A KASP molecular marker specific to chromosome 4E of Elytrimus elongatus and its application

Abstract

The present invention belongs to the field of molecular biology, and specifically relates to a KASP molecular marker specific to chromosome 4E of Elymus elongatus and its application. The specific technical scheme is: including any one or more of KASP molecular markers TWK4ES‑1, TWK4ES‑3, TWK4ES‑4 on the short arm of chromosome 4E and KASP molecular markers TWK4EL‑2, TWK4EL‑5, TWK4EL‑6, TWK4EL‑7, TWK4EL‑8, and TWK4EL‑9 on the long arm of chromosome 4E. The molecular markers provided by the present invention have good genetic stability and high resolution, and provide a powerful tool for high-throughput detection and tracking of Elymus elongatus 4E chromosomes from different sources under different wheat backgrounds, and accelerating the transfer and utilization of excellent genes on Elymus elongatus 4EL or 4ES, and can be applied to wheat chromosome engineering breeding and molecular marker-assisted selection breeding.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and in particular relates to a 4E chromosome-specific KASP molecular marker of Thinopyrum elongatum and an application thereof. Background Art

[0002] Wheat is one of the most important food crops in the world. Traditional hybrid breeding has led to a narrowing of the genetic base of wheat varieties, greatly reducing the diversity of genetic resources available for breeding; emerging diseases and climate change pose a serious threat to the safe production of wheat. Wheat related species such as rye and villous wheat have various excellent characteristics such as cold resistance, drought resistance, salt and alkali tolerance, and resistance to a variety of wheat diseases (fusarium head blight, rust, powdery mildew, etc.), and are valuable genetic resources for wheat genetic improvement. Therefore, transferring excellent genes carried by wild related species to common wheat through interspecific distant hybridization is an effective way to solve the problem of the narrowing of the genetic base of wheat varieties.

[0003] Thinopyrum elongatum (Host) DRDewey is a perennial plant of the Poaceae family, the Triticeae family, and the Thinopyrum genus. It includes multiple species with different chromosome ploidies, and the basic chromosome set is E. Currently, the main species identified are diploid (2n=2x=14, E1E1), tetraploid (2n=4x=28, E1E1E2E2) and decaploid (2n=10x=70, E1E1E2E2E3E3E4E4E5E5) Thinopyrum elongatum. Thinopyrum elongatum has many important excellent agronomic traits such as high yield (large spikes and many flowers and grains), disease resistance (leaf rust, stripe rust, stem rust, powdery mildew, gibberellosis and yellow dwarf disease, etc.), stress resistance (cold resistance, drought resistance, salinity, moisture resistance and barrenness resistance) and high protein, and is an excellent candidate species for broadening the wheat gene pool. For example, the ergot resistance genes on chromosomes 1E and 7E of Elytrimus elongatus have been successfully used to breed new wheat varieties resistant to ergot. Chromosomes 3E and 5E may contain salt-tolerance genes, chromosomes 2E and 4E carry genes that enhance wheat photosynthesis, chromosomes 4E and 6E contain genes for resistance to low-phosphorus nutritional stress, and chromosome 5E contains genes that inhibit low-phosphorus stress.

[0004] Molecular markers are effective tools for identifying distant hybridization germplasm of wheat. They can quickly and accurately identify and track exogenous genetic material introduced into the wheat background, thereby accelerating the large-scale screening of excellent germplasm resources and effectively improving the efficiency of molecular marker-assisted selection breeding. At present, many types of chromosome-specific molecular markers of Elymus longissima have been developed for diploid, tetraploid and decaploid Elymus longissima. However, they are all molecular marker technologies based on laboratory gel electrophoresis to detect polymorphisms of PCR amplified fragments, which cannot achieve automated and platform-based screening, and are not universal between Elymus longissima species with different ploidy. They are difficult to be widely used in large-scale identification and screening of Elymus longissima hybrid breeding offspring groups from different sources, which hinders the effective development and application of excellent genetic resources of Elymus longissima.

[0005] Single Nucleotide Polymorphisms (SNP) refers to DNA sequence polymorphism caused by the variation (conversion, transversion, deletion and insertion) of a single nucleotide at the genomic level. SNP has the advantages of high genetic stability, abundant sites, wide distribution, and suitability for high-throughput analysis and detection. It has become the third-generation molecular marker and has greatly improved the selection efficiency of target sites. KASP marker is a SNP genotyping method based on competitive allele-specific PCR (Kompetitive Allele-Specific PCR, KASP) technology. It has the characteristics of high throughput, low cost, good genetic stability, and automated data collection. It can quickly and accurately achieve genotyping in a high-throughput and platform-based manner.

[0006] At present, the research on the use of KASP-based high-throughput SNP typing technology for the identification of exogenous genetic material in wheat background is still in its infancy, and specific KASP markers for chromosome 4E carrying excellent genes have not yet been reported. Summary of the invention

[0007] The purpose of the present invention is to provide a KASP molecular marker specific to chromosome 4E of Elytrimus elongatus and its application.

[0008] To achieve the above-mentioned object of the invention, the technical solution adopted by the present invention is: a KASP molecular marker of chromosome 4E of Elymus elongatus, including any one or more of KASP molecular markers TWK3EL1, TWK4EL-2, TWK4EL-5, TWK4EL-6, TWK4EL-7, TWK4EL-8, and TWK4EL-9;

[0009] The KASP molecular marker TWK4ES-1 includes a wheat allele forward primer 4ES-1F1, whose nucleotide sequence is shown in SEQ ID NO: 1, a thin spike allele forward primer 4ES-1F2, whose nucleotide sequence is shown in SEQ ID NO: 2, and a common reverse primer 4ES-1R, whose nucleotide sequence is shown in SEQ ID NO: 3;

[0010] The KASP molecular marker TWK4EL-2 includes a wheat allele forward primer 4EL-2F1, whose nucleotide sequence is shown in SEQ ID NO: 4, a thin spike allele forward primer 4EL-2F2, whose nucleotide sequence is shown in SEQ ID NO: 5, and a common reverse primer 4EL-2R, whose nucleotide sequence is shown in SEQ ID NO: 6;

[0011] The KASP molecular marker TWK4ES-3 includes a wheat allele forward primer 4ES-3F1, whose nucleotide sequence is shown in SEQ ID NO: 7, a thin spike allele forward primer 4ES-3F2, whose nucleotide sequence is shown in SEQ ID NO: 8, and a common reverse primer 4ES-3R, whose nucleotide sequence is shown in SEQ ID NO: 9;

