A recombinant canine interleukin-2 fusion protein and its preparation method and application

Abstract

The present invention belongs to the technical field of canine interleukin 2 recombinant protein, and specifically relates to a recombinant canine interleukin 2 fusion protein and its preparation method and application. According to the structure and biological activity-related sites of the protein, the present invention induces canine lymphocytes by mitogen lectin and concanavalin A, obtains canine interleukin 2 mature peptide by RT-PCR method and PCR method, performs codon preference modification on the obtained canine interleukin 2 mature peptide CaIL2-H, mutants CaIL2-mut1-H, CaIL2-mut2-H, and CaIL2-mut3-H, and uses a Pichia pastoris expression system to secrete and express a long-acting recombinant canine interleukin 2 fusion protein and its mutants with high biological activity and high yield after moderate glycosylation modification, thereby solving the problems of inclusion body formation, short half-life and low expression level in the existing Escherichia coli expression system.

Description

Technical Field

[0001] The invention belongs to the technical field of canine interleukin 2 recombinant protein, and specifically relates to a recombinant canine interleukin 2 fusion protein and a preparation method and application thereof. Background Art

[0002] At present, the research on IL-2 is mainly focused on humans, pigs, chickens, geese, cattle, sheep, goats, dogs, horses and mice. Among them, human genetic engineering recombinant IL-2 has played an important role in the treatment of viral diseases, autoimmune diseases, tumors and as a vaccine immunopotentiator. Many researchers use IL-2 as an immune adjuvant to improve the immune effect of vaccines. It can not only be used as an immune adjuvant with vaccines to significantly improve the protective effect, but can even be used as a therapeutic drug in combination with some anti-disease drugs to significantly improve the efficacy. Although IL-2 is a multifunctional cytokine containing sugar groups, practice shows that glycosylation or not basically does not affect the activity of IL-2. Studies on the cross-action of IL-2 in different animals have shown that IL-2 has certain species specificity and certain rules, and is generally downward, that is, IL-2 of animals with a high degree of evolution can act on animals with a low degree of evolution.

[0003] Literature data shows that dogs are more likely to develop tumors than cats. Common tumors in dogs are often found in the mammary glands, skin and soft tissues, genitals and perianal areas. Tumors can occur in dogs of all breeds, and the incidence of tumors in small dogs is slightly higher than that in medium and large dogs. Among them, the incidence of tumors in Pekingese, hybrid dogs and poodles is higher than that in other breeds. Given the high incidence of tumor diseases in dogs, currently in clinical practice, benign tumor diseases can be removed by surgery, while there are currently no effective drugs available for malignant tumor diseases. In addition, there are studies and applications of radiotherapy, hormone therapy and chemotherapy in tumor diseases, but there are no consistent treatment guidelines.

[0004] At present, most of the research on canine IL-2 gene remains at the molecular level, and there are few reports on the function of IL-2 protein. It is an economical and efficient method to express and produce canine interleukin 2 through genetic engineering and related modern molecular biology techniques. In the study of cloning and expression of canine interleukin-2 gene (IL-2) by Wei Xiaofeng et al., the sequencing results of the clone were completely consistent with the canine DNA gene sequence reported in GenBank (sequence number CFU28141). The expressed protein was an inclusion body, and purification processes such as renaturation were required to prepare protein samples. The prepared recombinant canine IL-2 has the ability to promote the proliferation of canine lymphocytes. The canine interleukin 2 expressed and amplified in Pichia pastoris by Zhu Qian et al. and the sequencing results were completely consistent with the canine IL-2 gene sequence reported in GenBank (sequence number D30710) encoding the mature protein gene. In this study, the fermentation supernatant at different times was concentrated 10 times and then subjected to SDS-PAGE electrophoresis analysis to reveal visible bands. The expression level of this scheme is relatively low.

[0005] In view of the problems of E. coli expression inclusion body formation, complex purification process, short half-life and low expression in yeast expression system in the related research of canine interleukin 2, the development of long-acting canine interleukin 2 or its corresponding mutants, combined with the incidence of canine tumors and the blank period of the market, has a good market prospect and is of great significance to the industrial production of canine interleukin 2. Summary of the invention

[0006] In view of the above problems, the object of the present invention is to provide a recombinant canine interleukin-2 fusion protein and a preparation method and application thereof.

