InDel markers co-segregating with yellowing trait in watermelon and their application

Abstract

The invention discloses an Inde1 marker co-segregated with a yellowing trait of watermelon and its application, and belongs to the field of molecular breeding. The invention can be directly used for molecular marker-assisted breeding of yellowing watermelon plants, improve the selection efficiency of breeding, and accelerate the breeding process; it is worth noting that the yellowing material in the invention is different from the conventional yellowing material. Under suitable growth conditions, only plants in the late growth cycle of the material produce a yellowing phenotype, and the color of the early plants is no different from that of the wild type; when the material is stressed at any growth period, the plant will show a yellowing phenotype earlier. This characteristic can be used to introduce its fragments into existing commercial varieties through co-segregation markers, as a morphological marker to reflect its own growth status. At the same time, it can lay a foundation for the ultimate realization of the localization of the watermelon yellowing gene Clyp, the research on chloroplast development and the chlorophyll synthesis regulatory network, thereby improving the photosynthetic efficiency of watermelon and improving the fruit quality.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to an Indel marker co-segregated with a yellowing trait of a watermelon plant and an application thereof. Background Art

[0002] The selection of genotypes is one of the most important links in breeding. It refers to the selection of genotypes that meet the requirements in a group for subsequent cultivation. In the traditional breeding process, the basis for selection is often determined by the appearance phenotype of the plant. This selection is time-consuming and may deviate from the required genotype when the trait is ambiguous, resulting in wrong selection and low efficiency. Molecular marker-assisted breeding can quickly detect the target gene or the site co-segregated with the target trait from the seedling stage to achieve the purpose of selecting the target trait. It has the advantages of being fast, accurate, and not affected by environmental conditions.

[0003] Indel polymorphism molecular markers are markers designed based on the sequences on both sides of the insertion / deletion site for PCR amplification using specific primers. Relative to one parent, a certain number of nucleotides are inserted or deleted in the genome of the other parent. In essence, they are still length polymorphism markers, and can be used for rapid genotyping using a convenient electrophoresis platform.

[0004] China is currently the world's largest producer and consumer of watermelon, with a huge cultivation area and output. Watermelon is an important fruit for people to cool off in summer and quench their thirst, and it occupies a very important position in the world's horticultural crops. As people's living standards improve, their requirements for the quality of the fruits they eat in their lives are getting higher and higher.

[0005] The quality of vegetables, fruits and melons is an important condition that determines their commerciality. The conditions that determine quality are mainly in two aspects. On the one hand, it is determined by breeders, the quality of the commercial varieties themselves; on the other hand, it is determined by growers, the quality of management during the entire growth cycle of their cultivation. When a commercial dispute arises between growers and breeders due to poor quality, it is often difficult to distinguish whether it is the responsibility of the grower or the breeder. At the same time, the cultivation and management of vegetables, fruits and melons are more sophisticated than field crops. Cultivators are required to supplement necessary nutrients at any time according to the growth status of the plants. If plants can provide their own feedback on whether there is a lack of nutrients in their bodies, it will provide great convenience for the management of growers.

[0006] The chlorophyll synthesis and metabolic pathways in plants involve multiple genes. Mutations in any related genes may lead to chloroplast development defects, resulting in reduced chloroplast photosynthesis, changes in chlorophyll content, and various leaf color mutation phenotypes in the plants, while affecting the plant's yield and fruit quality.

[0007] The biosynthesis of chlorophyll molecules starts from L-glutamyl-tRNA, and finally synthesizes chlorophyll a and chlorophyll b through 19 steps of reaction with the participation of 15 enzymes. Gene mutations in the pathway can lead to phenotypes such as plant yellowing (CHL, PORA, CAO1), necrotic spots (PORB), weak growth, premature senescence, and even more severe mutation lethality (HEMF).

[0008] Gene mutations in the chlorophyll degradation pathway often make chlorophyll in the plant unable to degrade, resulting in a stay-green phenotype. Currently, the genes that have been reported to cause stay-green include PAO, NYC1, NOL, PPH, SGR, etc. Among them, the discovery of the SGR gene is a milestone in the research on chlorophyll degradation regulation in recent years. The SGR gene mutation not only causes the plant to remain green for a long time, but also allows the plant to photosynthesize for a longer time, increasing photosynthetic products and thus improving yield and fruit quality. In addition, SGR has also been reported to be related to plant resistance, and the mutant has stronger stress resistance. The stay-green trait has great application prospects in increasing crop yield and income.