[0012] The KASP molecular marker TWK4ES-4 includes a wheat allele forward primer 4ES-4F1, whose nucleotide sequence is shown in SEQ ID NO: 10, a thin spike allele forward primer 4ES-4F2, whose nucleotide sequence is shown in SEQ ID NO: 11, and a common reverse primer 4ES-4R, whose nucleotide sequence is shown in SEQ ID NO: 12;

[0013] The KASP molecular marker TWK4EL-5 includes a wheat allele forward primer 4EL-5F1, whose nucleotide sequence is shown in SEQ ID NO: 13, a thin spiked elytris allele forward primer 4EL-5F2, whose nucleotide sequence is shown in SEQ ID NO: 14, and a common reverse primer 4EL-5R, whose nucleotide sequence is shown in SEQ ID NO: 15;

[0014] The KASP molecular marker TWK4EL-6 includes a wheat allele forward primer 4EL-6F1, whose nucleotide sequence is shown in SEQ ID NO: 16, a thin spike allele forward primer 4EL-6F2, whose nucleotide sequence is shown in SEQ ID NO: 17, and a common reverse primer 4EL-6R, whose nucleotide sequence is shown in SEQ ID NO: 18;

[0015] The KASP molecular marker TWK4EL-7 includes a wheat allele forward primer 4EL-7F1, whose nucleotide sequence is shown in SEQ ID NO: 19, a thin spike allele forward primer 4EL-7F2, whose nucleotide sequence is shown in SEQ ID NO: 20, and a common reverse primer 4EL-7R, whose nucleotide sequence is shown in SEQ ID NO: 21;

[0016] The KASP molecular marker TWK4EL-8 includes a wheat allele forward primer 4EL-8F1, whose nucleotide sequence is shown in SEQ ID NO: 22, a thin spike allele forward primer 4EL-8F2, whose nucleotide sequence is shown in SEQ ID NO: 23, and a common reverse primer 4EL-8R, whose nucleotide sequence is shown in SEQ ID NO: 24;

[0017] The KASP molecular marker TWK4EL-9 includes a wheat allele forward primer 4EL-9F1, whose nucleotide sequence is shown in SEQ ID NO: 25, a thin spiked elytra allele forward primer 4EL-9F2, whose nucleotide sequence is shown in SEQ ID NO: 26, and a common reverse primer 4EL-9R, whose nucleotide sequence is shown in SEQ ID NO: 27.

[0018] Preferably, the KASP molecular marker consists of any one or more of TWK4EL-2, TWK4EL-7, TWK4EL-8, and TWK4EL-9.

[0019] Accordingly, a method for identifying whether a plant contains the 4EL and 4ES chromosomes of Elymus elongatus by using the primers corresponding to the KASP molecular marker of the 4E chromosome of Elymus elongatus comprises the following steps:

[0020] (1) Extracting DNA from the sample to be tested as a template; (2) Using primers corresponding to the KASP molecular markers to perform PCR amplification on the DNA template to obtain amplified products; (3) Analyzing the amplified products.

[0021] Preferably, the amplification system of the PCR amplification in step (2) is: 1 μL of 100 ng / μL DNA, 5 μL of 2×KASPMaseter Mix, 0.7 μL of primer mixture, 3.3 μL of ddH2O, and a total system of 10 μL;

[0022] The primer mixture is prepared by mixing 0.4 μL of a 10 μM common reverse primer, 0.15 μL of a wheat allele forward primer, and 0.15 μL of a thinwort allele forward primer evenly.

[0023] Preferably, the amplification program of the PCR amplification in step (2) is: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, gradient annealing and extension at 65.7°C for 1 min, 10 cycles, with the annealing and extension temperature decreasing by 0.7°C in each cycle; denaturation at 94°C for 20 s, annealing and extension at 57°C for 1 min, 42 cycles.

[0024] Correspondingly, a detection / identification reagent, a detection / identification kit, and a detection / identification test paper containing primers corresponding to the KASP molecular marker of the Elymus elongatus 4E chromosome.

[0025] Correspondingly, the detection / identification reagent, detection / identification kit, and detection / identification test paper are prepared using the primers corresponding to the KASP molecular marker of the Elymus elongatus 4E chromosome.

[0026] Correspondingly, the primers corresponding to the KASP molecular marker on chromosome 4E of Elytrimus elongatus are used in wheat breeding.

[0027] Preferably, the invention is used for enhancing photosynthesis of wheat.

[0028] Preferably, the method is used for identifying whether the Elymus elongatus 4EL or 4ES chromosome exists in wheat-Elymus elongatus material.

[0029] The invention has the following beneficial effects: the invention uses the second-generation sequencing technology to perform transcriptome sequencing on two tetraploid and decaploid species of Elymus longispinus containing an E chromosome group, obtains 100% identical conservative sequences of three species of Elymus longispinus through multiple sequence comparisons, and then identifies and screens SNP sites on the short arm 4ES and long arm 4EL of chromosome 4E of Elymus longispinus that are specific to the wheat genome based on the Chinese Spring reference genome (IWGSC CS RefSeq v2.1) and the diploid Elymus longispinus reference genome (ASM1179987v1), thereby providing sufficient target sites for the development of KASP markers specific to chromosome 4E. According to these loci, the present invention develops chromosome arm-specific codominant KASP markers TWK4ES-1, TWK4EL-2, TWK4ES-3, TWK4ES-4, TWK4EL-5, TWK4EL-6, TWK4EL-7, TWK4EL-8, and TWK4EL-9 for the first time. All KASP markers were verified in different wheat varieties, diploid Elymus elongatus, tetraploid Elymus elongatus, and wheat-Elymus elongatus introgression lines, and all were correctly typed and accurate. Among them, four KASP markers TWK4E-L2, TWK4EL-7, TWK4EL-8, and TWK4EL-9 can be used for chromosome typing of Elymus elongatus 4E in three different ploidy.