[0007] The technical contents of the present invention are as follows:

[0008] The present invention provides a canine interleukin-2 mature peptide protein, the amino acid sequence of which is shown in the sequence table SEQ ID NO.1;

[0009] The canine interleukin 2 mature peptide protein is obtained by inducing canine lymphocytes with mitogens phytohemagglutinin (PHA) and concanavalin A (ConA) through RT-PCR and PCR methods.

[0010] The present invention also provides a recombinant canine interleukin 2 fusion protein, wherein the recombinant canine interleukin 2 fusion protein includes canine interleukin 2 mature peptide fusion protein CaIL2-H and its mutants CaIL2-mut1-H, CaIL2-mut2-H and CaIL2-mut3-H;

[0011] The canine interleukin 2 mature peptide fusion protein CaIL2-H is obtained by fusing canine interleukin 2 mature peptide protein with histidine, and its amino acid sequence is shown in the sequence table SEQ ID NO.2;

[0012] The mutants CaIL2-mut1-H, CaIL2-mut2-H and CaIL2-mut3-H are obtained by mutating the amino acid sites of the canine interleukin 2 mature peptide fusion protein CaIL2-H, and their amino acid sequences are shown in the sequence table SEQ ID NO.3 to 5, respectively.

[0013] The present invention also provides a method for preparing a recombinant canine interleukin-2 fusion protein, comprising the following steps:

[0014] 1) Preparation of canine interleukin-2 mature peptide protein: canine lymphocytes were induced by mitogens phytohemagglutinin (PHA) and concanavalin A (ConA), and obtained by RT-PCR and PCR methods;

[0015] 2) Preparation of recombinant canine interleukin 2 fusion protein: fusing canine interleukin 2 mature peptide protein with histidine (SEQ ID NO.6) to obtain canine interleukin 2 mature peptide fusion protein CaIL2-H, and mutating the amino acid sites of canine interleukin 2 mature peptide protein CaIL2-H to obtain fusion protein mutants CaIL2-mut1-H, CaIL2-mut2-H, and CaIL2-mut3-H;

[0016] 3) Expression of fusion protein: The fusion protein canine interleukin 2 mature peptide protein CaIL2-H and mutants CaIL2-mut1-H, CaIL2-mut2-H, and CaIL2-mut3-H obtained in step 2) are modified by Pichia pastoris codon preference, and the target protein is expressed using the Pichia pastoris secretion expression system to obtain a recombinant plasmid;

[0017] The nucleic acid sequences of the fusion proteins after Pichia codon optimization are shown in the sequence listing as SEQ ID NOs. 7 to 10;

[0018] The expression vector of the Pichia pastoris secretory expression system includes one of pPICZαA, pPICZαB, pPICZαC, pPICZA, pPICZB, pPICZC, pGAPZαA, pGAPZαB, pGAPZαC, pGAPZA, pGAPZB, pGAPZC, pPIC3.5K, pPIC3K, pPIC9K, pPIC9, pHIL-S1, pYAM75P, pHIL-D2, pA0815, pHWO10, and Pichiapink-hc, preferably pPIC9K;

[0019] 4) Enzyme linearization and purification of recombinant plasmid;

[0020] 5) Electrotransformation of linearized plasmid with yeast to obtain recombinant yeast;

[0021] The yeast includes one of X33, KM71, KM71H, GS115, GS190, GS200, SMD1168, SMD1168H, SMD1163, Y-11430, M-G100-3, Pichiapink-1, Pichiapink-2, Pichiapink-3, and Pichiapink-4, preferably GS115;

[0022] 6) Identification, high copy screening and induced expression of recombinant yeast;

[0023] The identification primers used in the identification are as follows:

[0024] Upstream primer CaIL2-F (SEQ ID NO. 13): GCTCCCATTACGTCTTCCAGTAC;

[0025] Downstream primer CalI2-R (SEQ ID NO. 14): ATGATGGGTTAAGGTTGAGAAGATAG.