[0009] It has been reported that multiple light-responsive transcription factors (GLK, HY5, etc.) can directly regulate the expression of genes in the chlorophyll pathway and play an important role in regulating plant chloroplast development and photosynthesis.

[0010] With the continuous growth of the world's population, especially with the frequent occurrence of climate drought and natural disasters, improving photosynthetic efficiency has become an important goal of crop breeding. In recent years, research on molecular breeding of watermelon has developed rapidly. Many excellent traits have been genetically located, and some co-segregating markers with regulatory trait genes have also begun to be used in the molecular marker-assisted breeding process. Through the study of the yellowing trait of watermelon, the study of the located mutant yellowing gene can improve the photosynthetic efficiency of plants, resistance to abiotic stress, and effectively increase yield and fruit quality. Summary of the invention

[0011] One of the objectives of the present invention is to provide a pair of InDel markers co-segregating with the yellowing trait of watermelon.

[0012] The second object of the present invention is to provide the application of the above molecular markers in watermelon molecular breeding.

[0013] The third object of the present invention is to provide a method for determining yellowing varieties / genotypes of watermelon.

[0014] To achieve the above object, the present invention provides the following technical solutions:

[0015] A pair of molecular markers co-segregated with the watermelon yellowing trait gene Clyp, the molecular marker is an Indel molecular marker, named Indel18 marker, and the polymorphic molecular marker co-segregated with the watermelon yellowing trait is developed based on the gene Clyp. The upstream primer sequence of the primer pair for amplifying the Indel18 marker is shown in SEQ ID NO.1, and the downstream primer sequence is shown in SEQ ID NO.2.

[0016] Another object of the present invention is to introduce the above-mentioned Indel18 marker co-segregated fragment into commercial varieties. As a morphological marker, the plant can reflect its own growth status at any time, so that the grower can provide necessary nutrition in time. At the same time, when the quality of the fruit grown is poor, it can be clearly distinguished whether it is a problem of the grower's management or a problem of the breeder's seed selection itself, thereby resolving some commercial disputes.

[0017] The yellowing material in the present invention is different from conventional yellowing materials. Under suitable growth conditions, the material will only turn yellow slowly from the root upwards in the late growth cycle, and the yellowed parts include the leaves, stems and fruits of the watermelon plants, all of which will turn from the initial green to yellow. The color of the plants in the early stage is no different from that of the wild type; however, when the material is stressed at any growth stage, the plants will show obvious yellowing phenotypes in advance.

[0018] The present invention also discloses a method for determining yellowing varieties / genotypes of watermelons, which uses a PCR amplification method for detection. The method comprises the following steps:

[0019] (1) Extract DNA from watermelon tissue;

[0020] (2) PCR amplification: using a primer pair with an upstream primer sequence as shown in SEQ ID NO.1 and a downstream primer sequence as shown in SEQ ID NO.2, PCR amplification is performed on the sample extracted in step (1);

[0021] (3) electrophoresis detection or Sanger sequencing of the fragment extended by the primer pair described in step (2);

[0022] (4) Determine according to the electrophoresis band results of step (3), the specific criteria are:

[0023] If the PCR amplification product is a characteristic band of 111 bp in length, the plant to be tested is a homozygous watermelon yellowing material; if the PCR amplification product is a characteristic band of 201 bp, the plant to be tested is a homozygous watermelon normal material; if the PCR amplification product is two characteristic bands of 111 bp and 201 bp in length, the plant to be tested is a heterozygous watermelon normal material;

[0024] Or, expressed as follows:

[0025] If the PCR amplification product has only one characteristic band with a length of 111 bp as shown in SEQ ID NO.3, the watermelon to be tested is a variety / genotype of homozygous watermelon yellowing trait; if the PCR amplification product has only one characteristic band with a length of 201 bp as shown in SEQ ID NO.4, the watermelon to be tested is a normal variety / genotype of homozygous watermelon; if the PCR amplification product has both a characteristic band with a length of 111 bp as shown in SEQ ID NO.3 and a characteristic band with a length of 201 bp as shown in SEQ ID NO.4, the watermelon to be tested is a normal variety / genotype of heterozygous watermelon.

