An anti-aging composition, its preparation method and application
By providing an anti-aging composition containing Ganoderma lucidum polysaccharide, Astragalus polysaccharide, β-nicotinamide single nucleotide, recombinant human lysozyme, carnosine and glutathione, the problem that existing cosmetics are difficult to effectively inhibit and improve skin aging is solved, and the effect of enhancing cell proliferation and antioxidant ability and delaying skin aging is achieved.
Patent Information
- Application Number
- CN202310034942.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-01-10
- Publication Date
- 2025-06-27
- Estimated Expiration
- 2043-01-10
AI Technical Summary
Existing cosmetics are difficult to effectively inhibit and improve skin aging and cannot effectively delay the skin aging process.
An anti-aging composition is provided, including Ganoderma lucidum polysaccharide, Astragalus polysaccharide, β-nicotinamide single nucleotide, recombinant human lysozyme, carnosine and glutathione, which delays skin aging by enhancing cell proliferation ability, inhibiting the expression of secretory phenotype factors related to skin cell aging, and enhancing cell antioxidant ability.
This composition can effectively enhance cell proliferation ability, inhibit the expression of secreted phenotype factors related to skin cell aging, enhance cell antioxidant ability, and thus delay skin aging.
Smart Images

Figure CN116172901B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of cosmetics, and particularly relates to an anti-aging composition, a preparation method thereof, and an application thereof. Background Art
[0002] Skin aging is a physiological or pathological phenomenon of degenerative changes in skin morphology and function caused by the combined action of multiple factors. The influencing factors of skin aging can be divided into exogenous aging and endogenous aging. Exogenous aging is mainly due to exposure to factors such as sunlight, pollution, bacteria, and toxins, resulting in changes in normal skin functions and skin aging. Skin endogenous aging, also known as intrinsic aging, is affected by multiple factors such as genetics, endocrine, microcirculation of skin tissue, skin tissue nutrition, and skin tissue metabolism.
[0003] During the process of skin aging, due to external environments such as sunlight and bacteria, or internal aging factors, the cell phenotypes of some skin cells will change, and the structures and compositions of dermal matrix proteins (including elastic fibers, collagen, and proteoglycans) will change. Cellular senescence is the basis of skin aging. Cellular senescence refers to a state of irreversible proliferation arrest of cells caused by the accumulation of various stress factors (including ultraviolet radiation, free radicals, telomere over-shortening, gene mutations, etc.). In addition to proliferation arrest, active secretory ability is another important characteristic of senescent cells, that is, senescent cells will continuously express a series of pro-inflammatory cytokines (such as IL-1β), chemokines (such as CXCR2), growth factors, and proteases (such as MMP1 and MMP3), etc., which is the so-called senescence-associated secretory phenotype (SASP). These SASP factors make the skin tissue in a low-level chronic inflammatory state, affect the normal differentiation of skin cells, damage the skin stem cell niche, disrupt its function, impair the self-renewal and wound repair abilities of the skin, and lead to skin aging.
[0004] Since skin aging involves both exogenous factors of the skin and many intracellular biological processes, such as changes and stability in DNA repair, mitochondrial function, cell cycle and apoptosis, antioxidant capacity of cells, secretion of cytokines, extracellular matrix, lipid synthesis, ubiquitin-induced proteolysis, and cell metabolism, etc., currently, commercially available cosmetics with anti-aging functions have poor effects and cannot effectively improve and inhibit skin aging. Summary of the Invention
[0005] The object of the present invention is to provide an anti-aging composition, its preparation method and application. The anti-aging composition provided by the present invention can enhance cell proliferation ability, inhibit the expression of skin cell senescence-associated secretory phenotype (SASP) factors, enhance cell antioxidant ability, and effectively delay skin aging.
[0006] In order to achieve the above object, the present invention provides the following technical solutions:
[0007] The present invention provides an anti-aging composition, comprising the following components in parts by mass:
[0008] 6-10 parts of Ganoderma lucidum polysaccharide, 6-10 parts of Astragalus polysaccharide, 1-2 parts of β-nicotinamide mononucleotide, 2-4 parts of recombinant human lysozyme, 1-2 parts of carnosine, 1-2 parts of glutathione.
[0009] Preferably, the mass content of polysaccharide in the Ganoderma lucidum polysaccharide is ≥95%.
[0010] Preferably, the preparation method of the Ganoderma lucidum polysaccharide comprises the following steps:
[0011] Immerse Ganoderma lucidum powder in an organic solvent to obtain a Ganoderma lucidum mixed solution; the organic solvent is ethanol and ether;
[0012] Heat the Ganoderma lucidum mixed solution for degreasing, after solid-liquid separation, collect the solid-phase component to obtain degreased Ganoderma lucidum powder;
[0013] Disperse the degreased Ganoderma lucidum powder in water to obtain a degreased Ganoderma lucidum powder aqueous dispersion;
[0014] Boil and extract the degreased Ganoderma lucidum powder aqueous dispersion, after solid-liquid separation, collect the liquid-phase component to obtain a Ganoderma lucidum extract;
[0015] Concentrate the Ganoderma lucidum extract to obtain a Ganoderma lucidum concentrated solution;
[0016] Mix the Ganoderma lucidum concentrated solution and an organic extractant for extraction to obtain a Ganoderma lucidum extraction aqueous phase;
[0017] Mix the Ganoderma lucidum extraction aqueous phase and ethanol for alcohol precipitation, and collect the ethanol precipitate to obtain a crude Ganoderma lucidum polysaccharide;
[0018] Dissolve the crude Ganoderma lucidum polysaccharide in water, and perform column chromatography purification to obtain an eluate containing Ganoderma lucidum polysaccharide; the eluate for column chromatography purification is an aqueous sodium chloride solution;
[0019] Dialyze the eluate containing Ganoderma lucidum polysaccharide, and collect the dialysate and dry it to obtain a pure product of Ganoderma lucidum polysaccharide.
[0020] Preferably, the mass content of polysaccharide in the astragalus polysaccharide is ≥96%.
[0021] Preferably, the preparation method of the astragalus polysaccharide comprises the following steps:
[0022] Immerse the astragalus powder in an organic solvent to obtain an astragalus mixed solution; the organic solvent is ethanol and ether;
[0023] Heat the astragalus mixed solution for defatting, after solid-liquid separation, collect the solid-phase component to obtain defatted astragalus powder;
[0024] Disperse the defatted astragalus powder in an alkaline aqueous solution to obtain a defatted astragalus powder dispersion; the pH value of the alkaline aqueous solution is ≥9;
[0025] Boil and extract the defatted astragalus powder dispersion, after solid-liquid separation, collect the liquid-phase component to obtain an astragalus extract;
[0026] Adjust the pH of the astragalus extract to 6-7 and then concentrate it to obtain an astragalus concentrated solution;
[0027] Mix the astragalus concentrated solution and an organic extractant for extraction to obtain an astragalus extraction aqueous phase;
[0028] Mix the astragalus extraction aqueous phase and ethanol for alcohol precipitation, collect the ethanol precipitate to obtain a crude astragalus polysaccharide;
[0029] Dissolve the crude astragalus polysaccharide in water and perform column chromatography purification to obtain an eluate containing astragalus polysaccharide; the eluate for column chromatography purification is an aqueous sodium chloride solution;
[0030] Dialyze the eluate containing astragalus polysaccharide, collect the dialysate and dry it to obtain a pure product of astragalus polysaccharide.