[0026] The high copy screening includes using methods such as high resistance pressure, HIS4 screening tag, Southern Blot, fluorescent quantitative PCR, etc., preferably using high G418 resistance to screen multi-copy strains with high G418 resistance;

[0027] 7) Purifying and recovering the fusion protein obtained by induced expression to obtain recombinant canine interleukin-2 fusion protein.

[0028] The present invention also provides an application of a recombinant canine interleukin 2 fusion protein, wherein the recombinant canine interleukin 2 fusion protein is applied to an anti-tumor drug.

[0029] The beneficial effects of the present invention are as follows:

[0030] The recombinant canine interleukin 2 fusion protein of the present invention, CaIL2-H and its mutants CaIL2-mut1-H, CaIL2-mut2-H and CaIL2-mut3-H have high expression levels in the Pichia pastoris secretion expression system, and the expressed protein is soluble, simplifying the production process; and has high biological activity, and the half-life is prolonged after being appropriately glycosylated by Pichia pastoris;

[0031] The preparation of the recombinant canine interleukin 2 fusion protein of the present invention is as follows: according to the structure and biological activity-related sites of the protein, canine lymphocytes are induced by mitogens phytohemagglutinin (PHA) and concanavalin A (ConA), canine interleukin 2 mature peptide is obtained by RT-PCR method and PCR method, codon preference modification is performed on the obtained canine interleukin 2 mature peptide and its mutant, and the long-acting recombinant canine interleukin 2 fusion protein and its mutant which are appropriately glycosylated and modified and have high biological activity and high yield are secreted and expressed by Pichia pastoris expression system, thereby solving the problems of inclusion body formation and short half-life in the existing Escherichia coli expression system and low expression amount in the existing yeast expression system. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 Schematic diagram for the construction of canine interleukin-2 mature peptide fusion protein and mutants;

[0033] Figure 2 This is the result of PCR identification of recombinant yeast solution;

[0034] Figure 3 This is the result of SDS-PAGE analysis of the supernatant of recombinant yeast induced expression;

[0035] Figure 4 This is the result of SDS-PAGE analysis of the purified sample of the supernatant of recombinant yeast induced expression;

[0036] Figure 5 This is the WB analysis result of the purified sample of the supernatant of the recombinant yeast induced expression;

[0037] Figure 6 This is a graph showing the results of biological activity assay of recombinant canine interleukin-2 fusion protein samples. DETAILED DESCRIPTION

[0038] The present invention is further described in detail below through specific implementation cases and accompanying drawings. It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of protection of the present invention. After reading the present invention, various equivalent forms of modifications to the present invention by those skilled in the art are all within the scope of the claims attached to this application.

[0039] Unless otherwise specified, all raw materials and reagents of the present invention are raw materials and reagents from the conventional market.

[0040] Example

[0041] 1) Synthesis of whole gene fragments and construction of recombinant plasmids

[0042] Canine lymphocytes were induced by mitogens phytohemagglutinin (PHA) and concanavalin A (ConA), and canine interleukin-2 mature peptide protein (having individual amino acid differences from the public sequence) was obtained by RT-PCR and PCR, and its amino acid sequence is shown in SEQ ID NO.1 in the sequence listing;

[0043] The isolation of canine lymphocytes and the induction of interleukin-2 are as follows:

[0044] (1) Blood was collected from the forelimb vein of a healthy dog ​​aseptically and placed in a sterile bottle containing 5% sodium citrate;

[0045] (2) Add 2 volumes of Hank's solution and mix gently;

[0046] (3) Take a sterile centrifuge tube, add 4 mL of lymphocyte separation solution, then slowly add an equal amount of blood diluent along the tube wall, centrifuge at 2000 rpm for 20 min, and the liquid in the tube will be separated into three layers, the upper layer is Hank's solution, the middle layer is lymphocyte separation solution, and the bottom layer is red blood cells. There is a thin white layer between the upper layer of Hank's solution and the lymphocyte separation solution, which is the separated lymphocytes;

