, L barrel, M barrel and H barrel, different numbers of grass carp, bighead carp, bigscale mud carp and snakehead were put into each barrel. After obtaining the fish for the experiment, they were acclimated outside the barrel for two days. Before putting the fish, 250L of tap water was added to each barrel and aerated for three days. After aeration, the fish were put in the barrel and stayed for 2 days before being taken out. After taking out the fish, the water was immediately filtered using a polycarbonate filter membrane with a diameter of 47mm and a pore size of 0.22um. Three filter membranes were used for each barrel, and the filtration volume of each filter membrane was 200ml.

[0081] After filtration, the DNA was extracted using the magnetic bead method nucleic acid extraction kit developed by Yibinuo Biotechnology Co., Ltd. When extracting DNA, 150ul of 1.068x10 5 CFU / mL of internal standard E. coli solution was added to each sample immediately after adding the lysis solution, and the remaining steps were strictly followed according to the instructions in the kit. The DNA extraction process set 3 blank controls and 3 standard samples. Among them, the blank control refers to the DNA sample extracted using a blank filter membrane without adding internal standard E. coli solution, and the standard sample refers to the DNA sample extracted using a blank filter membrane after adding 150ul of internal standard E. coli solution.

[0082] After DNA extraction, single copy plasmid qPCR analysis was first performed. The specific primer design section for plasmid insert fragments was designed in advance, and a pair of plasmid-specific primers pCC1F and pCC1R were designed. The extracted DNA sample was detected by qPCR using the specific primers. The qPCR reaction system was 20ul: POWRUP SYBR MASTER MIX (ThermoFisher Scientific, USA) 10ul, pCC1F 1ul, pCC1R 1ul, DNA template 8ul. The qPCR reaction conditions were: 50℃ 2min, 95℃ 2min, 40 cycles (95℃ 15s, 60℃ 15s, 72℃ 1min), 95℃ 15s, 60℃ 1min, 95℃ 15s. The plasmid D copy number of each sample after extraction was obtained by qPCR, and then the DNA extraction efficiency was calculated according to the aforementioned calculation formula.

[0083] After extraction, the DNA was subjected to PCR amplification. When this step was performed, the standard plasmids P1, P2, P3 were diluted to the specified concentration and mixed together to form a standard plasmid mixture, and the concentrations of P1, P2, P3 in the standard plasmid mixture were 22 copies / μL, 65.5 copies / μL, 134 copies / μL, respectively. The PCR reaction system was as follows: 2x Taq Plus MasterMix II (Vazyme Biotech, Nanjing, China) 15 μL, 12S universal upstream primer 1 μL, 12S universal downstream primer 1 μL, ddH2O 10 μL, DNA template 2 μL, standard plasmid mixture 1 μL. The PCR reaction conditions were as follows: 95°C for 3 min, 30 cycles of 95°C for 15 s, 62.4°C for 30 s, 72°C for 15 s, 72°C for 5 min, 4°C for ∞. Three blank controls and three standard samples were set during the PCR process. Among them, the blank control refers to the PCR sample with ddH2O as the DNA template and without the addition of the standard plasmid mixture, and the standard sample refers to the PCR sample with ddH2O as the DNA template and with the addition of 1 μL of the standard plasmid mixture.

[0084] After completing the PCR, the obtained PCR products were mixed in equal volumes, and purification, library construction, and sequencing operations were performed, and finally data analysis was performed.

[0085] Correction of DNA extraction efficiency: calculation of sample DNA extraction efficiency by qPCR method

[0086] According to the following formula, the DNA extraction efficiency of the sample can be calculated by the qPCR method:

[0087] η = D qpcr ÷ D0

[0088] Where η is the DNA extraction efficiency of a certain sample, D qpcr is the plasmid copy number of the sample after DNA extraction obtained by qPCR, and D0 is the plasmid copy number added to the sample during DNA extraction.

[0089] According to the formula, the DNA extraction efficiency of each sample is as shown in Table 1. Figure 1 The samples starting with L, M, and H represent the samples in the L barrel, M barrel, and H barrel, respectively, and the three digits immediately following L, M, and H represent the filtration volume of the sample, and the last "-1", "-2", and "-3" of the sample name represent the three parallels of the same group of samples.

[0090] After obtaining the DNA extraction efficiency of each sample, the corrected sample reads can be obtained according to the following formula:

[0091] RD = R0 ÷ η

[0092] Wherein, η —— the DNA extraction efficiency of a certain sample; R D — the reads number of the sample after the DNA extraction efficiency correction, R0 — the original reads number of the sample.