[0031] Preferably, the purity of the recombinant human lysozyme is ≥99%; the specific activity of the recombinant human lysozyme is ≥120000 U / mg.
[0032] Preferably, the recombinant human lysozyme is obtained by purification after being expressed from a nucleotide sequence shown in SEQ ID NO.1.
[0033] The present invention provides an application of the anti-aging composition according to the above technical solution in anti-aging cosmetics.
[0034] Preferably, the mass percentage content of the anti-aging composition in the anti-aging cosmetics is 5-30%.
[0035] Preferably, the anti-aging cosmetics include one or more of skin care lotion, skin care milk, cream, essence, facial cleanser, facial mask, body gel, lipstick and eyeshadow.
[0036] The present invention provides an anti-aging composition, comprising the following components in parts by mass: 6-10 parts of ganoderma lucidum polysaccharide, 6-10 parts of astragalus polysaccharide, 1-2 parts of β-nicotinamide mononucleotide, 2-4 parts of recombinant human lysozyme, 1-2 parts of carnosine, and 1-2 parts of glutathione. In the composition provided by the present invention: Ganoderma lucidum polysaccharide has the function of regulating the body's immunity. By activating the differentiation and maturation of dendritic cells and macrophages, inducing natural killer cells, regulating the proliferation and immune response of T and B lymphocytes, and promoting the generation of immune cytokines, it is used to enhance the body's non-specific and specific immunity. Ganoderma lucidum polysaccharide can also improve the ability of the liver, bone marrow, and blood to synthesize DNA, RNA, and proteins; Astragalus polysaccharide is composed of hexuronic acid, glucose, fructose, rhamnose, arabinose, galacturonic acid, glucuronic acid, etc., and can be used as an immune promoter or regulator. At the same time, it has the effects of antiviral, anti-tumor, anti-aging, anti-radiation, anti-stress, antioxidant, etc.; β-nicotinamide mononucleotide (NMN) is a direct precursor of nicotinamide adenine dinucleotide (NAD + ), and NAD + is a key molecule in cellular energy metabolism and is crucial for regulating cell aging and maintaining normal body functions; NMN not only has significant effects such as anti-wrinkle, freckle and pigment removal, but also has the effects of anti-inflammatory, sunscreen, anti-aging, etc.; The amino acid sequence of recombinant human lysozyme is exactly the same as that of human natural lysozyme, and its use in the human body will not cause side effects such as immune reactions and allergic reactions; Carnosine (L-Carnosine) has anti-inflammatory, anti-glycation, antioxidant and chelating effects; Glutathione (glutathione, r-glutamyl cysteingl + glycine, GSH) is a tripeptide containing γ-amide bond and sulfhydryl group, composed of glutamic acid, cysteine and glycine, which can help maintain the normal function of the immune system and has antioxidant and integrated detoxification effects. The present invention realizes the effect of systematic anti-aging by using the above six components within an appropriate range of parts by mass. In summary, the anti-aging composition provided by the present invention can enhance cell proliferation ability, inhibit the expression of senescence associated secretory phenotype (SASP) factors related to skin cell aging, enhance cell antioxidant ability, and effectively delay skin aging. BRIEF DESCRIPTION OF THE DRAWINGS
[0037] Figure 1 It is a graph showing the influence of compositions 1-6 provided by the embodiments of the present invention on the proliferation activity of human primary fibroblasts;
[0038] Figure 2 It is a graph showing the influence of compositions 1-6 provided by the embodiments of the present invention on the proliferation activity of HaCaT;
[0039] Figure 3Effect of Compositions 1-6 provided in the embodiments of the present invention on the expression of SASP factors in primary human fibroblasts;
[0040] Figure 4 Effect of Compositions 1-6 provided in the embodiments of the present invention on the expression of SASP factors in HaCaT cells. Detailed implementation manners
[0041] The present invention provides an anti-aging composition, comprising the following components in parts by mass:
[0042] 6-10 parts of Ganoderma lucidum polysaccharide, 6-10 parts of Astragalus polysaccharide, 1-2 parts of β-nicotinamide mononucleotide, 2-4 parts of recombinant human lysozyme, 1-2 parts of carnosine, 1-2 parts of glutathione.
[0043] In the present invention, unless otherwise specified, all preparation raw materials / components are commercially available products well-known to those skilled in the art.
[0044] By mass, the anti-aging composition provided by the present invention comprises 6-10 parts of Ganoderma lucidum polysaccharide, preferably 6.5-9 parts, and more preferably 7-8 parts.
[0045] In the present invention, the mass content of polysaccharide in the Ganoderma lucidum polysaccharide is preferably ≥95%. In the present invention, the mass content of polysaccharide in the Ganoderma lucidum polysaccharide is measured by the phenol-sulfuric acid method.
[0046] In the present invention, the preparation method of the Ganoderma lucidum polysaccharide preferably comprises the following steps:
[0047] Impregnate Ganoderma lucidum powder in an organic solvent to obtain a Ganoderma lucidum mixed solution; the organic solvent is ethanol and ether;
[0048] Heat the Ganoderma lucidum mixed solution for defatting, and after solid-liquid separation, collect the solid-phase component to obtain defatted Ganoderma lucidum powder;
[0049] Disperse the defatted Ganoderma lucidum powder in water to obtain a defatted Ganoderma lucidum powder aqueous dispersion;
[0050] Boil and extract the defatted Ganoderma lucidum powder aqueous dispersion, and after solid-liquid separation, collect the liquid-phase component to obtain a Ganoderma lucidum extract;
[0051] Concentrate the Ganoderma lucidum extract to obtain a Ganoderma lucidum concentrate;
[0052] Mix the Ganoderma lucidum concentrate and an organic extractant for extraction to obtain a Ganoderma lucidum extraction aqueous phase;
[0053] Mix the Ganoderma lucidum extraction aqueous phase and ethanol for alcohol precipitation, and collect the ethanol precipitate to obtain a crude Ganoderma lucidum polysaccharide;
[0054] Dissolve the crude ganoderma polysaccharide in water and perform column chromatography purification to obtain an eluate containing ganoderma polysaccharide; the eluate for column chromatography purification is an aqueous sodium chloride solution;
[0055] Dialyze the eluate containing ganoderma polysaccharide, and collect the dialysate. After drying, obtain the pure product of ganoderma polysaccharide.
[0056] In the present invention, the ganoderma powder is impregnated in an organic solvent to obtain a ganoderma mixed solution; the organic solvent is ethanol and ether. In the present invention, the preparation method of the ganoderma powder preferably includes the following steps: successively drying, slicing, pulverizing and sieving the ganoderma entity to obtain the ganoderma powder; the drying is preferably vacuum drying, and the temperature of the vacuum drying is preferably 65 °C; the drying is preferably carried out in a vacuum drying oven. In the present invention, the diameter of the sieve used for sieving is preferably 40 mesh; the particle size of the ganoderma powder is preferably <0.4 mm. In the present invention, the volume ratio of the ethanol to the ether is preferably 1:1; the liquid-solid ratio of the ganoderma powder to the organic solvent is preferably 1:10.
[0057] After obtaining the ganoderma mixed solution, the present invention heats the ganoderma mixed solution for defatting. After solid-liquid separation, collect the solid phase component to obtain defatted ganoderma powder. In the present invention, the temperature of the heating for defatting is preferably 50 °C, the time of the heating for defatting is preferably 2-3 h, and the heating for defatting is preferably carried out under the condition of water bath reflux. In the present invention, the specific implementation manner of the solid-liquid separation is preferably filtration. The present invention preferably dries the solid phase component collected by the solid-liquid separation to obtain defatted ganoderma powder.