[0047] (4) Aspirate the cells, wash twice with Hank's solution, wash once with RPMI1640 medium, resuspend the cells in RPMI1640 medium (containing 5% calf serum), and adjust the cell concentration to 5.0×10 6 / mL;

[0048] (5) Add 5 mg / mL ConA and 20 mg / mL (PHA) to the cell suspension to make the final concentrations of 5 μg / mL (ConA) and 20 μg / mL (PHA), and add 10000 IU / mL of double antibody solution to make the final concentration of 100 IU / mL;

[0049] (6) The cells were transferred to a plate and cultured in a carbon dioxide incubator at 5% CO2, 37°C for 18 h;

[0050] (7) The supernatant and induced lymphocytes were collected separately and used as templates for RT-PCR amplification of canine interleukin-2 mature peptide protein.

[0051] The obtained canine interleukin 2 mature peptide protein was fused with a histidine tag (6×His) (SEQ ID NO.6) to obtain a canine interleukin 2 mature peptide fusion protein CaIL2-H (SEQ ID NO.2), and the amino acid sites were mutated to obtain canine interleukin 2 mutants CaIL2-mut1-H (SEQ ID NO.3), CaIL2-mut2-H (SEQ ID NO.4), and CaIL2-mut3-H (SEQ ID NO.5);

[0052] The amino acid sequences of canine interleukin 2 mature peptide protein CaIL2, canine interleukin 2 mature peptide fusion protein (CaIL2-H) and mutants (CaIL2-mut1-H, CaIL2-mut2-H, CaIL2-mut3-H) were modified by Pichia pastoris codons, and the optimized nucleic acid sequences of canine interleukin 2 mature peptide fusion protein (CaIL2-H), mutants (CaIL2-mut1-H, CaIL2-mut2-H, CaIL2-mut3-H) and histidine were shown in the sequence table as SEQ ID As shown in NO.7-12, the whole gene was synthesized by Nanjing GenScript Biotechnology Co., Ltd. in the Pichia pastoris expression vector pPIC9K (it can also be one of pPICZαA, pPICZαB, pPICZαC, pPICZA, pPICZB, pPICZC, pGAPZαA, pGAPZαB, pGAPZαC, pGAPZA, pGAPZB, pGAPZC, pPIC3.5K, pPIC3K, pPIC9, pHIL-S1, pYAM75P, pHIL-D2, pA0815, pHWO10, Pichiapink-hc), the cloning sites are EcoRI and NotI, and the recombinant gene structure constructed is as shown Figure 1 shown.

[0053] The fully synthesized plasmids pPIC9K-CaIL2-H, pPIC9K-CaIL2-mut1-H, pPIC9K-CaIL2-mut2-H, and pPIC9K-CaIL2-mut3-H were transformed into DH5α, and colonies were picked and inoculated into LB liquid medium containing 100 g / mL ampicillin, and cultured at 37°C and 250 rpm for 12 hours. The culture liquid was identified by PCR, and the culture of positive bacteria identified by PCR was picked for plasmid extraction and sequencing.

[0054] The PCR identification system and identification procedure are shown in Tables 1 and 2.

[0055] Table 1 PCR identification system

[0056]

[0057]

[0058] Table 2 PCR identification procedure

[0059]

[0060] 2) Enzyme linearization and purification of recombinant plasmid

[0061] Refer to the NEB enzyme digestion test manual, use SacI to digest each recombinant plasmid, and perform agarose gel electrophoresis to check whether the linearization is complete. Purify and recover the linearized product. The purification and recovery method refers to the kit instruction manual (OMEGA).