[0026] Specifically, the reaction system of PCR amplification is: DNA 1μL, 2xPCR Mix 5μL, upstream primer 0.5μL, downstream primer 0.5μL, sterile distilled water 3μL, total volume 10μL. PCR amplification conditions are: 95℃, 5min; 94℃, 30s, 57℃, 30s, 72℃, 50s, 35 cycles in total; 72℃, 10min; 4℃ storage.

[0027] In addition, the kit containing the above primer pair can be used to identify whether the watermelon material has the yellowing trait of watermelon. In specific applications, the kit containing the primer pair can be selected.

[0028] The present invention also protects vectors containing the above-mentioned molecular markers. The recombinant vector may be an expression vector or a cloning vector into which the molecular marker of the present invention is inserted. After obtaining the above-mentioned recombinant vector, those skilled in the art can transform the recombinant vector into suitable cells according to different needs to obtain recombinant cells containing the recombinant vector. Therefore, the present invention also protects recombinant cells containing the recombinant vector.

[0029] Advantages of the present invention:

[0030] On the one hand, the molecular markers of the present invention can ultimately realize the cloning of the Clyp gene, thereby laying the foundation for the study of the molecular mechanism of watermelon chlorophyll synthesis and degradation. The above molecular markers can be directly used in molecular marker-assisted breeding of yellowing watermelon plant materials, and since molecular markers have the advantages of simplicity, rapidity and high throughput in the assisted breeding system, the molecular markers provided by the present invention have good application value in the cultivation of new varieties.

[0031] On the other hand, the yellowing material in the present invention is different from the conventional yellowing material in that the material exhibits a yellowing phenotype when it is subjected to abiotic stress. This has never been reported in watermelons. Its genomic fragments can be introduced into existing commercial varieties by reporting co-segregated Indel markers. This can solve some commercial disputes caused by unclear division of responsibilities, so the molecular markers in the present invention also have certain application value for the development of the watermelon industry.

[0032] This application has conducted a detailed study on the genes related to the yellowing trait of watermelon plants, and finally determined an Indel molecular marker that is co-segregated with the yellowing of watermelon plants by using relevant research methods such as molecular markers and chromosome walking. The positioning results show that the plant yellowing gene Clyp is located between two molecular markers Indel4 and Inde114, with a physical distance of only 88Kb; the Inde118 molecular marker is co-segregated with the yellowing trait of watermelon in the interval. This discovery lays the foundation for the final cloning of the Clyp gene and the establishment of a molecular marker-assisted breeding system, and also helps to lay the foundation for the study of the synthesis and metabolic regulatory network of chlorophyll in the final watermelon. In addition, due to the particularity of the material mutation in the present invention, it is of certain help to the development of the industry. In short, since molecular markers are of great significance for the final functional gene positioning, and molecular markers have the advantages of simplicity, rapidity and high throughput in the establishment of molecular marker breeding systems, this application has very important application value and is also of very important protection significance for the cultivation of new watermelon varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 Phenotypic photos of normal watermelon material WT2 (left) and yellow watermelon material WM103 (right);

[0034] Figure 2 To map the Clyp gene for the yellowing trait of watermelon;

[0035] Figure 3 The gel electrophoresis diagram of the co-segregation marker Indel18 in the parental and F2 generation populations;

[0036] In the figure, M is DL2000 Marker, and the bands shown in the figure are 100bp and 250bp; P1 represents the normal watermelon material WT2, and P2 represents the yellow watermelon material WM103;

[0037] Figure 4 The gel electrophoresis diagram of the co-segregation marker Indel18 in the parental and natural materials;

[0038] In the figure, M is DL2000 Marker, and the figure shows 100bp and 250bp bands; P1 represents the normal watermelon material WT2, and P2 represents the yellow watermelon material WM103. DETAILED DESCRIPTION

[0039] The following is a further explanation in conjunction with the application. Before introducing the specific embodiments, the biological materials, experimental reagents and related experimental background in the following embodiments are briefly introduced as follows.