[0058] After obtaining the defatted ganoderma powder, the present invention disperses the defatted ganoderma powder in water to obtain a defatted ganoderma powder aqueous dispersion. In the present invention, the water is preferably deionized water; the liquid-solid ratio of the defatted ganoderma powder to water is preferably 1:20.
[0059] After obtaining the defatted ganoderma powder aqueous dispersion, the present invention boils and extracts the defatted ganoderma powder aqueous dispersion. After solid-liquid separation, collect the liquid phase component to obtain a ganoderma extract. In the present invention, the temperature of the boiling extraction is preferably 100 °C, and the holding time of the boiling extraction is preferably 3-4 h; the boiling extraction is preferably carried out under the condition of water bath. The present invention preferably cools the feed liquid obtained by the boiling extraction to room temperature and then performs the solid-liquid separation. In the present invention, the specific implementation manner of the solid-liquid separation is preferably centrifugation, and the rotation speed of the centrifugation is preferably 10000 rpm; the time of the centrifugation is preferably 10-20 min, and the supernatant is taken to obtain the ganoderma extract.
[0060] After obtaining the Ganoderma lucidum extract, the present invention concentrates the Ganoderma lucidum extract to obtain a concentrated Ganoderma lucidum extract. In the present invention, the volume of the concentrated Ganoderma lucidum extract is preferably 20-30% of the volume of the Ganoderma lucidum extract. The present invention has no special requirements for the specific implementation manner of the concentration.
[0061] After obtaining the concentrated Ganoderma lucidum extract, the present invention mixes the concentrated Ganoderma lucidum extract with an organic extractant for extraction to obtain an aqueous phase of Ganoderma lucidum extract. In the present invention, the organic extractant is preferably chloroform and n-butanol; the volume ratio of chloroform to n-butanol is preferably 4:1; the volume of the organic extractant is preferably 30% of the volume of the concentrated Ganoderma lucidum extract. In the present invention, the mixing is preferably shaking mixing, and the time of the shaking mixing is preferably 20 min; the extraction is preferably static extraction, and the time of the extraction is preferably 15-30 min; the present invention preferably removes the denatured protein at the junction of the water layer and the organic extractant layer, and the remaining aqueous phase is the aqueous phase of Ganoderma lucidum extract.
[0062] After obtaining the aqueous phase of Ganoderma lucidum extract, the present invention mixes the aqueous phase of Ganoderma lucidum extract with ethanol for ethanol precipitation, and collects the ethanol precipitate to obtain a crude Ganoderma lucidum polysaccharide. In the present invention, the ethanol is preferably anhydrous ethanol; in the present invention, the ethanol precipitation preferably includes the following steps: mixing the aqueous phase of Ganoderma lucidum extract with a part of ethanol for the first ethanol precipitation; centrifuging to obtain a supernatant and a first ethanol precipitate; mixing the supernatant with the remaining ethanol for the second ethanol precipitation, and centrifuging to obtain a second ethanol precipitate; combining the first ethanol precipitate and the second ethanol precipitate to obtain the crude Ganoderma lucidum polysaccharide; in the mixed solution obtained by mixing the aqueous phase of Ganoderma lucidum extract with a part of ethanol, the mass percentage of the part of ethanol is preferably 50%; the temperature of the first ethanol precipitation is preferably 4°C; the time of the first ethanol precipitation is preferably 18-24 h. In the mixed solution obtained by mixing the supernatant with the remaining ethanol, the mass percentage of the remaining ethanol is preferably 70%; the temperature of the second ethanol precipitation is preferably 4°C; the time of the second ethanol precipitation is preferably 18-24 h. The present invention preferably stores the crude Ganoderma lucidum polysaccharide frozen.
[0063] After obtaining the crude Ganoderma lucidum polysaccharide, the present invention dissolves the crude Ganoderma lucidum polysaccharide in water and performs column chromatography purification to obtain an eluate containing Ganoderma lucidum polysaccharide; the eluate of the column chromatography purification is an aqueous sodium chloride solution. In the present invention, the column used for the column chromatography purification is preferably a DEAE-52 cellulose column; the molar concentration of the aqueous sodium chloride solution is preferably 0.1 mol / L; the present invention preferably collects the elution solution in fractions and detects the content of Ganoderma lucidum polysaccharide in each tube of the obtained elution solution by the sulfuric acid-phenol method; the eluates with a Ganoderma lucidum polysaccharide mass percentage greater than 0.5% are combined to obtain the eluate containing Ganoderma lucidum polysaccharide.
[0064] After obtaining the eluate containing Ganoderma lucidum polysaccharide, the present invention dialyzes the eluate containing Ganoderma lucidum polysaccharide, and collects the dialysate and dries it to obtain the pure product of Ganoderma lucidum polysaccharide. In the present invention, the cut-off molecular weight of the dialysis bag used for dialysis is preferably 3.5 kDa; the present invention preferably uses flowing water for the dialysis. The present invention preferably removes small molecule impurities in the eluate containing Ganoderma lucidum polysaccharide through the dialysis. In the present invention, the drying is preferably freeze-drying.
[0065] Based on 1 part by mass of the Ganoderma lucidum polysaccharide, the anti-aging composition provided by the present invention comprises 6 to 10 parts by mass of Astragalus polysaccharide, preferably 6.5 to 9 parts by mass, and more preferably 7 to 8 parts by mass.
[0066] In the present invention, the mass content of polysaccharide in the Astragalus polysaccharide ≥ 96%. In the present invention, the mass content of polysaccharide in the Astragalus polysaccharide is measured by the phenol-sulfuric acid method.
[0067] In the present invention, the preparation method of the Astragalus polysaccharide preferably comprises the following steps:
[0068] Immerse the Astragalus powder in an organic solvent to obtain an Astragalus mixed solution; the organic solvent is ethanol and ether;
[0069] Heat the Astragalus mixed solution for degreasing, after solid-liquid separation, collect the solid phase component to obtain the degreased Astragalus powder;
[0070] Disperse the degreased Astragalus powder in an alkaline aqueous solution to obtain a degreased Astragalus powder dispersion; the pH value of the alkaline aqueous solution ≥ 9;
[0071] Boil and extract the degreased Astragalus powder dispersion, after solid-liquid separation, collect the liquid phase component to obtain an Astragalus extract;
[0072] Adjust the pH value of the Astragalus extract to 6 - 7 and then concentrate it to obtain an Astragalus concentrate;
[0073] Mix the Astragalus concentrate and an organic extractant for extraction to obtain an Astragalus extraction aqueous phase;
[0074] Mix the Astragalus extraction aqueous phase and ethanol for alcohol precipitation, and collect the ethanol precipitate to obtain a crude product of Astragalus polysaccharide;
[0075] Dissolve the crude product of Astragalus polysaccharide in water, and perform column chromatography purification to obtain an eluate containing Astragalus polysaccharide; the eluate for column chromatography purification is an aqueous sodium chloride solution;
[0076] Dialyze the eluate containing Astragalus polysaccharide, and collect the dialysate and dry it to obtain the pure product of Astragalus polysaccharide.
[0077] The astragalus polysaccharide described in the present invention is prepared from astragalus traditional Chinese medicine decoction pieces. In the present invention, the astragalus polysaccharide exists in astragalus fibers. The present invention preferably extracts the astragalus polysaccharide under alkaline conditions. On the one hand, the swelling effect and solubility of the fibers can be significantly increased. On the other hand, the ester bonds between the fibers are more likely to break and undergo a peeling reaction, so that more polysaccharides can be extracted in a free form, thereby increasing the extraction rate of the polysaccharides.