[0062] 3) Preparation of competent cells of Pichia pastoris GS115 (can also be one of X33, KM71, KM71H, GS115, GS190, GS200, SMD1168, SMD1168H, SMD1163, Y-11430, M-G100-3, Pichiapink-1, Pichiapink-2, Pichiapink-3, Pichiapink-4)

[0063] 3.1) Inoculate a single colony of the yeast recipient onto a YPD plate and culture at 30°C for 2 days;

[0064] 3.2) Pick a single colony from the plate and inoculate it into 10 mL of YPD liquid medium and shake it overnight at 30°C;

[0065] 3.3) After overnight culture, inoculate about 1% of the inoculum into 100 mL YPD medium and shake culture until the OD value is 1.2-1.5;

[0066] 3.4) Centrifuge at 4°C, 5000 rpm for 5 min to collect the precipitated cells, and resuspend them in 100 mL of pre-cooled sterile water;

[0067] 3.5) Centrifuge at 4°C, 5000 rpm for 10 min to collect the precipitated cells, and resuspend them in 100 mL of pre-cooled sterile water;

[0068] 3.6) Centrifuge again at 4°C, 5000 rpm for 10 min to collect the precipitated cells, and resuspend the cells in 100 mL of pre-cooled sterile water;

[0069] 3.7) Wash once with 20 mL, 1 mol / L sorbitol;

[0070] 3.8) Dissolve the bacterial cells in 1 mL of 1 M pre-cooled sorbitol without adding glycerol and place at -80°C for several hours until transformation.

[0071] 4) Electroconversion

[0072] 4.1) Prepare 80L of competent yeast and mix with 1-5g of linearized plasmid (precooled on ice for 15min), quickly put into a 0.2cm electric shock cup (precooled and sterilized on ice), and electroporate; the electroporation parameters are Voltage: 1500V; Capacitance: 25μF; Resistance: 200Ω; Cuvette (mm): 2mm;

[0073] 4.2) After the electroporation, add 1 mL of sorbitol (1 M) quickly, place on ice for 15 min, and then place in a 30°C incubator for 1 h. Add 1 mL of YPD liquid culture medium, shake and culture at 30°C, 200 r / min for 1 h, collect the cells by centrifugation at room temperature, 4000 r / min, and spread on a YPDS plate containing 0.5 mg / mL of G418 and culture for 3 days.

[0074] 5) Identification of recombinant yeast and screening of high-copy

[0075] A single colony with G418 resistance growing on a YPDS plate was carefully picked with a sterilized pipette tip and inoculated into 1 mL of YPD liquid medium (containing 0.5 mg / mL G418), and cultured overnight at 30°C and 200 r / min with shaking. P. pastoris transformants were analyzed by bacterial liquid PCR, and 1% agarose gel electrophoresis was performed to identify clones that could amplify the target band with the identification primers as positive transformants. The recombinant yeast bacterial liquid PCR identification system and procedure are shown in Tables 3 and 4.

[0076] Table 3 PCR identification system

[0077]

[0078] Table 4 PCR identification procedure of recombinant yeast solution

[0079]

[0080] In the table, the upstream primer CaIL2-F (SEQ ID NO. 13): GCTCCCATTACGTCTTCCAGTAC;

[0081] Downstream primer CalI2-R (SEQ ID NO. 14): ATGATGGGTTAAGGTTGAGAAGATAG.

[0082] The screening of high copies needs to be combined with the band brightness in PCR identification and the test results of high-resistance YPD plates (0.5-4 mg / mL G418). The screening of high-resistance recombinant yeast was streaked on different G418-resistant YPD plates according to the table.

[0083] The PCR product was detected by 1% agarose gel electrophoresis, and a specific band appeared below 500 bp. Figure 2 (M: DNA Marker (5000bp); 1-3: pPIC9K-CaIL2-H-GS115; 4-6: pPIC9K-CaIL2-mut1-H-GS115; 7-9: pPIC9K-CaIL2-mut2-H-GS115; 10-12: pPIC9K-CaIL2-mut3-H-GS115), which is consistent with the theoretical value (423bp). The results showed that the genes of CaIL2-H and its mutants (CaIL2-mut1-H, CaIL2-mut2-H, and CaIL2-mut3-H) were successfully integrated into the genomic DNA of the host bacteria.

[0084] 6) Inducible expression of high-copy recombinant yeast

[0085] 6.1) Use a sterile pipette tip to carefully pick a high-copy single colony with G418 resistance growing on the YPD plate, and place it in 20 mL of BMGY liquid culture medium for activation culture. Shake at 30°C, 200 rpm overnight until the OD600 is 2-6, at which time the cells are in the logarithmic growth phase.