[0030] In summary, the SNP mining method and KASP marker development technology specific to chromosome E of the present invention are completely feasible and have a high success rate. They can accurately identify the long arm or short arm of the introduced exogenous chromosome, and can also detect small fragments of the exogenous chromosome containing the target SNP site, and develop a set of (9) co-dominant KASP markers evenly distributed on chromosome 4E for the first time based on these sites. The SNP sites targeted by the KASP markers developed by the present invention are conservative between different ploidy long-spiked Elymus and different wheat varieties, providing a universal molecular marker selection technology for efficiently transferring and utilizing the excellent traits on chromosome 4E of Elymus from different sources, and quickly transferring exogenous excellent genes to different wheat backgrounds. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 Schematic diagram of the distribution of the 9 SNPs selected for the present invention on chromosome 4E;

[0032] Figure 2 This is a schematic diagram of the typing results of the test materials identified by the molecular marker TWK4ES-1;

[0033] Figure 3 This is a schematic diagram of the typing results of the test materials identified by the molecular marker TWK4EL-2;

[0034] Figure 4 This is a schematic diagram of the typing results of the test materials identified by the molecular marker TWK4EL-7;

[0035] Figure 5 This is a schematic diagram of the typing results of the test materials identified by the molecular marker TWK4EL-8;

[0036] Figure 6 This is a schematic diagram of the typing results of the test materials identified by the molecular marker TWK4EL-9. DETAILED DESCRIPTION

[0037] The present invention provides a specific KASP molecular marker for chromosome 4E of Elymus longispinus. The KASP molecular marker is developed based on SNP sites on the long arm 4EL and short arm 4ES of chromosome 4E that are specific to the wheat genome, and specifically includes any one or more of the specific co-dominant KASP molecular markers of the short arm 4ES of chromosome 4E: TWK4ES-1, TWK4ES-3, TWK4ES-4 and the specific co-dominant KASP molecular markers of the long arm 4EL of chromosome 4E: TWK4EL-2, TWK4EL-5, TWK4EL-6, TWK4EL-7, TWK4EL-8, and TWK4EL-9. A preferred embodiment is that the KASP molecular marker includes any one or more of TWK4E-L2, TWK4EL-7, TWK4EL-8, and TWK4EL-9.

[0038] The KASP molecular marker TWK4ES-1 includes a wheat allele forward primer 4ES-1F1 (its nucleotide sequence is shown in SEQ ID NO: 1), a long-spiked elytrium allele forward primer 4ES-1F2 (its nucleotide sequence is shown in SEQ ID NO: 2) and a common reverse primer 4ES-1R (its nucleotide sequence is shown in SEQ ID NO: 3). The KASP molecular marker TWK4EL-2 includes a wheat allele forward primer 4EL-2F1 (its nucleotide sequence is shown in SEQ ID NO: 4), a long-spiked elytrium allele forward primer 4EL-2F2 (its nucleotide sequence is shown in SEQ ID NO: 5) and a common reverse primer 4EL-2R (its nucleotide sequence is shown in SEQ ID NO: 6). The KASP molecular marker TWK4ES-3 includes a wheat allele forward primer 4ES-3F1 (its nucleotide sequence is shown in SEQ ID NO: 7), a long-spiked elytrium allele forward primer 4ES-3F2 (its nucleotide sequence is shown in SEQ ID NO: 8) and a common reverse primer 4ES-3R (its nucleotide sequence is shown in SEQ ID NO: 9). The KASP molecular marker TWK4ES-4 includes a wheat allele forward primer 4ES-4F1 (its nucleotide sequence is shown in SEQ ID NO: 10), a long-spiked elytrium allele forward primer 4ES-4F2 (its nucleotide sequence is shown in SEQ ID NO: 11) and a common reverse primer 4ES-4R (its nucleotide sequence is shown in SEQ ID NO: 12). The KASP molecular marker TWK4EL-5 includes a wheat allele forward primer 4EL-5F1 (its nucleotide sequence is shown in SEQ ID NO: 13), a long-spiked elytrium allele forward primer 4EL-5F2 (its nucleotide sequence is shown in SEQ ID NO: 14) and a common reverse primer 4EL-5R (its nucleotide sequence is shown in SEQ ID NO: 15). The KASP molecular marker TWK4EL-6 includes a wheat allele forward primer 4EL-6F1 (its nucleotide sequence is shown in SEQ ID NO: 16), a long-spiked elytrium allele forward primer 4EL-6F2 (its nucleotide sequence is shown in SEQ ID NO: 17) and a common reverse primer 4EL-6R (its nucleotide sequence is shown in SEQ ID NO: 18). The KASP molecular marker TWK4EL-7 includes a wheat allele forward primer 4EL-7F1 (whose nucleotide sequence is shown in SEQ ID NO: 19), a thin spiked elytra allele forward primer 4EL-7F2 (whose nucleotide sequence is shown in SEQ ID NO: 20) and a common reverse primer 4EL-7R (whose nucleotide sequence is shown in SEQ ID NO: 21).The KASP molecular marker TWK4EL-8 includes a wheat allele forward primer 4EL-8F1 (its nucleotide sequence is shown in SEQ ID NO: 22), a long-spiked elytrium allele forward primer 4EL-8F2 (its nucleotide sequence is shown in SEQ ID NO: 23) and a common reverse primer 4EL-8R (its nucleotide sequence is shown in SEQ ID NO: 24). The KASP molecular marker TWK4EL-9 includes a wheat allele forward primer 4EL-9F1 (its nucleotide sequence is shown in SEQ ID NO: 25), a long-spiked elytrium allele forward primer 4EL-9F2 (its nucleotide sequence is shown in SEQ ID NO: 26) and a common reverse primer 4EL-9R (its nucleotide sequence is shown in SEQ ID NO: 27). The base direction of the above sequences is 5' to 3' from left to right. The specific sequences are shown in Table 1.

[0039] Table 1 Primer sequences corresponding to each molecular marker

[0040]

[0041]

[0042] The present invention also provides a method for identifying whether a wheat-Elygropyrum elongatum introgression line contains Elygropyrum elongatum 4EL and 4ES chromosomes using the KASP molecular marker, which specifically comprises the following steps:

[0043] 1. Extract DNA from the sample to be tested as a template.

[0044] 2. Use any one or several of the above KASP molecular marker corresponding primers to perform PCR amplification on the DNA template to obtain amplified products.

[0045] 3. Use a fluorescent quantitative PCR detector to analyze the genotype of the amplified product, collect fluorescent signals, and use the software QuantStudio Design & Analysis Software v1.5.1 to read the typing results. Among them, TWK4EL-2, TWK4EL-7, TWK4EL-8, and TWK4EL-9 can be used for accurate typing of three different ploidy (diploid, tetraploid, and decaploid) of Elymus longissima and wheat-Elymus longissima introductory lines, and TWK4ES-1, TWK4ES-3, TWK4ES-4, TWK4EL-5, and TWK4EL-6 can be used for accurate typing of two different ploidy (diploid, tetraploid) of Elymus longissima and wheat-Elymus longissima introductory lines.