[0078] In the present invention, the astragalus powder is impregnated in an organic solvent to obtain an astragalus mixed solution; the organic solvent is ethanol and ether. In the present invention, the preparation method of the astragalus powder preferably includes the following steps: crushing and screening astragalus traditional Chinese medicine decoction pieces to obtain the astragalus powder; in the present invention, the diameter of the sieve used for screening is preferably 40 mesh; the particle size of the astragalus powder is preferably <0.4 mm. In the present invention, the volume ratio of the ethanol to the ether is preferably 1:1; the liquid-solid ratio of the astragalus powder to the organic solvent is preferably 1:10.
[0079] After obtaining the astragalus mixed solution, the present invention heats and defats the astragalus mixed solution, and after solid-liquid separation, the solid phase component is collected to obtain defatted astragalus powder. In the present invention, the temperature of the heating and defatting is preferably 50 °C, the time of the heating and defatting is preferably 2-3 h, and the heating and defatting is preferably carried out under the condition of water bath reflux. In the present invention, the specific implementation manner of the solid-liquid separation is preferably filtration. The present invention preferably dries the solid phase component collected by the solid-liquid separation to obtain defatted astragalus powder.
[0080] After obtaining the defatted astragalus powder, the present invention disperses the defatted astragalus powder in an alkaline aqueous solution to obtain a defatted astragalus powder dispersion; the pH value of the alkaline aqueous solution is preferably ≥9. In the present invention, the pH value of the alkaline aqueous solution is more preferably 9-10; the alkaline aqueous solution is specifically preferably a Ca(OH)2 aqueous solution. In the present invention, the liquid-solid ratio of the defatted astragalus powder to the alkaline aqueous solution is preferably 1:10.
[0081] After obtaining the defatted astragalus powder dispersion, the present invention boils and extracts the defatted astragalus powder dispersion, and after solid-liquid separation, the liquid phase component is collected to obtain an astragalus extract. In the present invention, the heat preservation time of the boiling extraction is preferably 3-4 h; the boiling extraction is preferably carried out under the condition of water bath. The present invention preferably cools the material liquid obtained by the boiling extraction to room temperature and then carries out the solid-liquid separation. In the present invention, the specific implementation manner of the solid-liquid separation is preferably filtration with 8 layers of gauze, and the present invention combines the filtrates to obtain the astragalus extract.
[0082] After obtaining the astragalus extract, the present invention adjusts the pH of the astragalus extract and then concentrates it to obtain an astragalus concentrated solution. In the present invention, after adjusting the pH, the pH value of the astragalus extract is preferably 6-7, more preferably 6.5-7; in the present invention, the volume of the astragalus concentrated solution is preferably 20-30% of the volume of the astragalus extract. The present invention has no special requirements for the specific implementation manner of the concentration.
[0083] After obtaining the astragalus concentrated solution, the present invention mixes the astragalus concentrated solution with an organic extractant for extraction to obtain an astragalus extraction aqueous phase. In the present invention, the organic extractant is preferably chloroform and n-butanol; the volume ratio of chloroform to n-butanol is preferably 4:1; the volume of the organic extractant is preferably 30% of the volume of the astragalus concentrated solution. In the present invention, the mixing is preferably shaking mixing, and the time of the shaking mixing is preferably 20 min; the extraction is preferably static extraction, and the extraction time is preferably 15-30 min; the present invention preferably removes the denatured protein at the junction of the water layer and the organic extractant layer, and the remaining aqueous phase is the astragalus extraction aqueous phase.
[0084] After obtaining the astragalus extraction aqueous phase, the present invention mixes the astragalus extraction aqueous phase with ethanol for alcohol precipitation, and collects the ethanol precipitate to obtain a crude astragalus polysaccharide product. In the present invention, the ethanol is preferably ethanol with a mass percentage content of preferably 95%; in the present invention, the volume ratio of the astragalus extraction aqueous phase to ethanol is preferably 1:3; the temperature of the alcohol precipitation is preferably 4°C; the time of the alcohol precipitation is preferably 18-24 h. The present invention preferably stores the crude astragalus polysaccharide product frozen.
[0085] After obtaining the crude astragalus polysaccharide product, the present invention dissolves the crude astragalus polysaccharide product in water and performs column chromatography purification to obtain an eluate containing astragalus polysaccharide; the eluate of the column chromatography purification is an aqueous sodium chloride solution. In the present invention, the column used for column chromatography purification is preferably a DEAE-52 cellulose column; the molar concentration of the aqueous sodium chloride solution is preferably 0.1 mol / L; the present invention preferably collects the elution solution in fractions and detects the content of astragalus polysaccharide in each tube of the obtained elution solution by the sulfuric acid-phenol method; the eluates with an astragalus polysaccharide mass percentage content greater than 0.5% are combined to obtain the eluate containing astragalus polysaccharide.
[0086] After obtaining the eluate containing astragalus polysaccharide, the present invention fills the eluate containing astragalus polysaccharide into a dialysis bag for dialysis, and after drying, a pure astragalus polysaccharide product is obtained. In the present invention, the cut-off molecular weight of the dialysis bag is preferably 3.5 kDa; the present invention preferably uses flowing water for the dialysis. The present invention preferably removes small molecule impurities in the eluate containing astragalus polysaccharide through the dialysis. In the present invention, the drying is preferably freeze-drying.
[0087] Based on 1 part by mass of the ganoderma lucidum polysaccharide, the anti-aging composition provided by the present invention comprises 1 to 2 parts of β-nicotinamide mononucleotide, preferably 1.2 to 1.8 parts, and more preferably 1.4 to 1.6 parts.
[0088] In the examples of the present invention, the β-nicotinamide mononucleotide used is preferably purchased from Hubei Guoheng Medical Technology Co., Ltd. and is a pharmaceutical grade product.
[0089] Based on 1 part by mass of the ganoderma lucidum polysaccharide, the anti-aging composition provided by the present invention comprises 2 to 4 parts of recombinant human lysozyme, preferably 2.2 to 3.5 parts, and more preferably 2.5 to 3 parts.
[0090] In the present invention, the purity of the recombinant human lysozyme is preferably ≥99%; the specific activity of the recombinant human lysozyme is preferably ≥120000 U / mg; the recovery rate of the active protein of the recombinant human lysozyme is preferably ≥80%. In the present invention, the specific activity of the recombinant human lysozyme is determined with reference to the national standard GBT 25879-2010.
[0091] In the present invention, the recombinant human lysozyme is a white freeze-dried powder, odorless, soluble in water, and insoluble in ether and acetone.
[0092] In the present invention, the recombinant human lysozyme is obtained by purification after being expressed from a nucleotide sequence shown in SEQ ID NO.1.