[0086] 6.2) Collect the precipitate by centrifugation at 3000 rpm for 5 min at room temperature, resuspend it in 1 mL of BMMY medium, continue shaking culture, wrap it with four layers of clean gauze and two layers of newspaper, and shake culture it in a 15 mL test tube.

[0087] 6.3) Add 100% methanol to a final concentration of 1% every 24 hours for induction culture.

[0088] 6.4) After 72 hours of culture, collect samples, centrifuge, and take the supernatant for SDS-PAGE and Western blot analysis immediately, or store at -80°C.

[0089] SDS-PAGE analysis was performed on 5% concentrated gel and 12% separation gel, and a protein band appeared near 20 kDa. Figure 3(M: Protein Marker (14.4-97.4kDa); 1-2: pPIC9K-CaIL2-H-GS115; 3-4: pPIC9K-CaIL2-mut1-H-GS115; 5-6: pPIC9K-CaIL2-mut2-H-GS115; 7-8: pPIC9K-CaIL2-mut3-H-GS115). The experiment showed that the CaIL2-H and its mutants (CaIL2-mut1-H, CaIL2-mut2-H, CaIL2-mut3-H) genes were successfully expressed in high yields in the Pichia pastoris system.

[0090] 7) Purification and recovery of expression products

[0091] The supernatant of the shake flask culture was purified by nickel column affinity chromatography and dialyzed; the purified and recovered samples were analyzed by SDS-PAGE, and a protein band appeared near 20 kDa. The results are shown in Figure 4 (M: Protein Marker (14.4-97.4Da); 1: pPIC9K-CaIL2-H-GS115; 2: pPIC9K-CaIL2-mut1-H-GS115; 3: pPIC9K-CaIL2-mut2-H-GS115; 4: pPIC9K-CaIL2-mut3-H-GS115). Western blot analysis (primary antibody: Anti-His Tag Mouse Monoclonal Antibody; secondary antibody: HRP Goat Anti-Mouse IgG) showed a specific protein band around 20kDa. The results are shown in Figure 5 (M: Protein Marker (14-100kDa); 1: pPIC9K-CaIL2-H-GS115; 2: pPIC9K-CaIL2-mut1-H-GS115; 3: pPIC9K-CaIL2-mut2-H-GS115; 4: pPIC9K-CaIL2-mut3-H-GS115). Comparison of the SDS-PAGE and Western blot band sizes showed that the size of the protein was slightly larger than the expected size of 17kDa, indicating that Pichia pastoris had moderately glycosylated CaIL2-H and its mutants (CaIL2-mut1-H, CaIL2-mut2-H, and CaIL2-mut3-H).

[0092] 8) Biological activity analysis

[0093] 8.1) Cell resuscitation: cryopreserved mouse T lymphocytes CTLL-2 were revived by rapidly shaking and thawing the cryotube containing 1 mL of cell suspension in a 37°C water bath, adding 5 mL of culture medium and mixing evenly, centrifuging at 1000 rpm for 5 minutes, discarding the supernatant, adding 4-6 mL of complete culture medium and blowing evenly, and then adding all the cell suspension to a culture flask and culturing overnight;

[0094] The next day, change the medium and check the cell density. If the cell density reaches 80% to 90%, subculture can be performed.

[0095] 8.2) Cell passaging: Cells were cultured in complete medium at 37°C and 5% carbon dioxide for 48 to 60 hours until sufficient volume was obtained for the determination of recombinant interleukin-2 biological activity;

[0096] CTLL-2 cells were collected by centrifugation, washed three times with RPMI 1640 culture medium, and then resuspended in basal culture medium to prepare 6.0×10 5 The cell suspension of 10 cells was stored at 37°C and 5% carbon dioxide for later use;

[0097] In a 96-well cell culture plate with standard solution and test solution, add 50 μL of cell suspension to each well and culture at 37°C and 5% carbon dioxide for 18 to 24 hours;