[0093] The reads number of four kinds of fish reflected before and after the DNA extraction process correction by qPCR method is shown in Figure 2 , and the correlation analysis between the reads number before and after the correction and the biomass is shown in Figure 3 . It can be found that the correlation r value between the sequencing reads number in the three barrels and the fish biomass is higher after the correction than before the correction, which shows that the total reads number after the correction can better reflect the actual fish biomass. This shows that the correction of the DNA extraction process using qPCR plays a certain effect, and can better reflect the absolute abundance and biomass of the species.

[0094] Example 2

[0095] This example provides the joint correction of the DNA extraction efficiency and the PCR process.

[0096] First, the reads number of the three standard plasmids P1, P2, P3 added in the PCR step of each sample is summarized, and linear fitting is performed with the initial copy number added, as shown in Figure 4 , and then according to the following formula, the sample copy number after the PCR process correction can be calculated:

[0097] C = R0 ÷ slope

[0098] Wherein, C —— the copy number of a certain sample after the PCR process correction; R0 — the original reads number of the sample, slope — the slope obtained by linear fitting of the standard plasmid in the sample.

[0099] The joint correction of the DNA extraction process and the PCR process is to combine the correction formulas of the two correction processes to calculate:

[0100] η = D qpcr ÷ D0

[0101] C = R0 ÷ (slope × η)

[0102] Wherein, C —— the copy number of a certain sample after the joint correction; R0 — the original reads number of the sample, slope — the slope obtained by linear fitting of the standard plasmid in the sample; η — the DNA extraction efficiency of the sample; D qpcrD0 —— the copy number of plasmid D in the sample after DNA extraction, D —— the copy number of plasmid D added in the sample during DNA extraction.

[0103] The reads number of four fish before joint correction and the corrected copy number are shown in Figure 5 , and the correlation analysis is shown in Figure 6 . It can be found from Figure 5 that before correction, the change trend of the sequencing reads number of grass carp and Paramisgurnus dabryanus in the three barrels does not completely conform to the fish biomass, and the reads number of grass carp in barrel M is the lowest, and the reads number of Paramisgurnus dabryanus is the highest, which shows that the total reads number before correction is difficult to reflect the actual fish biomass. After correction, the change trend of the reads number of any fish and the biomass shows good consistency, and from the change of the correlation analysis r value, it can be seen that the r value after correction is obviously higher than that before correction, which shows that the joint correction has good effect and can well reflect the absolute abundance of the species.

[0104] Comparative example

[0105] The sequencing reads number of plasmid D is used to calculate the DNA extraction efficiency of the sample in this comparative example.

[0106] It is assumed that the extraction efficiency of the sample with the highest extraction efficiency in all samples is 100%, and then according to the following formula, the DNA extraction efficiency of the sample can be calculated by using the sequencing reads number of plasmid D:

[0107] η = D seq ÷ D max

[0108] Wherein, η —— the DNA extraction efficiency of a sample; D seq — the reads number of plasmid D in the sample obtained by sequencing, D max — the maximum value selected from the reads number of plasmid D in each sample obtained by sequencing.

[0109] According to the formula, the DNA extraction efficiency of each sample is shown in Figure 7 , and the samples starting with L, M and H represent the samples in barrel L, barrel M and barrel H respectively, the three digits immediately following L, M and H represent the filtration volume of the sample, and the last "-1", "-2" and "-3" of the sample name represent three parallel samples in the same group.

[0110] After obtaining the DNA extraction efficiency of each sample, the corrected sample reads number can be obtained according to the following formula:

[0111] R D = R0 ÷ η

[0112] wherein, η ——the DNA extraction efficiency of a sample; R D ——the reads number of a sample after DNA extraction efficiency correction, R0 ——the original reads number of a sample.

[0113] The reads number of four fish species before and after DNA extraction process correction using plasmid D sequencing reads is shown in Figure 8 , and the correlation analysis is shown in Figure 9 . It can be clearly found that the correlation r value between the sequencing reads after correction and the biomass of fish is lower, and the highest reads number appears in M barrel instead of H barrel, which indicates that this correction method is not effective and cannot accurately reflect the absolute abundance of species.