[0040] Biomaterials:

[0041] The watermelon yellow material WM103 (female parent) has yellowing of the whole plant in the late growth cycle, and has no difference with the normal watermelon material in the early stage and can be stably inherited ( Figure 1 right);

[0042] Watermelon material WT2 (male parent) is a high-generation inbred line selected and bred by the inventors. This material is a normal watermelon material and can be stably inherited ( Figure 1 Left).

[0043] The above-mentioned watermelon material WT2 is consistent with the normal common tendril-bearing watermelon material WT2 used in the Chinese invention patent with publication number CN110938706A “Molecular markers tightly linked to the tendril-free gene Clnt of watermelon plants and their applications” and the reticulated-textured watermelon material WT2 used in the Chinese invention patent with publication number CN110938706A “Molecular markers co-separated with the watermelon rind texture gene ClGS and their applications”.

[0044] The above materials can be provided through commercial channels or by the melon crop genetics and breeding research group of Henan Agricultural University.

[0045] During the experiment, the watermelon materials were planted in the solar greenhouse of Maozhuang Science and Education Park of Henan Agricultural University. During the planting process, plug tray seedlings were used after germination, and normal watermelon cultivation and management methods were adopted. A preliminary investigation and statistics of relevant phenotypic traits were conducted 45 days after planting, and the relevant phenotypic traits were investigated and confirmed again 60 days after planting.

[0046] The primers for PCR amplification and gene sequencing were provided by Beijing Nosai Genome Research Center Co., Ltd.

[0047] Experimental reagents:

[0048] PCR MagicMix 3.0 was used for PCR amplification and was purchased from Beijing Tianenze Gene Technology Co., Ltd.;

[0049] Electrophoresis and silver staining related reagents such as acrylamide, methylene acrylamide, AgNO3, NaOH, and formaldehyde were purchased from Beijing Solebow Technology Co., Ltd.;

[0050] Experimental equipment:

[0051] PCR instrument, Hema9600 gene amplification instrument from Zhuhai Heima Medical Instrument Co., Ltd.;

[0052] JY300HC universal electrophoresis apparatus, produced by Beijing Junyi Dongfang Electrophoresis Equipment Co., Ltd.;

[0053] HT-SCZ04A high-throughput vertical electrophoresis tank is produced by Beijing Hongtao Jiye Technology Development Co., Ltd.

[0054] Example

[0055] This example mainly introduces the fine positioning process of the watermelon yellowing gene Clyp, including the construction of genetic isolation populations, preliminary positioning, fine positioning and other processes. This process involves the development, design and testing of the Indel18 molecular marker that is ultimately co-segregated with the watermelon yellowing trait. The relevant experimental process is briefly introduced as follows.

[0056] 1. Construction of genetically isolated populations

[0057] Watermelon yellowing material WM103 ( Figure 1 Right) as the female parent, with normal watermelon material WT2 ( Figure 1 Left) as the male parent (it should be explained that during the experiment, considering the availability of materials and ease of operation, the inventors used WT2 as the male parent. When other homozygous normal materials are used, related experiments can also be carried out). A hybrid combination was configured using these two parents. The results showed that the obtained F1 generation had normal plant color.

[0058] Ten individual plants were selected from the F1 generation and self-pollinated to obtain F2 generation seeds for genetic analysis and gene positioning. The phenotypes of these F2 generation individuals were identified and verified using the chi-square test.

[0059] The results show that:

[0060] During the initial positioning, a small F2 population of 302 plants was planted, including 216 normal phenotype plants, 86 watermelon yellow phenotype plants, and χ 2 =1.8585<3.84, which meets the separation ratio of 3:1.

[0061] During fine positioning, a large F2 population of 1071 plants was planted, including 796 plants with normal phenotypes, 275 plants with yellow watermelon phenotypes, and χ 2 =0.0999<3.84, which also meets the separation ratio of 3:1.

[0062] Comprehensive analysis shows that the yellowing trait of watermelon plants is controlled by a pair of recessive genes, which are named Clyp. The normal phenotype (YP) is completely dominant over the yellowing phenotype (yp).