[0093] In the present invention, the SEQ ID NO.1 is:
[0094] cgaaggatccaaacgatgagatttccttcaatttttactgcagttttattcgcagcatcctccgcattagctgctccagtcaacactacaacagaagatgaaacggcacaaattccggctgaagctgtcatcggttactcagatttagaaggggatttcgatgttgctgttttgccattttccaacagcacaaataacgggttattgtttataaatactactattgccagcattgctgctaaagaagaaggggtatctctcgagaaaagagaggctgaagctaaggtcttcgagagatgtgagttggctagaaccttgaagagacttggtatggacggttacagaggtatttccttggctaattggatgtgcttggctaagtgggagtctggctacaataccagagctactaactacaacgctggtgacagatccactgactacggtattttccagatcaattcccgttactggtgcaacgacggtaagaccccaggcgctgtcaatgcttgtcacttgtcctgttccgctttgctgcaagacaatatcgctgacgccgtcgcctgtgccaagagagttgttagagacccacaaggtattagagcttgggtcgcttggagaaatagatgtcaaaatagagacgttagacaatacgtccaaggttgcggtgtctaggaattcccta。
[0095] The recombinant human lysozyme provided by the present invention preferably synthesizes the SEQ ID NO.1 sequence according to the preferred codons of Pichia pastoris (P.pastoris), and clones the SEQ ID NO.1 into the secretory expression plasmid pPIC9K at the BamHI and EcoRI sites to obtain the recombinant plasmid pPIC9K-LYC71; the linearized recombinant plasmid is electrotransformed into GS115 respectively, integrated into the yeast genome at a fixed point, and through nutritional screening and multi-copy identification, a multi-copy insertion strain with a stably integrated expression vector is obtained; through shake flask culture and induction expression, strains with relatively high protein expression levels and activities are initially screened out; then, density fermentation is scaled up in 50L and 500L fermenters; after the fermentation broth is centrifuged and filtered, the protein is purified using a composite cation exchange column with MMC as the packing material, and the purified protein solution is stored by freeze-drying.
[0096] In the present invention, the purification preferably includes the following steps:
[0097] Use centrifugation to remove solid impurities in the fermentation broth containing recombinant human lysozyme, and collect the supernatant of the fermentation broth.
[0098] Equilibrate the chromatography column with 30 mmol / L phosphate buffer at pH 6.2.
[0099] Equilibrate for 3 - 7 column volumes at a flow rate of 50 - 150 mL per minute, and ensure that the chromatography column is equilibrated to the baseline by ultraviolet detection.
[0100] Pass the sample with a pH value of 6.0 - 7.0 through the chromatography column pre-equilibrated with the buffer; the sample is the supernatant of the yeast culture broth containing recombinant human lysozyme, and the conductivity strength is preferably 15 - 20 ms / cm.
[0101] Wash the chromatography column with 30 mmol / L phosphate buffer at pH 6.2 containing 0.05 mol / L sodium chloride for 2 - 3 column volumes to wash out all unbound impurities from the chromatography column.
[0102] Equilibrate the chromatography column with 30 mmol / L phosphate buffer at pH 6.2 for 2 - 3 column volumes.
[0103] Elute the recombinant human lysozyme from the chromatography column with 20 - 30 mmol / L phosphate buffer at pH 6.2 containing 0.5 - 1.0 mol / L sodium chloride, and collect the eluted peak protein.
[0104] The collected eluted peak protein is desalted and freeze-dried to prepare a sterile freeze-dried powder to obtain a pure protein sample of recombinant human lysozyme.
[0105] The present invention preferably prepares the obtained pure protein sample of recombinant human lysozyme into a sterile freeze-dried powder by freeze-drying.
[0106] Based on the parts by mass of the ganoderma lucidum polysaccharide, the anti-aging composition provided by the present invention comprises 1 to 2 parts of carnosine, preferably 1.2 to 1.8 parts, and more preferably 1.4 to 1.6 parts.
[0107] The carnosine involved in the present invention is preferably purchased from Jiangsu Jiujia Biotechnology Co., Ltd. and is a pharmaceutical grade product.
[0108] Based on the parts by mass of the ganoderma lucidum polysaccharide, the anti-aging composition provided by the present invention comprises 1 to 2 parts of glutathione, preferably 1.2 to 1.8 parts, and more preferably 1.4 to 1.6 parts.
[0109] The glutathione involved in the present invention is preferably purchased from Henan Kangzhiwang Biotechnology Co., Ltd. and is a pharmaceutical grade product.
[0110] The present invention provides the application of the anti-aging composition described in the above technical solution in anti-aging cosmetics.
[0111] In the present invention, the mass percentage content of the anti-aging composition in the anti-aging cosmetics is preferably 5 to 30%.
[0112] In the present invention, the anti-aging cosmetics preferably include one or more of skin care lotion, skin care milk, cream, essence, facial cleanser, facial mask, body gel, lipstick and eyeshadow.
[0113] In order to further illustrate the present invention, the technical solution provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.
[0114] Example 1
[0115] Preparation of pure ganoderma lucidum polysaccharide:
[0116] The sample of Ganoderma lucidum fruiting body (Anhui Huangshan Yunle Ganoderma Co., Ltd.) was placed in a vacuum drying oven and dried at 65 °C, then sliced, crushed, and passed through a 40-mesh sieve; 500 grams of Ganoderma lucidum powder was accurately weighed, soaked with a mixed solution of ethanol:ether (volume ratio 1:1) at a solid-liquid ratio of 1:10, refluxed in a water bath at 50 °C for 3 hours, filtered, and the solid part was dried; the defatted Ganoderma lucidum powder was added with deionized water at a solid-liquid ratio of 1:20, heated in a water bath at 100 °C for 3 hours, then cooled to room temperature, and centrifuged at 10000 rpm for 10 minutes; the supernatant was collected; the collected supernatant was concentrated to 30% of the original volume to obtain a Ganoderma lucidum concentrated solution; Sevage reagent (Sevage reagent is chloroform and n-butanol, chloroform and n-butanol volume ratio = 4:1) was added at a volume ratio of 30% of the volume of the Ganoderma lucidum concentrated solution, mixed and shaken for 20 minutes, left standing for 20 minutes, the denatured protein at the junction of the water layer and the solvent layer was removed, and the aqueous phase part was reserved for use; pure ethanol was added to the aqueous phase part to make the ethanol concentration reach 50% by volume of the solution after mixing the aqueous phase and ethanol, and left standing at 4 °C for alcohol precipitation for 24 hours, and centrifuged to obtain an ethanol precipitate and a supernatant; pure ethanol was added to the supernatant part again to make the ethanol volume percentage in the solution after mixing the supernatant and pure ethanol reach 70%, and left standing at 4 °C for alcohol precipitation for 20 hours; the ethanol precipitate was obtained by centrifugation. The ethanol precipitates obtained above were combined to obtain a crude Ganoderma lucidum polysaccharide product, which was stored frozen; the crude Ganoderma lucidum polysaccharide product was dissolved in water, purified by a DEAE-52 cellulose column, eluted with 0.1 mol / L NaCl solution, collected in fractions, detected by the phenol-sulfuric acid method, and the eluates with a Ganoderma lucidum polysaccharide mass percentage greater than 0.5% were collected and combined; the eluate containing Ganoderma lucidum polysaccharide was dialyzed against running water with a dialysis bag with a cut-off molecular weight of 3.5 kDa to remove small molecules, and the purified Ganoderma lucidum polysaccharide product after dialysis was freeze-dried for standby. The total sugar content was determined by the phenol-sulfuric acid method, and the polysaccharide content in the Ganoderma lucidum polysaccharide was 95.6%;
[0117] Example 2
[0118] Preparation of pure Astragalus polysaccharide:
[0119] Weigh the astragalus Chinese herbal pieces, crush them into powder, and sieve through a 40-mesh sieve. Weigh 200 grams of astragalus powder, soak it with a mixed solution of ethanol and ether (volume ratio 1:1) according to a solid-liquid ratio of 1:10, reflux in a water bath at 50 °C for 3 hours, filter, and evaporate the solid part to dryness; boil the defatted solid part with a Ca(OH)2 solution (pH = 10) at a solid-liquid ratio of 1:10 for 4 hours for extraction, filter with 8 layers of gauze, and combine the filtrates to adjust the pH value to 6.5. Concentrate the collected filtrate with a pH value of 6.5 to 20% of the original volume, add Sevage reagent (Sevage reagent is chloroform and n-butanol, chloroform:n-butanol volume ratio = 4:1) according to a volume ratio of 30% of the concentrated volume, mix and shake for 20 minutes, let stand for 30 minutes, remove the denatured protein at the junction of the water layer and the solvent layer, and retain the aqueous phase for use; add 3 volumes of 95% ethanol to the aqueous phase for precipitation, place it at 4 °C for 24 hours for precipitation, and freeze and store the obtained crude astragalus polysaccharide; dissolve the obtained crude astragalus polysaccharide in water, purify it with a DEAE-52 cellulose column, elute it with a 0.1 mol / L NaCl solution, collect in fractions, detect by the sulfuric acid-phenol method, collect and combine the eluates with an astragalus polysaccharide mass percentage content greater than 0.5% to obtain an eluate containing astragalus polysaccharide; dialyze the eluate containing astragalus polysaccharide with a dialysis bag with a cut-off molecular weight of 3.5 kDa against running water to remove small molecules, and freeze-dry the purified astragalus polysaccharide after dialysis for standby. The polysaccharide content is determined by the phenol-sulfuric acid method, and the polysaccharide content in the purified astragalus polysaccharide is 96.3%.