[0046] When only base G is detected by KASP molecular marker TWK4ES-1, it is identified as containing the short arm of chromosome 4E; when only base T is detected by KASP molecular marker TWK4ES-1, it is identified as not containing the short arm of chromosome 4E; when bases G and T are detected simultaneously by KASP molecular marker TWK4ES-1, it is identified as containing the short arm of chromosome 4E in the wheat background;

[0047] When only base C is detected by KASP molecular marker TWK4EL-2, it is identified as containing the long arm of chromosome 4E; when only base T is detected by KASP molecular marker TWK4EL-2, it is identified as not containing the long arm of chromosome 4E; when bases C and T are detected simultaneously by KASP molecular marker TWK4EL-2, it is identified as containing the long arm of chromosome 4E in the wheat background;

[0048] When only base T is detected by KASP molecular marker TWK4ES-3, it is identified as containing the short arm of chromosome 4E; when only base C is detected by KASP molecular marker TWK4ES-3, it is identified as not containing the short arm of chromosome 4E; when bases T and C are detected simultaneously by KASP molecular marker TWK4ES-3, it is identified as containing the short arm of chromosome 4E in the wheat background;

[0049] When only base T is detected by KASP molecular marker TWK4ES-4, it is identified as containing the short arm of chromosome 4E; when only base C is detected by KASP molecular marker TWK4ES-4, it is identified as not containing the short arm of chromosome 4E; when bases T and C are detected simultaneously by KASP molecular marker TWK4ES-4, it is identified as containing the short arm of chromosome 4E in the wheat background;

[0050] When only base T is detected by KASP molecular marker TWK4EL-5, it is identified as containing the long arm of chromosome 4E; when only base C is detected by KASP molecular marker TWK4EL-5, it is identified as not containing the long arm of chromosome 4E; when bases T and C are detected simultaneously by KASP molecular marker TWK4EL-5, it is identified as containing the long arm of chromosome 4E in the wheat background;

[0051] When only base G is detected by KASP molecular marker TWK4EL-6, it is identified as containing the long arm of chromosome 4E; when only base A is detected by KASP molecular marker TWK4EL-6, it is identified as not containing the long arm of chromosome 4E; when bases G and A are detected simultaneously by KASP molecular marker TWK4EL-6, it is identified as containing the long arm of chromosome 4E in the wheat background;

[0052] When only base C is detected by KASP molecular marker TWK4EL-7, it is identified as containing the long arm of chromosome 4E; when only base T is detected by KASP molecular marker TWK4EL-7, it is identified as not containing the long arm of chromosome 4E; when bases C and T are detected simultaneously by KASP molecular marker TWK4EL-7, it is identified as containing the long arm of chromosome 4E in the wheat background;

[0053] When only base A is detected by KASP molecular marker TWK4EL-8, it is identified as containing the long arm of chromosome 4E; when only base C is detected by KASP molecular marker TWK4EL-8, it is identified as not containing the long arm of chromosome 4E; when both bases A and C are detected by KASP molecular marker TWK4EL-8, it is identified as containing the long arm of chromosome 4E in the wheat background;

[0054] If only base C is detected using the KASP molecular marker TWK4EL-9, it is identified as containing the 4E chromosome long arm. If only base G is detected using the KASP molecular marker TWK4EL-9, it is identified as not containing the 4E chromosome long arm. If both bases G and C are detected using the KASP molecular marker TWK4EL-9, it is identified as containing the 4E chromosome long arm in the wheat background.

[0055] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0056] Example 1: Screening of universal SNPs specific to Elymus elongatus and wheat

[0057] 1. Extraction of genomic RNA. Young leaves of tetraploid Elytrigia longissima and decaploid Elytrigia longissima were collected respectively, and total RNA from the leaves was extracted using the Plant Total RNA Isolation Kit according to the instructions. The purity, concentration and integrity of the RNA samples were tested and stored at -80°C for use in transcriptome sequencing.

[0058] 2. Screening of universal SNPs specific to wheat and Elymus elongatus. The RNA of tetraploid Elymus elongatus and decaploid Elymus elongatus extracted in step 1 was sent to Biomike Biotechnology Co., Ltd. for second-generation transcriptome sequencing. After library construction, library quality control, and on-machine sequencing, the RNA samples were used to obtain the original sequencing sequence (Raw Reads) for generating FASTQ, with a read length of 150bp. Then the Raw Reads of the two samples were counted separately, and low-quality Reads were further filtered by Q20 (%) and Q30 (%), where Q20 (%) and Q30 (%) represent the percentage of bases with quality values ​​≥20% and ≥30%, respectively, to obtain high-quality sequence data (Clean Data). The results are shown in Table 2.

[0059] Table 2 Transcriptome sequencing information of Elytrinum longispinum

[0060] Elytium longipedum Number of Reads Number of bases (bp) Q20(％) Q30(％) Tetraploid 21388726 6396819840 98.19 95.05 Decaploid 22411864 6707308216 98.24 95.16

[0061] As shown in Table 1, a total of 43,800,590 reads were obtained by second-generation transcriptome sequencing, of which 21,388,726 reads were obtained for tetraploid Elymus elongatus and 22,411,864 reads were obtained for decaploid Elymus elongatus. The Q20 of the two samples was greater than 98%, and the Q30 was greater than 95%, indicating that the sequencing data quality was high.

[0062] The fasta sequence files of tetraploid and decaploid Elymus elongatum Clean Data were used to create a localized database using BLAST+, and compared with the diploid Elymus elongatum genome (address: http: / / 202.194.139.32 / blast / blast.html). Based on the comparison results, 100% consistent conservative sequences among three different ploidy Elymus elongatum were obtained. The above conservative sequences were further compared with the Chinese Spring reference genome (address: https: / / urgi.versailles.inrae.fr / download / iwgsc / IWGSC_RefSeq_Assemblies / v2.1 / ), and sequences that met the following conditions were selected: sequence length was 150 bp, no missing bases in the sequence; there was a unique SNP between the conservative sequences of different ploidy Elymus elongatum and the homologous sequences of the common wheat Chinese Spring reference genome; the common wheat SNP was conserved among the Chinese Spring A, B, and D subgenomes.

[0063] A total of 903 conserved nucleotide sequences between wheat and three different ploidy Elymus elongatum were obtained, from which a total of 7397 SNPs common to wheat and Elymus elongatum E group were identified. Their distribution on the A, B, and D subgenomes of wheat and the chromosome of Elymus elongatum E group is shown in Table 3.