[0063] 2. Preliminary location of the gene

[0064] The BSA method was used for preliminary positioning. The specific experimental process was as follows:

[0065] (1) First, prepare a gene pool, specifically:

[0066] Randomly select 20 normal phenotype plants and 20 etiolated phenotype plants from the F2 generation population in the above step 1, collect relatively tender leaves from each plant 45 days after planting, extract their genomic DNA using the CTAB method, and mix them to form a normal gene pool and a etiolated gene pool (normal phenotypes are mixed with normal phenotypes, and etiolated phenotypes are mixed with etiolated phenotypes).

[0067] (2) Polymorphism screening analysis, specifically:

[0068] Using 1256 pairs of SSR primers developed by the inventors from the whole watermelon genome (for specific primer sequences, refer to "Genome wide characterization of simple sequence repeats in watermelon genome and their application in comparative mapping and genetic diversity analysis", Zhu et al., BMC Genomics, 2016, 17: 557-573.), markers with polymorphism between parents were screened. A total of 175 markers showed polymorphism between parents. Then, the two gene pools prepared in step (1) were subjected to a second polymorphism screening using the 175 markers with polymorphism between parents, and 4 markers with polymorphism between the two gene pools were obtained. According to the information of the SSR markers, the 4 markers with polymorphism between both parents and the mixed pool are all located at the front end of chromosome 10.

[0069] Furthermore, the selected polymorphic SSR markers were used to perform genotype analysis on 302 F2 populations (selected during the preliminary positioning in step one), and the ones with the same band shape as the yellow parent WM103 were recorded as "1", the ones with the same band shape as the normal parent WT2 were recorded as "2", and the ones with heterozygous band shape were recorded as "3".

[0070] During the polymorphism screening analysis, during PCR amplification, the 10 μL amplification system was designed as follows:

[0071] Gene pool sample (genomic DNA, 30 ng / μL), 1 μL (about 30 ng);

[0072] F, R primers, 0.5 μL each (primer concentration is 5 μmol / L)

[0073] PCR MagicMix, 5.0 μL;

[0074] ddH2O, 3.0 μL;

[0075] The PCR amplification program was: 94°C, 5 min; 94°C, 30 s, 55°C, 30 s, 72°C, 30 s, 35 cycles; 72°C, 5 min.

[0076] It should be explained that the F and R primers in the above-mentioned PCR amplification system represent the front primer and the back primer respectively; the 1256 pairs of SSR primers are not directly related to the subject matter to be protected in this application, so they will not be described in detail for the sake of brevity.

[0077] The PCR amplification products were detected by 8% non-denaturing polyacrylamide gel electrophoresis. During electrophoresis, the polyacrylamide gel electrophoresis buffer was 0.6×TBE, and the electrophoresis was performed at a constant voltage of 200V for 1 to 1.5 hours. After the electrophoresis, silver staining was performed for observation and detection. The silver staining method was as follows:

[0078] A. Place the glass plate with glue in the fixing solution and gently shake it on a shaker until the indicator loses its color. The fixing solution consists of glacial acetic acid: anhydrous ethanol: distilled water in a volume ratio of 0.5:10:100.

[0079] B. Wash with ultrapure water for 1 to 3 minutes;

[0080] C. Place the washed plastic plate in the staining solution and shake for 10 minutes. The staining solution is 0.2% silver nitrate aqueous solution.

[0081] D. Rinse the stained plastic plate in ultrapure water for 30 seconds, place it in a plastic box containing developer, and shake it gently until the bands are clearly visible. The developer is prepared by adding 15g NaOH and 3mL formaldehyde to 1L distilled water;

[0082] E. Finally, rinse repeatedly in tap water several times;

[0083] F. Dry at room temperature and then take photos.

[0084] (3) Preliminary gene localization

[0085] Specifically, the JoinMap4.0 software was used to preliminarily locate the watermelon yellowing trait gene by combining the preliminary positioning population phenotypic survey data and the typing results of the final SSR markers in step (2). As a result, two SSR molecular markers closely linked to the Clyp gene were obtained: ClSSR26748 and ClSSR26967 (the relevant codes were coded by the inventors during the research process and have no special meaning). These two molecular markers are located at both ends of the watermelon yellowing gene Clyp gene, and the physical distance between the two SSR molecular markers is 1.39 MB ( Figure 2 ).