Claims

1. An environmental DNA macro-barcoding technology-based fish quantification method, characterized by, The method comprises the following steps: (1) extracting sample DNA to obtain a DNA extract, adding a reference DNA with a known copy number during extraction, and detecting the copy number of the reference DNA in the DNA extract after extraction; the reference DNA with a known copy number is obtained by adding Escherichia coli with a known bacterial concentration, the Escherichia coli is transformed with a single-copy plasmid containing a target gene fragment A, the target gene fragment A includes a specific fragment that can be subjected to qPCR; the detection of the copy number of the reference DNA in the DNA extract includes determination of the copy number of the single-copy plasmid after extraction, and the copy number of the single-copy plasmid is determined by detecting the copy number of the target gene fragment A in the single-copy plasmid by qPCR technology; (2) PCR amplification, using the DNA extract in step (1) as a template and using fish 12S universal primers for amplification; in step (2), different concentrations of a mixture of three internal standard DNA fragments are added during PCR amplification, both ends of the three internal standard DNA fragments are the same and are designed for fish universal primers, and the difference is that the three internal standard DNA fragments include random sequences with the same length of 12-20 bp inserted at the same position in the above fish universal primer design region, and the above position is between the fish 12S universal primer sequences designed in the PCR amplification; (3) sequencing the PCR amplification results, purifying, library building, and sequencing the PCR amplification results in step (2) to obtain the number of original reads; after sequencing, the three internal standard DNA fragments can be identified by the random sequences to obtain the number of reads of the three internal standard DNA fragments; (4) jointly using the DNA extraction process and the PCR process to correct the obtained copy number DNA extraction efficiency correction includes the following methods: a) calculating the DNA extraction efficiency of the sample according to the following formula: η = D 提取后 ÷ D0 wherein, η — DNA extraction efficiency of a certain sample; D 提取后 — Copy number of the reference DNA in the DNA extract after extraction, D0 — Copy number of the reference DNA added in the sample during DNA extraction; PCR amplification and sequencing process correction includes the following methods: a) summing up the number of reads of the three internal standard DNA fragments added in step (2) PCR amplification of each sample, and linearly fitting them with the initial added copy number to obtain the fitting slope slope; jointly using the DNA extraction process and the PCR process correction includes the following methods: η = D 提取后 ÷ D0 C=R0÷(slope×η) Wherein, C-the copy number of a certain sample after joint correction; R0-the original reads number of the sample, slope-the slope of the linear fitting of the standard plasmid in the sample; η-the DNA extraction efficiency of the sample; D 提取后 The copy number of the reference DNA in the DNA extract after extraction, D0-the copy number of the reference DNA added in the sample during DNA extraction.

2. The fish quantification method based on the environmental DNA macro barcoding technology according to claim 1, characterized in that, The preparation of the Escherichia coli includes connecting the target gene fragment A to a single-copy plasmid, transforming the connected single-copy plasmid into Escherichia coli and expanding the culture, determining the bacterial liquid concentration and calculating the number of bacterial bodies, and / or the single-copy plasmid is pCC1BAC, and / or the above Escherichia coli is Escherichia coli EPI300.

3. The fish quantification method based on the environmental DNA macro barcoding technology according to claim 2, characterized in that, The sequence of the gene fragment A includes: GTCTTACAGTGTTCACCGTAGGCGCTGTGCAATATTAGTTTCTGACCTCCATTAGGTA GTTTCCCATAGTGCAAGGTCATACAAGGCGAGGCTAT; and / or the primers for qPCR are: pCC1F, GTCTTACAGTGTTCACCGTAGGC; pCC1R, ATAGCCTCGCCTTGTATGACCTT.

4. The fish quantification method based on the environmental DNA macro barcoding technology according to claim 3, characterized in that, The adding of the three internal standard DNA fragments includes connecting the three DNA fragments to a plasmid vector and then adding.

5. The fish quantification method based on the environmental DNA macrobarcoding technology according to claim 4, characterized in that, The concentrations of the three internal standard DNA fragments form a gradient.

6. The fish quantification method based on the environmental DNA macrobarcoding technology according to claim 4 or 5, characterized in that, The three internal standard DNA fragments are: Internal standard DNA fragment 1 includes: TCGTGCCAGCCACCGCGGTTAAACCTAGGGGAAAGCTCGAATTATGCCTACACCGCCCGTCACTCTTGCGGAGGGACTTCGCACTCACG ATCTCTGGCATA GCCAGACGTTGATTAAGCTTAGTTAACCCCCATGGTAAGTGTACCGGAAGTGCGTGCACGGTTCCTGCACTGATCGACATATATGATACTGGGATTAGATACCCCACTAT; Internal standard DNA fragment 2 includes: TCGTGCCAGCCACCGCGGTTAAACCTAGGGGAAAGCTCGAATTATGCCTACACCGCCCGTCACTCTTGCGGAGGGACTTCGCACTCACG ATGGATACGCTC GCCAGACGTTGATTAAGCTTAGTTAACCCCCATGGTAAGTGTACCGGAAGTGCGTGCACGGTTCCTGCACTGATCGACATATATGATACTGGGATTAGATACCCCACTAT; Internal standard DNA fragment 3 includes: TCGTGCCAGCCACCGCGGTTAAACCTAGGGGAAAGCTCGAATTATGCCTACACCGCCCGTCACTCTTGCGGAGGGACTTCGCACTCACG CAACTCATCGTA GCCAGACGTTGATTAAGCTTAGTTAACCCCCATGGTAAGTGTACCGGAAGTGCGTGCACGGTTCCTGCACTGATCGACATATATGATACTGGGATTAGATACCCCACTAT.

Images