[0098] 8.3) Preparation of standard solution: Take the national standard for the biological activity assay of recombinant human interleukin-2, reconstitute it according to the instructions, dilute it with basic culture medium to 200 IU per 1 mL, and make a 2-fold serial dilution in a 96-well cell culture plate, with a total of 8 dilutions, 2 wells for each dilution, and keep 50 μL of standard solution in each well, and discard the excess solution in the well. The above operations are carried out under sterile conditions;

[0099] 8.4) Preparation of test solution: After re-dissolving the test sample according to the labeled amount, dilute it with basal culture medium to about 200 IU per 1 mL (equivalent to 0.02 g / mL). In a 96-well cell culture plate, make a 2-fold serial dilution, a total of 8 dilutions, and make 2 wells for each dilution. Keep 50 liters of test solution in each well and discard the excess solution in the well;

[0100] The above operations were performed under sterile conditions;

[0101] Then, 20 μL of MTT solution was added to each well, and after incubation at 37°C and 5% carbon dioxide for 4 to 6 hours, 150 μL of lysis solution was added to each well, and incubated at 37°C and 5% carbon dioxide for 18 to 24 hours;

[0102] All the above operations were performed under sterile conditions;

[0103] Mix the liquid in the cell plate, put it into the microplate reader, use 630nm as the reference wavelength, measure the absorbance at a wavelength of 570nm, and record the measurement results.

[0104] The test data are processed using a computer program or a four-parameter regression method, and the results are calculated as follows:

[0105] Biological activity of the test article

[0106] Where, Pr is the biological activity of the standard, IU / mL;

[0107] Ds is the pre-dilution multiple of the test product;

[0108] Dr is the pre-dilution multiple of the standard;

[0109] Es is the dilution multiple of the test sample equivalent to the half-effective dose of the standard sample;

[0110] Er is the dilution multiple of the half-effective dose of the standard.

[0111] The results are as follows Figure 6 As shown, it can be seen that the recombinant canine interleukin-2 fusion protein of the present invention can effectively stimulate the growth of T lymphocytes and has relatively excellent biological activity.

[0112] 9) Antitumor activity

[0113] Literature data show that the incidence of tumors in dogs is 6 times that of cats in terms of breed: skin and connective tissue tumors account for 67.7%, and breast cancer in female dogs and perianal adenomas in male dogs account for 1 / 3 of all tumors in dogs. Canine mammary tumors are one of the common tumors in dogs, and are the most likely tumors to occur in female dogs. The incidence and mortality rates have always been high, and the incidence rate is about 1.988‰. The present invention treats female mammary tumors and perianal adenomas in male dogs collected clinically, with 5 dogs in each group.

[0114] The purified CaIL2-H and its mutants (CaIL2-mut1-H, CaIL2-mut2-H, and CaIL2-mut3-H) were subcutaneously injected at 10,000 IU / kg for 28 consecutive days. The blank control group was injected with an equal amount of normal saline. The treatment status of the tumor at different time points during the treatment cycle was observed. The grouping and treatment effects are shown in Table 6.

[0115] Table 6 The therapeutic effect of canine interleukin-2 samples on mammary tumors in female dogs and perianal adenomas in male dogs

[0116]

[0117]

[0118] 10) Determination of half-life

[0119] The concentration of canine interleukin 2 (IL-2) in plasma was quantitatively determined in vitro using a canine interleukin 2 (IL-2) enzyme-linked immunosorbent assay (ELISA) kit. Healthy adult beagles were selected, with 5 dogs in each sample group, and were used to determine the half-life of canine interleukin 2 after passing quarantine. The purified CaIL2-H and its mutants (CaIL2-mut1-H, CaIL2-mut2-H, and CaIL2-mut3-H) were subcutaneously injected into beagles at 10,000 IU / kg, and 0.5 mL of blood samples were collected from each group and stored at -80°C. The blood collection time was before the first injection and 30 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 8 hours, and 12 hours after the injection. DAS pharmacokinetic software was used for curve fitting and calculation of relevant parameters. The data are shown in Table 7.