[0064] Table 3 SNPs specific to Chinese Spring and Elymus elongatus group E

[0065]

[0066] Example 2: Establishment of 4E chromosome-specific KASP marker

[0067] Extraction of genomic DNA. The experimental materials include the following 15 kinds: 3 wheat varieties (China Spring, Rongmai No. 4, Taishan No. 5), 3 kinds of Elytrium elongatum (diploid, tetraploid, decaploid Elytrium elongatum, all containing basic E chromosome sets), 9 wheat-Elytrium elongatum introgression lines (derived from the hybridization of common wheat China Spring and diploid Elytrium elongatum) identified and confirmed by genomic in situ hybridization GISH (genomic in situ hybridization) to have the presence of peripheral chromosomes, including a complete set of wheat-Elytrium elongatum 1E-7E disomic addition lines (2n=44, a pair of identical exogenous chromosomes are added to the complete chromosome set of wheat), wheat-Elytrium elongatum 4EL telesomic addition lines (2n=44, a pair of identical 4E chromosome long arms 4EL are added to the complete chromosome set of wheat) and wheat-Elytrium elongatum 4ES telesomic addition lines (2n=44, a pair of identical 4E chromosome short arms 4ES are added to the complete chromosome set of wheat). Among them, the wheat varieties are conventional variety resources commonly used in China, the three types of Elytrimus elongatus were introduced from the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, and the wheat-Elytrimus elongatus introductory line was introduced from the College of Agriculture, Henan Agricultural University.

[0068] The young leaves of all the above test materials were collected 7 days after germination, and the genomic DNA of each material was extracted using the modified CTAB method (Zhang X, Wang L. Modified CTAB Method for Extracting Genomic DNA from Wheat Leaf [J]. Agricultural Science and Technology, 2013, 2013, 14 (07): 946-949). The concentration and purity of the DNA solution were detected by NanoDrop 2000c, and the DNA quality was detected by 1.2% agarose gel electrophoresis. According to the measured concentration, a DNA working solution with a concentration of 100 ng / μL was prepared with ultrapure water and used as a PCR amplification template.

[0069] 2. Development of KASP markers for chromosome 4E.

[0070] Primers were designed using SNPWay (http: / / www.snpway.com / ) and bioinformatics software Geneious R8. The key to the success of KASP marker typing lies in the quality of KASP primer design. To improve the success rate, the primer design was optimized as follows:

[0071] (1) Perform a preliminary analysis of the sequences before and after the SNP site, where the primer length is about 18 bp to 35 bp, the GC content of the primer is 30% to 60%, and the GC content of the upstream and downstream primers is as close as possible to ensure that the primers can stably bind to the DNA single strand at the same annealing temperature, thereby amplifying.

[0072] (2) The amplified fragment is between 50 bp and 250 bp, and small fragment design is given priority.

[0073] (3) The designed primers were predicted on the wheat multi-omics website Wheat Omics 1.0 (http: / / 202.194.139.32 / PrimerServer / ) to ensure that the primers specifically bind to the target sites of the wheat A, B, and D genomes and the Elygrove grass E genome to obtain specific amplified fragments.

[0074] (4) The DNAMAN tool was used to detect the self-complementarity of each designed primer and the complementarity of the primers after pairing to ensure that primer dimers were not easily formed during the amplification process.

[0075] After the above primer design optimization, 9 SNPs evenly distributed on chromosome 4E of Elymus elongatus were selected for the design of KASP marker primers (chromosome 4E length is 612967577). The types of the 9 SNPs and their distribution positions on chromosome 4E are shown in Table 4 and Appendix Figure 1 shown.

[0076] Table 4 Common SNP sites on chromosome 4E of Elytrinum elongatum with different ploidy

[0077]

[0078]

[0079] Based on the above 9 SNPs, chromosome arm-specific codominant KASP markers TWK4ES-1, TWK4EL-2, TWK4ES-3, TWK4ES-4, TWK4EL-5, TWK4EL-6, TWK4EL-7, TWK4EL-8, and TWK4EL-9 were developed, and primers corresponding to KASP markers were further developed. Each KASP marker contains three primers, one common primer for the marker site, and the other two are SNP allele specific primers. The 5' of wheat allele specific primer AL1 is added with a linker sequence matching FAM fluorescence: GAAGGTGACCAAGTTCATGCT, and the 5' of the elytricum allele primer AL2 is added with a linker sequence matching VIC fluorescence: GAAGGTCGGAGTCAACGGATT. Among them, the purpose of setting each fluorescent linker is to facilitate the rapid acquisition of typing results through different fluorescent colors during subsequent typing and identification. In practice, those skilled in the art can choose to add other fluorescent groups or linker sequences of markers that can achieve equivalent effects as needed.

[0080] The KASP marker TWK4ES-1 was developed based on SNP 4ES-1, including a wheat allele forward primer 4ES-1F1 containing a FAM fluorescent linker sequence, whose nucleotide sequence is shown in SEQ ID NO: 1; a long-spiked elytra allele forward primer 4ES-1F2 containing a VIC fluorescent linker sequence, whose nucleotide sequence is shown in SEQ ID NO: 2; and a shared reverse primer 4ES-1R, whose nucleotide sequence is shown in SEQ ID NO: 3.

[0081] The KASP marker TWK4EL-2 was developed based on SNP 4EL-2, including a wheat allele forward primer 4EL-2F1 containing a FAM fluorescent linker sequence, whose nucleotide sequence is shown in SEQ ID NO: 4; a long-spiked elytra allele forward primer 4EL-2F2 containing a VIC fluorescent linker sequence, whose nucleotide sequence is shown in SEQ ID NO: 5; and a shared reverse primer 4EL-2R, whose nucleotide sequence is shown in SEQ ID NO: 6.

[0082] The KASP marker TWK4ES-3 was developed based on SNP 4ES-3, and its primers included a wheat allele forward primer 4ES-3F1 containing a FAM fluorescent linker sequence, whose nucleotide sequence is shown in SEQ ID NO: 7; a long-spiked Elymus allele forward primer 4ES-3F2 containing a VIC fluorescent linker sequence, whose nucleotide sequence is shown in SEQ ID NO: 8; and a shared reverse primer 4ES-3R, whose nucleotide sequence is shown in SEQ ID NO: 9.

[0083] The KASP marker TWK4ES-4 was developed based on SNP 4ES-4, and its primers included a wheat allele forward primer 4ES-4F1 containing a FAM fluorescent linker sequence, whose nucleotide sequence is shown in SEQ ID NO: 10; a long-spiked elytra allele forward primer 4ES-4F2 containing a VIC fluorescent linker sequence, whose nucleotide sequence is shown in SEQ ID NO: 11; and a shared reverse primer 4ES-4R, whose nucleotide sequence is shown in SEQ ID NO: 12.