[0120] Example 3
[0121] Preparation of recombinant human lysozyme:
[0122] 1. First, construct a recombinant Pichia pastoris engineering strain (FHX-LYC71) expressing human lysozyme, specifically as follows:
[0123] 1) Synthesize the artificial synthetic sequence SEQ ID NO.1 through a gene synthesis company. SEQ ID NO.1 contains the Saccharomyces cerevisiae α-factor signal peptide sequence (alpha-factor sequence) and the codon-optimized mature peptide sequence of human lysozyme, and clone SEQ ID NO.1 into the secretory expression plasmid pPIC9K at the BamHI and EcoRI sites to obtain the recombinant plasmid pPIC9K-LYC71.
[0124] 2) Digest the recombinant plasmid pPIC9K-LYC71 with Sal I alone to linearize it at the His4 site, then electrotransform the above linearized plasmid into Pichia pastoris GS115 competent cells, and then spread the transformed Pichia pastoris GS115 competent cells on an MD plate. After culturing, pick 500 His + transformants, and the His on the MD plate +500 transformants were inoculated into a 96-well plate containing 250 μL of YPD and cultured at 30 °C for 24 hours. 1 μL of the bacterial solution from each well was spotted onto MM and MD plates (note: the clone numbers are the same). The plates were cultured at 30 °C until white colonies appeared. By comparative observation, clones that grew well on both the MD and MM plates were of the Mut + phenotype; clones that grew well on the MD plate but poorly or not at all on the MM plate were of the Muts phenotype. 200 clones with good growth on both the MD and MM plates, i.e., the Mut + phenotype, were selected;
[0125] 3) G418 resistance screening: 200 clones with the Mut + phenotype were picked from the MD plate using a sterilized toothpick and inoculated onto YPD plates containing geneticin G418 at concentrations of 2.0, 3.0, and 4.0 mg / mL, and cultured at 30 °C for 96 hours. 200 clones on the YPD plates containing geneticin G418 were selected;
[0126] 4) Multiple clones on the YPD plates containing geneticin G418 were first verified by PCR: The verification method was as follows: The direct PCR method using bacterial solution was adopted. A pipette tip was gently dipped into a small amount of the plate (selecting the transformant clones on the YPD plate containing 4 mg / mL G418 as the main ones because they are multi-copy), dissolved in 20 μL of sterile water, and 1 μL was taken as the PCR template. PCR amplification was carried out using the primers LYC71-F and LYC71-R for the coding fragment of human lysozyme. Among them, LYC71-F has the nucleotide sequence shown in SEQ ID NO.2, and SEQ ID NO.2 is: AAGGTCTTCGAGAGATGTGAG; LYC71-R has the nucleotide sequence shown in SEQ ID NO.3, and SEQ ID NO.3 is: GACACCGCAACCTTGGACGT.
[0127] PCR reaction system: The total volume of the PCR reaction system was 25 μL, specifically as follows: 10×Pyrobest buffer 2.5 μL; dNTPs (25 mmol each) 2.0 μL; LYC71-F (5 pmol / μL) 1.0 μL; LYC71-R (5 pmol / μL) 1.0 μL; template bacterial solution 1.0 μL; Pyrobest DNA polymerase (2.5 U / μL) 0.2 μL; ddH2O 17.3 μL.
[0128] PCR reaction conditions: 95°C, 5 min → (95°C, 30 s; 63°C, 30 s; 72°C, 1 min) × 30 cycles → 72°C, 5 min → 4°C, 5 min. After the reaction, select the colonies that grow on the YPD plate with 4.0 mg / mL Geneticin G418 for the following small-scale expression experiment;
[0129] 5) Small-scale expression experiment of recombinant strains: For the colonies that grow on the YPD plate with 4.0 mg / mL Geneticin G418, conduct a small-scale expression experiment: (1) Pick a single colony and inoculate 3 mL of YPD medium into a test tube, incubate at 28 - 30°C, 250 rpm, and shake culture until OD600 = 2 - 6 (16 - 18 h); (2) Take 1 mL of the above bacterial solution and inoculate it into 30 mL of BMGY medium in a 250 mL Erlenmeyer flask for shake flask culture, incubate at 28 - 30°C, 250 rpm, and shake culture for 24 h; (3) Centrifuge at 1500 × g for 5 min at room temperature using a 50 mL sterile centrifuge tube to collect the cells, resuspend the cells with an equal volume of BMMY medium, transfer to a shake flask, and start induction, continue culturing on a shaker at 28 - 30°C, 250 rpm; (4) Thereafter, add 1% methanol to the medium every 24 hours, end the culture after 72 hours, centrifuge the fermentation broth at 12000 rpm for 1 min, collect the supernatant, store at -20°C, and analyze the expression level and enzyme activity of the target protein; The composition of the YPD plate is as follows: yeast extract 10 g / L, peptone 20 g / L, glucose 10 g / L, agar powder 15 g / L, and the solvent is deionized water; The final concentration composition of the medium: yeast extract 10 g / L, peptone 20 g / L, glucose 10 g / L, the solvent is deionized water, and the pH value is 7.0; Finally, select 5 strains with high expression for shake flask expression;
[0130] 6) Shake flask expression of recombinant Pichia pastoris: Five strains of the above-selected highly expressing strains were used for small-scale expression experiments. (1) Pick a single colony and inoculate 3 mL of YPD medium into a test tube, and culture it at 28 - 30 °C with shaking at 250 rpm until OD600 = 2 - 6 (16 - 18 h); (2) Take 1 mL of the above bacterial solution and inoculate it into 30 mL of BMGY medium in a 250 mL Erlenmeyer flask for shake flask culture at 28 - 30 °C with shaking at 250 rpm for 24 h; (3) Centrifuge with a 50 mL sterile centrifuge tube at 1500 × g for 5 min at room temperature to collect the cells, resuspend the cells with an equal volume of BMMY medium, transfer them to a shake flask, and start induction, and continue to culture on a shaker at 28 - 30 °C with shaking at 250 rpm; (4) Thereafter, add 1% methanol to the medium every 24 hours, and end the culture after 72 hours. Centrifuge the fermentation broth at 12000 rpm for 1 min, collect the supernatant, and store it at -20 °C to analyze the expression level and enzyme activity of the target protein. The composition of the YPD plate is as follows: yeast extract 10 g / L, peptone 20 g / L, glucose 10 g / L, agar powder 15 g / L, and the solvent is deionized water; the final concentration composition of the medium: yeast extract 10 g / L, peptone 20 g / L, glucose 10 g / L, the solvent is deionized water, and the pH value is 7.0; finally, select 2 highly expressing strains among them for fermentor expression experiments;