[0086] 3. Fine positioning of genes

[0087] Based on the preliminary positioning in step 2, the inventors further carried out fine positioning of the Clyp gene related to the yellowing trait of watermelon. The specific process is briefly described as follows.

[0088] (1) Expansion of the mapping community:

[0089] Based on the preliminary positioning, we will further increase the F2 generation mapping population to 1071 strains, and then select markers ClSSR26768, ClSSR26748 and ClSSR26967 at both ends of the preliminary positioning for genotype analysis. The target gene is still located between C1SSR26748 and ClSSR26967.

[0090] (2) Parental resequencing and genome alignment

[0091] The Illumina Hi-seq2000 high-throughput sequencing platform was used to resequence the two parental materials, and the sequencing depth was controlled to be >30 times; the 1.39MB segment between SSR markers ClSSR26748 and C1SSR26967 in the published watermelon whole genome sequence was used as the reference sequence, and the resequencing sequences of the two parents and the candidate segments were compared using the free software package BWA (http: / / bio-bwa.sourceforge.net / ) publicly available on the Internet to find the different sites between the two parents in the candidate segments.

[0092] (3) Fine positioning

[0093] Since there were no more polymorphic SSR markers in the initial positioning interval, we compared the sequence differences between the two parental genomes in the candidate segments of the initial positioning, continued to develop Indel markers, and screened these markers for polymorphism between the parents. We used the newly developed Indel markers to perform genotyping analysis on the population expanded in (1), and further narrowed the interval to between Indel3 and Indel5, which were 360 ​​kb apart. We continued to narrow the interval in the screened recombinant strains using the developed Indel molecular markers. The target gene was finally determined to be located between Indel4 and Indel14, which were 88 kb apart ( Figure 2 ).

[0094] (4) Development of co-segregating Indel markers

[0095] In the 88Kb candidate segment, we found a 90bp deletion site in the mutant material relative to the wild-type material. We developed the Indel18 molecular marker for this 90bp deletion. By randomly selecting individual plants in the F2 generation, we found that the Indel18 molecular marker co-segregated with the yellowing trait of watermelon ( Figure 3 ).

[0096] The molecular marker Indel18 consists of a pair of upstream primers (Indel18-F) and downstream primers (Indel18-R) for PCR amplification. Specifically:

[0097] Indel18-F: 5'-AGATTGCAAAACTGGAGCAACT-3' (SEQ ID NO. 1);

[0098] Indel18-R: 5'-AGCATTTGCAGCTTTTATCACA-3' (SEQ ID NO. 2);

[0099] The size of the amplified product of this primer in the male parent (yellowing material) is 111 bp, and the size of the amplified product in the female parent (normal material) is 201 bp. Specifically:

[0100] The characteristic band of 111 bp was obtained by PCR amplification. The specific base sequence of the characteristic band of 111 bp is as follows:

[0101] AGATTGCAAAACTGGAGCAACTACATAAGTAGGATCTGGAGAAAAAAGAAAAGAACAACGACGTAATAAAGTGAACCGGTAAGAGCAGCTGTGATAAAAGCTGCAAATGCT (SEQ ID NO. 3).

[0102] A 201 bp characteristic band was obtained by PCR amplification, and the specific base sequence of the 201 bp characteristic band is as follows:

[0103] AGATTGCAAAACTGGAGCAACTACATAAGTAGGATCTGGAGAAAAAAGAAAAGAACAACGCTGTCATTAAGATGGAGACTGTCAACCAAATTGTAAACCAAACATTGTCTAAATGATTTGATAGGATATTGACCTTTCGGCGATGCAGCGACGTAATAAAGTGAACCGGTAAGAGCAGCTGTGATAAAAGCTGCAAATGCT (SEQ ID NO. 4).

[0104] IV. Application of Molecular Markers

[0105] (1) DNA extraction, PCR amplification and electrophoresis detection

[0106] The conventional CTAB method was used for DNA extraction, and the PCR reaction procedure and polyacrylamide gel electrophoresis process referred to Yang Huihui's master's thesis: Fine positioning and functional verification of the watermelon lateral branch gene Clbl, Henan Agricultural University, 2021.