[0084] The KASP marker TWK4EL-5 was developed based on SNP 4EL-5, and its primers included a wheat allele forward primer 4EL-5F1 containing a FAM fluorescent linker sequence, whose nucleotide sequence is shown in SEQ ID NO: 13; a long-spiked elytra allele forward primer 4EL-5F2 containing a VIC fluorescent linker sequence, whose nucleotide sequence is shown in SEQ ID NO: 14; and a common reverse primer 4EL-5R, whose nucleotide sequence is shown in SEQ ID NO: 15.

[0085] The KASP marker TWK4EL-6 was developed based on SNP 4EL-6, and its primers included a wheat allele forward primer 4EL-6F1 containing a FAM fluorescent linker sequence, whose nucleotide sequence is shown in SEQ ID NO: 16; a long-spiked elytra allele forward primer 4EL-6F2 containing a VIC fluorescent linker sequence, whose nucleotide sequence is shown in SEQ ID NO: 17; and a common reverse primer 4EL-6R, whose nucleotide sequence is shown in SEQ ID NO: 18.

[0086] The KASP marker TWK4EL-7 was developed based on SNP 4EL-7, and its primers included a wheat allele forward primer 4EL-7F1 containing a FAM fluorescent linker sequence, whose nucleotide sequence is shown in SEQ ID NO: 19; a long-spiked elytra allele forward primer 4EL-7F2 containing a VIC fluorescent linker sequence, whose nucleotide sequence is shown in SEQ ID NO: 10; and a common reverse primer 4EL-7R, whose nucleotide sequence is shown in SEQ ID NO: 21.

[0087] The KASP marker TWK4EL-8 was developed based on SNP 4EL-8, and its primers included a wheat allele forward primer 4EL-8F1 containing a FAM fluorescent linker sequence, whose nucleotide sequence is shown in SEQ ID NO: 22; a long-spiked elytra allele forward primer 4EL-8F2 containing a VIC fluorescent linker sequence, whose nucleotide sequence is shown in SEQ ID NO: 23; and a common reverse primer 4EL-8R, whose nucleotide sequence is shown in SEQ ID NO: 24.

[0088] The KASP marker TWK4EL-9 was developed based on SNP 4EL-9, and its primers include a wheat allele forward primer 4EL-9F1 containing a FAM fluorescent linker sequence, whose nucleotide sequence is shown in SEQ ID NO: 25; a long-spiked elytra allele forward primer 4EL-9F2 containing a VIC fluorescent linker sequence, whose nucleotide sequence is shown in SEQ ID NO: 26; and a common reverse primer 4EL-9R, whose nucleotide sequence is shown in SEQ ID NO: 27.

[0089] The PCR amplification system was: 1 μL of 100 ng / μL DNA, 5 μL of 2×KASP Maseter Mix, 0.7 μL of primer mixture, 3.3 μL of ddH2O, and a total system of 10 μL. The preparation method of the primer mixture was: 0.4 μL of the common reverse primer with a working solution concentration of 10 μM, 0.15 μL of the wheat allele forward primer, and 0.15 μL of the long-spiked Elymus allele forward primer, and mixed them evenly. The PCR amplification program was: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 65.7℃ gradient annealing and extension for 1 min, 10 cycles, the temperature of annealing and extension decreased by 0.7℃ in each cycle; 94℃ denaturation for 20 s, 57℃ annealing and extension for 1 min, 42 cycles.

[0090] It should be noted that the PCR amplification system and reaction procedure are directly related to the success or failure of the results, and the parameters in the system and procedure cannot be obtained by conventional adjustment or selection. Adjusting the parameters arbitrarily is likely to lead to amplification failure. When establishing the amplification system, the inventors found that too many or too few cycles would lead to poor typing or failure, and finally set the number of cycles to 42 cycles. The subsequent PCR amplification system and reaction procedure are based on the same reason, and the parameters cannot be adjusted arbitrarily, so they will not be repeated.

[0091] Using the above method, the primers obtained were used to perform PCR amplification on the genomic DNA of the test materials using an ABI real-time fluorescence quantitative PCR instrument, and sterilized ddH2O was used as a blank control to obtain the amplified product, which was collected by fluorescence at 60°C, and the PCR product was typed using the bioinformatics software Quant Studio Design&Analysis Software v1.5.1. Due to the large number of KASP markers, the typing result schematic diagram and related data are not shown one by one in the article. The typing results showed that all 9 markers can be used for the correct typing of different wheat varieties and diploid and tetraploid Elymus elongatus, and 4 of them (TWK4EL-2, TWK4EL-7, TWK4EL-8, TWK4EL-9) can also be used for the E chromosome typing of decaploid Elymus elongatus.

[0092] To save space, this patent only shows the typing results of KASP markers TWK4ES-1, TWK4EL-2, TWK4EL-7, TWK4EL-8, and TWK4EL-9, respectively. Figures 2 to 6 Due to patent submission requirements, all drawings are in black and white and cannot show fluorescent colors. The corresponding fluorescent colors are explained in the text. Figure 2 In the figure, the sample group at the far end of the horizontal axis (in the circle at the lower right corner, AL1-Allele T) is different wheat varieties, wheat-Elygropyrum longissimum addition lines without 4E or 4ES, and decaploid Elygropyrum longissimum, the allele is "Allele T / Allele T", and the fluorescence reading is red. The sample group at the far end of the vertical axis (in the ellipse at the upper left corner, AL2-Allele G is diploid and tetraploid Elygropyrum longissimum, the allele is "Allele G / Allele G", and the fluorescence reading is blue. The middle sample group (middle position, Allele G / T) is a wheat-Elygropyrum longissimum introduction line containing 4E or 4ES (wheat-Elygropyrum longissimum 4E disomic addition line, 4ES disomic addition line), the fluorescence reading is green, and the allele is "Allele G / Allele T". The three black dots near the origin (NTC) represent the no-template control.

[0093] from Figure 2 It can be seen that the TWK4ES-1 marker is highly conservative among different ploidy Elymus elongatum and different wheat varieties, and can be used to detect 4ES chromosomes from diploid and tetraploid Elymus elongatum in different wheat backgrounds, but the fluorescence signal of decaploid Elymus elongatum is mixed with the fluorescence signal of common wheat, and the fluorescence readings are all red, which is a typing error, and cannot be used to detect 4ES chromosomes from decaploid Elymus elongatum. The possible reason is that the E genomes of diploid and tetraploid Elymus elongatum are closely related, while the decaploid Elymus elongatum with a complex genome may have undergone different degrees of genome differentiation during the long-term evolution process.