[0131] 7) Fermentation of the expression strain in a fermenter: Two recombinant Pichia pastoris engineering strains with high expression levels were separately inoculated onto YPD plates and tested separately as follows: The recombinant Pichia pastoris engineering strains were inoculated onto YPD plates and cultured at 28 °C for 45 h; single colonies on the plates were picked and inoculated into 500 mL of YPD medium, cultured at 28 °C and 210 r / min for 24 hours. When OD600 = 3 - 5, it was ready to be inoculated into the fermenter. The seed culture solution was obtained; the BSM fermentation medium in the fermenter was sterilized, and after cooling, the pH value was adjusted to 5.4 with 20% ammonia water by mass percentage. The cultured YPD seed culture solution was inoculated into a 15 L fully automatic fermenter containing 7.5 L of BSM fermentation medium by the fire ring method, with an inoculation amount of 5 wt%, an initial stirring speed of 230 r / min, an aeration rate of 2 vvm, and a growth stage temperature of 28 °C. The dissolved oxygen (DO)-speed linkage was set: by adjusting the stirring speed and aeration rate to maintain DO at about 20 - 30%; when the glycerol in the fermenter was exhausted, an increase in the DO value could be observed, indicating that the glycerol had been exhausted; at this time, a 50% glycerol solution was started to be fed; when the cell concentration reached a certain level, the feeding was stopped; after stopping the addition of glycerol, the cells were maintained in a starved state for 45 minutes. After the glycerol was completely exhausted, methanol induction was started. The feeding induction medium was restrictively fed in a variable-speed manner according to the value of dissolved oxygen DO to induce the expression of human lysozyme; the induction stage temperature was 25 °C, and the pH value was 5.5 - 6.0. The feeding rate of methanol fed-batch culture was controlled at 2.8 - 3.4 mL / h / L of the initial fermentation medium, maintaining the dissolved oxygen DO greater than 10%. Fermentation ended 78 hours after induction; finally, one engineering strain with the highest expression level was selected and named FHX-LYC71. After 78 hours of fermentation of the FHX-LYC71 engineering strain, the lysozyme activity in the fermentation broth reached more than 56,000 units per milliliter; the yield could reach 2.8 grams of human lysozyme protein per liter of fermentation broth.
[0132] 8) The FHX-LYC71 engineering strain was preserved in a -80 °C low-temperature refrigerator.
[0133] 2. Large-scale fermentation and purification of human lysozyme
[0134] Density fermentation was scaled up in a 500 L fermenter. After the fermentation broth was centrifuged and filtered, ion exchange chromatography was carried out. The chromatography system was the SCG-300 type produced by Sepax Technologies, Inc., and the chromatography column was produced by Shanghai Huxi Analytical Instrument Factory Co., Ltd., with a diameter of Φ10×40 CM. Materials used: MMC chromatography packing (composite cationic medium), produced by Bio-Gel (Shanghai) Biotechnology Co., Ltd., with the trade name MMC Bestarose 6FF.
[0135] The specific steps are as follows:
[0136] 1. Sample pretreatment: Use centrifugation to remove solid impurities in the fermentation broth containing recombinant human lysozyme; perform solid-liquid separation of the fermentation broth using a continuous flow centrifuge, and collect the supernatant of the fermentation broth.
[0137] 2. Column equilibration: Equilibrate the chromatography column with a 30 mmol / L phosphate buffer at pH 6.2.
[0138] Equilibrate for 3 - 7 column volumes at a flow rate of 50 - 150 mL per minute, and ensure that the chromatography column is equilibrated to the baseline by ultraviolet detection.
[0139] Loading: Pass the sample with a pH value of 6.0 - 7.0 through the chromatography column pre-equilibrated with the buffer; where the sample refers to the supernatant of the yeast culture broth containing recombinant human lysozyme, and the conductivity is 15 - 20 ms / cm.
[0140] Washing: Wash the chromatography column with a 30 mmol / L phosphate buffer containing 0.05 mol / L sodium chloride at pH 6.2 for 2 - 3 column volumes to wash out all unbound impurities from the chromatography column.
[0141] Re - equilibration: Equilibrate the chromatography column with a 30 mmol / L phosphate buffer at pH 6.2 for 2 - 3 column volumes.
[0142] Elution: Elute the protein from the chromatography column with a 30 mmol / L phosphate buffer containing 1.0 mol / L sodium chloride at pH 6.2, and collect the elution peak.
[0143] The collected elution peak protein is desalted and freeze - dried to make a sterile freeze - dried powder, obtaining a pure protein sample of recombinant human lysozyme.
[0144] Make a sterile freeze - dried powder by freeze - drying method.
[0145] The purity of the recombinant human lysozyme protein isolated in this example is 99.0%, the specific activity of the protein is 120000 U / mg U / mg (determined with reference to the national standard GBT 25879 - 2010), and the recovery rate of the active protein is 80%.
[0146] Example 4
[0147] Verify that there is an obvious synergistic effect between astragalus polysaccharide and carnosine in the aging composition provided by the present invention in terms of affecting the SOD and MDA enzyme activities of HaCaT cells:
[0148] Prepare the pure astragalus polysaccharide and carnosine prepared in Example 1 in the corresponding mass ratios in Table 1 for Test Groups 1 - 6, and add water for injection to each test group to make up to 100 parts.
[0149] Table 1 Mass ratios of pure astragalus polysaccharide and carnosine in Test Groups 1 - 6
[0150]
[0151] HaCaT cells (from Sciencell, USA) are human immortalized epidermal cells, and are routinely cultured in DMEM medium with 15% fetal bovine serum. Superoxide dismutase (SOD) plays a crucial role in the oxidation and antioxidant balance of the body. SOD enzyme can scavenge superoxide anion free radicals and protect cells from damage. Malondialdehyde (MDA) is an important product of lipid peroxidation and accumulates significantly during the aging process. Currently, MDA is considered an important biomarker of aging.
[0152] The HaCaT cells were seeded at 1.2×10 5 / well in 6-well plates. After 12 hours, human primary fibroblast cells were co-incubated with t-BHP (10 μM) in 6-well cell culture plates to induce aging. 40 μg of each of Compositions 1-6 was added to the corresponding wells, and incubation was continued for 24 h. The cells were collected, and the SOD activity in skin tissues was measured by the xanthine oxidase colorimetric method, and the MDA content in skin tissues was measured by the thiobarbituric acid colorimetric method. The operations were carried out strictly according to the kit instructions (Nanjing Jiancheng Bioengineering Institute); the obtained results were standardized per milligram of tissue. The results are shown in Table 2. The results showed that the SOD activities of Test Group 1 and Test Group 2 were significantly higher than those of the single t-BHP group, indicating that Test Group 1 and Test Group 2 had strong antioxidant capabilities. The SOD activities of Test Group 3, Test Group 4, Test Group 5, and Test Group 6 also increased, but the increase was not as obvious as that of Test Group 1 and Test Group 2 when compared. The MDA amounts of Test Group 1 and Test Group 2 were significantly lower than those of the single t-BHP group, indicating that Test Group 1 and Test Group 2 had strong anti-aging capabilities. The MDA amounts of Test Group 3, Test Group 4, Test Group 5, and Test Group 6 were also lower than those of the single t-BHP group, but the reduction intensity was significantly lower than that of Test Group 1 and Test Group 2. This shows the synergistic effect of astragalus polysaccharide and carnosine.