[0107] PCR amplification was performed on the watermelon samples to be tested (parents and F2 population) using the primers. The results showed that if the PCR amplification product was a characteristic band of 111 bp in length, the plant to be tested was a homozygous watermelon yellowing material; if the PCA amplification product was a characteristic band of 201 bp, the plant to be tested was a homozygous watermelon normal material; if the PCA amplification product was two characteristic bands of 111 bp and 201 bp in length, respectively, the plant to be tested was a heterozygous watermelon normal material.

[0108] Therefore, according to the amplified bands, the varieties / genotypes / traits of individual plants can be quickly distinguished; further, the inventors used the Indel18 molecular marker to perform PCR amplification gel electrophoresis detection on natural populations (42 copies) ( Figure 4 ). Combined with the phenotypic data, it was found that the phenotype of the natural material was consistent with the measurement results, indicating that the auxiliary selection rate of the Indel18 marker of the present invention for the yellowing trait molecular marker in the natural population of watermelon was 100%. Based on this result, it is shown that the molecular marker Indel18 of the present invention can effectively distinguish whether the watermelon plant is a yellowing material.

[0109] The molecular marker of the present invention lays a foundation for the final cloning of the Clyp gene and the establishment of a molecular marker-assisted breeding system, and also helps to lay a foundation for the final research on the synthesis and metabolic regulatory network of watermelon chlorophyll.

Claims

1. An Indel marker co-segregating with the yellowing trait of watermelon, characterized in that: Named as Indel18 marker, the Indel18 marker is located at the 90 bp insertion / deletion at positions 61-150 of SEQ ID NO.

4. The upstream primer sequence of the primer pair for amplifying the Indel18 marker is shown in SEQ ID NO.1, and the downstream primer sequence is shown in SEQ ID NO.

2.

2. Use of the Indel marker co-segregating with the yellowing trait of watermelon according to claim 1 in identifying or assisting in identifying the yellowing trait / genotype of watermelon plants.

3. The use according to claim 2, characterized in that: Through the Indel markers that co-segregate the yellowing trait of watermelon, the co-segregated genomic fragments were introduced into existing commercial watermelon varieties, providing watermelon plants with morphological markers that can reflect their own growth conditions.

4. A method for determining yellowing varieties / genotypes of watermelon, characterized in that: The method comprises the following steps: (1) Extracting genomic DNA from watermelon samples to be tested; (2) using the genomic DNA extracted in step (1) as a template and the primer pair described in claim 1, performing PCR amplification on the sample extracted in step (1); (3) detecting the amplified product in step (2) by polyacrylamide gel electrophoresis; (4) Determine based on the electrophoresis band results of step (3). The specific criteria are: If the PCR amplification product has only one characteristic band with a length of 111bp as shown in SEQ ID NO.3, then the watermelon to be tested is a variety / genotype of homozygous watermelon yellowing trait; if the PCR amplification product has only one characteristic band with a length of 201bp as shown in SEQ ID NO.4, then the watermelon to be tested is a normal variety / genotype of homozygous watermelon; if the PCR amplification product has both a characteristic band with a length of 111bp as shown in SEQ ID NO.3 and a characteristic band with a length of 201bp as shown in SEQ ID NO.4, then the watermelon to be tested is a normal variety / genotype of heterozygous watermelon.

5. The method according to claim 4, characterized in that: The DNA of the test materials was extracted using the CTAB method.

6. The method according to claim 4, characterized in that The reaction system for PCR amplification was: DNA 1μL, 2×PCRMix 5μL, upstream primer 0.5μL, downstream primer 0.5μL, sterile distilled water 3μL, total volume 10μL; PCR amplification conditions were: 95℃, 5min; 94℃, 30s, 57℃, 30s, 72℃, 50s, a total of 35 cycles; 72℃, 10min; stored at 4℃.

7. Reagents for detecting the presence of the Indel8 marker in the yellowing gene of watermelon plants Clyp The application of positioning is characterized in that The Indel18 marker is located at the 90 bp insertion / deletion at positions 61-150 of SEQ ID NO.

4. The upstream primer sequence of the primer pair for amplifying the marker is shown in SEQ ID NO.1, and the downstream primer sequence is shown in SEQ ID NO.2.

Images