[0094] Figure 3In the figure, the distal sample group on the horizontal axis (in the ellipse on the lower right corner, AL1-Allele T) is a wheat-Elygropyrum disomic addition line of different wheat varieties and does not contain 4E or 4EL, with an allele type of "Allele T / Allele T", and the fluorescence reading is red. The distal sample group on the vertical axis (in the ellipse on the upper left corner, AL2-Allele C is Elygropyrum of different ploidy, with an allele type of "Allele C / Allele C", and the fluorescence reading is blue. The middle sample group (middle position, Allele T / C) is a wheat-Elygropyrum introgression line containing 4E or 4EL (wheat-Elygropyrum 4E disomic addition line, 4EL disomic addition line), the fluorescence reading is green, and the allele type is "Allele C / Allele T". The three black dots near the origin (NTC) represent the no-template control. From Figure 3 It can be seen that the typing results of TWK4EL-2 marker are accurate and conservative among three different ploidy types of Elytrium longispinum, namely diploid, tetraploid and decaploid, as well as among different wheat varieties. It can be used to detect 4EL chromosomes of different Elytrium longispinum sources in the wheat background. Figure 4 , 5 The analysis of 6 is similar and will not be repeated here.

[0095] Example 3: Application and verification of TWK4ES-1 and TWK4EL-2 markers

[0096] It should be noted that the application methods and results of TWK4ES-3, TWK4ES-4, TWK4EL-5, and TWK4EL-6 are similar to those of TWK4ES-1, and the application methods and results of TWK4EL-7, TWK4EL-8, and TWK4EL-9 are similar to those of TWK4EL-2. Therefore, this embodiment only reflects TWK4ES-1 and TWK4EL-2, and the rest are not repeated.

[0097] 1. Identification of distant hybridization progenies between wheat and Thinopyrum elongatum.

[0098] The materials to be tested include 252 high-generation derivative materials of wheat-Elygropyrum longissima hybrid (numbered: JD-1 to JD-252) and reference materials with different SNP alleles. The reference materials include 3 wheat varieties including Chinese Spring, 2 wheat-Elygropyrum longissima introduction lines: wheat-Elygropyrum longissima 4EL disomic addition line and 4ES disomic addition line, and each material is tested in parallel three times. The genomic DNA of the above materials is extracted as a template using the method of Example 2, and PCR amplification is performed on them using the primers of the KASP molecular markers TWK4ES-1 and TWK4EL-2 respectively. The PCR amplification system is: 1μL of 100ng / μL DNA, 5μL of 2×KASP Maseter Mix, 0.7μL of primer mixture, 3.3μL of ddH2O, and 10μL of the total system. The primer mixture was prepared by taking 0.4 μL of a common upstream primer with a working concentration of 10 μM, 0.15 μL of a downstream primer of the elytris allele, and 0.15 μL of a downstream primer of the wheat allele, and mixing them evenly. Each upstream primer and downstream primer used the upstream and downstream primers of TWK4ES-1 and TWK4EL-2, respectively.

[0099] The PCR amplification program was as follows: 94°C pre-denaturation for 15 min; 94°C denaturation for 20 s, 65.7°C gradient annealing and extension for 1 min, 10 cycles, with the annealing and extension temperature decreasing by 0.7°C in each cycle; 94°C denaturation for 20 s, 57°C annealing and extension for 1 min, 42 cycles. The fluorescence of the amplified products was collected at 60°C using an ABI real-time fluorescence quantitative PCR instrument, and the PCR products were typed using the bioinformatics software Quant Studio Design & Analysis Software v1.5.1.

[0100] Due to the large number of samples tested, the schematic diagram of the test results and related data are not shown one by one in this article. According to the typing results of the 4ES chromosome of Elymus elongatus, a total of 22 wheat-Elymus elongatus hybrid derivative materials containing 4ES chromosomes were detected, numbered JD-1, JD-2, JD-3, JD-4, JD-5, JD-6, JD-8, JD-10, JD-11, JD-12, JD-15, JD-18, JD-23, JD-24, JD-25, JD-27, JD-28, JD-30, JD-32, JD-38, JD-40, JD-45. According to the typing results of the 4EL chromosome of Elymus longissimus, a total of 20 wheat-Elymus longissimus hybrid materials containing the 4EL chromosome were detected, numbered JD-2, JD-3, JD-4, JD-5, JD-6, JD-8, JD-10, JD-11, JD-12, JD-15, JD-18, JD-24, JD-25, JD-27, JD-28, JD-30, JD-32, JD-38, JD-40, JD-45. Based on the above KASP marker detection results of 4ES and 4EL, 20 materials contained the complete chromosome 4E among the tested materials, and 2 materials (numbered JD-1 and JD-23) only contained the short arm 4ES of the chromosome, and no materials containing only 4EL were detected. The typing results of the reference material were consistent with expectations, and all 3 wheat varieties were homozygous wheat genotypes.

[0101] 2. Verification of KASP molecular marker identification results.

[0102] Materials to be tested: 5 materials of the wheat-Elygropyrum elongatum 4E introduction line containing the long and short arms of chromosome 4E identified in step 1 (JD-2, JD-3, JD-4, JD-5, JD-8), 2 materials of the wheat-Elygropyrum elongatum 4ES introduction line containing the short arm of chromosome 4E (JD-1, JD-23), 1 reference material wheat-Elygropyrum elongatum 4EL addition line, 1 wheat variety Chinese Spring, 1 tetraploid Elygropyrum elongatum, and 1 decaploid Elygropyrum elongatum, and the identification results of the KASP molecular marker were further verified by sequencing.

[0103] According to the 4ES-1 molecular marker SNP on chromosome 4ES, two pairs of primers were designed using geneious 8.0.2 software. Because no reverse primer sequence that can amplify two species at the same time and meet the requirements of primer design parameters was found, the reverse primers of the two species were designed separately in this step. The first pair of primers (4ES-TF / 4ES-CS-R) only specifically amplified the 293bp fragment where the target SNP site was located from the wheat genome, and the second pair of primers (4ES-TF / 4ES-YM-R) only specifically amplified the 298bp fragment where the target SNP site was located from the E group of E.

[0104] Among them, the nucleotide sequence of primer 4ES-TF is: 5'-ACATTTTCAGGTGAGAATGGTG-3'; the nucleotide sequence of primer 4ES-CS-R is: 5'-GCTCGTGTACTCAACTGTATG-3'; and the nucleotide sequence of primer 4ES-YM-R is: 5'-TTGCTCATGTACTCATCAACTG-3'.