[0120] Table 7 Determination of half-life of canine interleukin-2 samples

[0121]

[0122] The results showed that the plasma half-life of Calil2-H and its mutants (CaIL2-mut1-H, Calil2-mut2-H, Calil2-mut3-H) in the present invention was much higher than the 2.3 h reported in the literature.

Claims

1. A recombinant canine interleukin-2 fusion protein, characterized in that: The recombinant canine interleukin-2 fusion protein is a mutant CaIL2-mut1-H, CaIL2-mut2-H or CaIL2-mut3-H, and the amino acid sequences are shown in the sequence table SEQ ID NO.3-5 respectively.

2. A method for preparing the recombinant canine interleukin-2 fusion protein according to claim 1, characterized in that: The steps include: 1) Preparation of canine interleukin-2 mature peptide protein: canine lymphocytes were induced by mitogens lectin and concanavalin A, and obtained by RT-PCR and PCR methods; 2) Preparation of recombinant canine interleukin 2 fusion protein: the canine interleukin 2 mature peptide protein with an amino acid sequence as shown in SEQ ID NO.1 in the sequence table was fused with histidine to obtain the canine interleukin 2 mature peptide fusion protein CaIL2-H, and the fusion protein mutants CaIL2-mut1-H, CaIL2-mut2-H and CaIL2-mut3-H were obtained by mutating the amino acid sites of the canine interleukin 2 mature peptide protein CaIL2-H; The amino acid sequences of the fusion protein mutants CaIL2-mut1-H, CaIL2-mut2-H and CaIL2-mut3-H are shown in the sequence listing SEQ ID NOs. 3 to 5, respectively; 3) Expression of fusion protein: The obtained mutants CaIL2-mut1-H, CaIL2-mut2-H, and CaIL2-mut3-H were modified by Pichia pastoris codon preference, and the target protein was expressed using the Pichia pastoris secretion expression system to obtain recombinant plasmids; 4) Enzyme linearization and purification of recombinant plasmid; 5) Electrotransformation of linearized plasmid into yeast to obtain recombinant yeast; 6) Identification, high copy screening and induced expression of recombinant yeast; 7) Purify and recover the fusion protein obtained by induced expression to obtain recombinant canine interleukin-2 fusion protein.

3. The method for preparing the recombinant canine interleukin-2 fusion protein according to claim 2, characterized in that: Step 3) The nucleic acid sequence of the fusion protein after Pichia pastoris codon optimization is shown in the sequence listing SEQ ID NOs. 9 to 11.

4. The method for preparing the recombinant canine interleukin-2 fusion protein according to claim 2, characterized in that: Step 3) The expression vector of the Pichia pastoris secretory expression system includes one of pPICZαA, pPICZαB, pPICZαC, pPICZA, pPICZB, pPICZC, pGAPZαA, pGAPZαB, pGAPZαC, pGAPZA, pGAPZB, pGAPZC, pPIC3.5K, pPIC3K, pPIC9K, pPIC9, pHIL-S1, pYAM75P, pHIL-D2, pA0815, pHWO10, and Pichiapink-hc.

5. The method for preparing the recombinant canine interleukin-2 fusion protein according to claim 2, characterized in that: Step 5) The yeast includes one of X33, KM71, KM71H, GS115, GS190, GS200, SMD1168, SMD1168H, SMD1163, Y-11430, M-G100-3, Pichiapink-1, Pichiapink-2, Pichiapink-3, and Pichiapink-4.

6. The method for preparing the recombinant canine interleukin-2 fusion protein according to claim 2, characterized in that: Step 6) The identification primers used in the identification are as follows: Upstream primer CaIL2-F: GCTCCCATTACGTCTTCCAGTAC; Downstream primer Calil2-R: ATGATGGGTTAAGGTTGAGAAGATAG.

7. The method for preparing the recombinant canine interleukin-2 fusion protein according to claim 2, characterized in that: The high-copy screening includes using high G418 resistance to screen out multi-copy strains with high G418 resistance.

8. An application of the recombinant canine interleukin-2 fusion protein according to claim 1, characterized in that: The recombinant canine interleukin-2 fusion protein is used for preparing anti-canine tumor drugs, and the canine tumors are mammary tumors and perianal adenomas.

Images