[0105] PCR amplification system: 100ng / μL DNA 5μL, Pfu Mix 25μL, upstream and downstream primers 2.5μL each, ddH2O 15μL, total system 50μL. PCR amplification program: 94℃ pre-denaturation 5min; 94℃ denaturation 30s, 56℃ annealing 30s, 72℃ extension 30s, a total of 35 cycles; 72℃ extension 10min.

[0106] The amplified PCR products were sent to Youkang Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the base at the target SNP site of the amplified fragments of wheat Chinese Spring and reference material 4EL addition line was T, the base at the target SNP site of the amplified fragments of tetraploid and decaploid Elymus elongatus was G, and the wheat-Elymus elongatus 4ES addition line, 4ES introduction line (JD-1, JD-23) and 4E introduction line (JD-2, JD-3, JD-4, JD-5, JD-8) all produced two amplified fragments, and the bases at the target SNP site were T and G, respectively, which was consistent with the results of KASP molecular marker detection.

[0107] Similarly, based on the 4EL-2 molecular marker SNP on chromosome 4EL and the wheat genome sequence, a pair of universal upstream and downstream primers (4EL-F, 4EL-R) were designed using geneious 8.0.2 software. The primers can specifically amplify the 223 bp wheat genome fragment containing the SNP site and the E genome fragment of the long spike.

[0108] The nucleotide sequence of primer 4EL-F is 5'-AGCGGTAGTGGCAATGACAT-3', and the nucleotide sequence of primer 4EL-R is 5'-TGCGTCCAACTACTTGGAAA-3'.

[0109] PCR amplification system: 100ng / μL DNA 5μL, Pfu Mix 25μL, upstream and downstream primers 2.5μL each, ddH2O 15μL, total system 50μL. PCR amplification program: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30s, 58℃ annealing for 30s, 72℃ extension for 30s, a total of 35 cycles; 72℃ extension for 10min.

[0110] The amplified PCR products were sent to Youkang Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the base at the target SNP site of the amplified fragments of wheat Chinese Spring and 4ES introduction lines (JD-1, JD-23) was T, and the base at the target SNP site of the amplified fragments of tetraploid and decaploid Elymus elongatus was C, while the wheat-Elymus elongatus 4E introduction lines (JD-2, JD-3, JD-4, JD-5, JD-8) and the reference material 4EL addition line produced two amplified fragments, and the bases at the target SNP site were T and C, respectively. The sequencing results were consistent with the KASP molecular marker detection results. The results show that the 4E chromosome-specific co-dominant KASP markers TWK4ES-1 and TWK4EL-2 provided by the present invention can be used for rapid, accurate, high-throughput, and automated identification and tracking of Elymus elongatus 4ES and 4EL chromosomes in the wheat background, and are efficiently used in wheat chromosome engineering breeding and molecular marker-assisted selection breeding.

[0111] The embodiments described above are only descriptions of the preferred modes of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations, modifications, and substitutions made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A primer for detecting KASP molecular markers on chromosome 4E of Elymus elongatus, characterized in that: Comprising primers for detecting KASP molecular marker TWK4ES-1; and / or; Primers for detecting KASP molecular marker TWK4EL-2; The primers for detecting the KASP molecular marker TWK4ES-1 include: a wheat allele forward primer 4ES-1F1, whose nucleotide sequence is shown in SEQ ID NO: 1, a thin spike allele forward primer 4ES-1F2, whose nucleotide sequence is shown in SEQ ID NO: 2, and a common reverse primer 4ES-1R, whose nucleotide sequence is shown in SEQ ID NO: 3; The primers for detecting the KASP molecular marker TWK4EL-2 include: a wheat allele forward primer 4EL-2F1, whose nucleotide sequence is shown in SEQ ID NO: 4, a long-spiked elytra allele forward primer 4EL-2F2, whose nucleotide sequence is shown in SEQ ID NO: 5, and a common reverse primer 4EL-2R, whose nucleotide sequence is shown in SEQ ID NO:

6.

2. A method for identifying whether a plant contains a 4EL and / or 4ES chromosome of Elymus elongatus by using the primers for detecting the KASP molecular marker of the 4E chromosome of Elymus elongatus according to claim 1, characterized in that: The specific steps include: (1) Extract DNA from the sample to be tested as a template; (2) using the primers described in claim 1 to perform PCR amplification on the DNA template to obtain amplified products; (3) Analyze the amplified products. If the product amplified by the primers for detecting the KASP molecular marker TWK4ES-1 only detects the base G, it is identified as containing the 4ES chromosome. If the product amplified by the primers for detecting the KASP molecular marker TWK4ES-1 only detects the base T, it is identified as not containing the 4ES chromosome. If the product amplified by the primers for detecting the KASP molecular marker TWK4ES-1 simultaneously detects the bases G and T, it is identified as containing the 4ES chromosome in the wheat background. If only base C is detected in the product amplified by the primers for detecting the KASP molecular marker TWK4EL-2, it is identified as containing the 4EL chromosome. If only base T is detected in the product amplified by the primers for detecting the KASP molecular marker TWK4EL-2, it is identified as not containing the 4EL chromosome. If both bases C and T are detected in the product amplified by the primers for detecting the KASP molecular marker TWK4EL-2, it is identified as containing the 4EL chromosome in the wheat background.

3. The method according to claim 2, characterized in that: The amplification system of the PCR amplification in step (2) is: 1µL of 100ng / µL DNA, 5µL of 2×KASP Maseter Mix, 0.7µL of primer mixture, 3.3µL of ddH2O, and the total system is 10µL; The primer mixture is prepared by mixing 0.4 μL of a 10 μM common reverse primer, 0.15 μL of a wheat allele forward primer and 0.15 μL of a thinwort allele forward primer evenly.

4. The method according to claim 3, characterized in that: The amplification program of the PCR amplification in step (2) is as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, gradient annealing and extension at 65.7°C for 1 min, 10 cycles, with the annealing and extension temperature decreasing by 0.7°C in each cycle; denaturation at 94°C for 20 s, annealing and extension at 57°C for 1 min, 42 cycles.

5. A detection reagent, a detection kit or a detection test strip containing the primers for detecting the KASP molecular marker of chromosome 4E of Elymus elongatus according to claim 1.

6. Use of the primers for detecting the KASP molecular marker on chromosome 4E of Thinopyrum elongatum according to claim 1 in wheat breeding, characterized in that: Application in identifying whether the Elymus elongatus 4EL and / or 4ES chromosomes exist in wheat-Elymus elongatus materials.

Images