[0153] Table 2 Synergistic effect of astragalus polysaccharide and carnosine on the effects of SOD and MDA in HaCaT cells
[0154] Group SOD (U / mg) MDA (nmol / mg) Single t-BHP 139.33±8.45 6.46±0.56 Experimental Group 1 202.55±11.76 3.71±0.23 Experimental Group 2 211.59±13.23 3.83±0.18 Experimental Group 3 154.73±12.82 5.85±0.28 Experimental Group 4 149.74±11.56 5.77±0.22 Experimental Group 5 151.74±11.73 5.58±0.31 Experimental Group 6 148.72±12.53 5.75±0.47
[0155] Example 5
[0156] To test the combined synergistic effect of the anti-aging composition provided by the present invention, the present invention conducted tests on the effects of the provided anti-aging composition 1 and incomplete compositions D1-D4 on the SOD and MDA enzyme activities of HaCaT cells:
[0157] The pure astragalus polysaccharide prepared in Example 2, the pure ganoderma polysaccharide prepared in Example 1, the recombinant human lysozyme prepared in Example 3, β-nicotinamide mononucleotide, carnosine, and glutathione were prepared into a composition according to the corresponding mass ratios. They were prepared into a composition according to the corresponding mass ratios. The specific ratios are as follows: Composition 1: By mass parts: 10 parts of ganoderma polysaccharide, 6 parts of astragalus polysaccharide, 2 parts of β-nicotinamide mononucleotide, 2 parts of recombinant human lysozyme, 1 part of carnosine, 2 parts of glutathione, and then add injection water to make up to 100 parts;
[0158] Compositions D1-D4 were all prepared according to the corresponding ratios in Table 3, and then add injection water to make up to 100 parts;
[0159] Table 3 Composition of Composition 1 and Incomplete Compositions D1-D4
[0160]
[0161] HaCaT cells (from Sciencell, USA) are human immortalized epidermal cells, and are routinely cultured in DMEM medium with 15% fetal bovine serum. Superoxide dismutase (SOD) plays a crucial role in the oxidation and antioxidant balance of the body. SOD enzyme can scavenge superoxide anion radicals and protect cells from damage. Malondialdehyde (MDA) is an important product of lipid peroxidation and accumulates significantly during the aging process. Currently, MDA is considered an important biomarker of aging.
[0162] The HaCaT cells were seeded in a 6-well plate at a density of 1.2×10 5 / well. After 12 hours, human primary fibroblast cells were co-incubated with t-BHP (10 μM) in a 6-well cell culture plate to induce aging. 40 μg of each component of Composition 1 was added to the corresponding wells, and incubation was continued for 24 h. The cells were collected and the SOD activity in the skin tissue was measured by the xanthine oxidase colorimetric method, and the MDA content in the skin tissue was measured by the thiobarbituric acid colorimetric method, and the operation was carried out strictly according to the kit instructions (Nanjing Jiancheng Bioengineering Institute); the results obtained were all standardized per milligram of tissue. The results are shown in Table 4. The results show that the SOD activity of Composition 1 was significantly increased compared with the single t-BHP group, indicating that Composition 1 has antioxidant ability. The SOD activity of the D1-D4 groups of compositions also increased, but compared with Composition 1, the increase was not obvious enough. The MDA amount of Composition 1 was significantly lower than that of the single t-BHP group, indicating that Composition 1 has strong anti-aging ability. The MDA amount of the D1-D4 groups of compositions was also lower than that of the single t-BHP group, but the reduction intensity was significantly lower than that of Composition 1 group. This shows that Composition 1 has a synergistic effect relative to the D1-D4 groups of compositions, that is, the effect of Composition 1 is not the addition of Composition D1 and Composition D2 or the addition of Composition D3 and Composition D4.
[0163] Table 4 Synergistic effect of Composition 1 on groups D1-D4 of compositions in terms of their effects on SOD and MDA in HaCaT cells
[0164] Group SOD (U / mg) MDA (nmol / mg) Single t-BHP 136.73±10.45 6.69±0.88 Composition 1 241.55±12.67 2.71±0.23 Composition D1 163.59±11.23 5.83±0.18 Composition D2 168.73±14.35 5.45±0.28 Composition D3 155.74±12.37 5.77±0.22 Composition D4 162.72±13.35 5.63±0.17
[0165] Example 6
[0166] Effect of anti-aging compositions 1-6 on the proliferation activity of primary human fibroblasts
[0167] The pure astragalus polysaccharide prepared in Example 2, the pure ganoderma polysaccharide prepared in Example 1, the recombinant human lysozyme prepared in Example 3, β-nicotinamide mononucleotide, carnosine, and glutathione were prepared into compositions according to the corresponding mass ratios in Table 5. The specific ratios are as shown in Table 5: Anti-aging composition 1: By mass, 10 parts of ganoderma polysaccharide, 6 parts of astragalus polysaccharide, 2 parts of β-nicotinamide mononucleotide, 2 parts of recombinant human lysozyme, 1 part of carnosine, 2 parts of glutathione, and then add injection water to make up to 100 parts; Anti-aging compositions 2-6 were all prepared according to the corresponding ratios in Table 5, and then add injection water to make up to 100 parts;
[0168] Table 5 Composition components of anti-aging compositions 1-6
[0169]
[0170]
[0171] The primary human fibroblast proliferation was purchased from Ausells Biotechnology (Shanghai) Co., Ltd. and was routinely cultured in RPMI 1640 medium with 15% fetal bovine serum. The CCK-8 cell viability assay was used to detect the effect of compositions 1-6 in Examples 1-6 on the proliferation activity of human fibroblasts, and epidermal growth factor (EGF 4000 IU) was used as the positive control group;
[0172] Specific method: Prepare a single cell (primary human fibroblasts (Ausells Biotechnology (Shanghai) Co., Ltd.)) suspension and inoculate it into a 96-well culture plate at a concentration of 1×10 4 cells / mL, incubate at 37 °C for 12 h, divide into 8 groups in total, with 6 parallel samples in each group. The 1st to 6th groups were respectively Composition 1-6 (10 μL per well), the 7th group was the routine culture control group, and the 8th group was the positive control group of epidermal growth factor. Add compositions 1-6 in Examples 1-6 or epidermal growth factor and continue to incubate for 24 h, then add 15 μL of CCK-8 and continue to culture for 4 h. Operate according to the CCK8 kit instructions and measure the absorbance value at a wavelength of 450 nm. Define the proliferation ability of the routine culture control group as 100%, and calculate the proliferation ability of Composition 1-6 groups and EGF group (the results are shown in Figure 1) The results showed that the anti-aging compositions 1-6 prepared in Example 6 could all enhance the proliferation ability of primary human fibroblasts.
[0173] Example 7
[0174] Effect of the anti-aging compositions 1-6 prepared in Example 6 on the proliferation activity of HaCaT cells:
[0175] HaCaT cells (from Sciencell, USA) are human immortalized epidermal cells, routinely cultured in DMEM medium with 15% fetal bovine serum. The CCK-8 cell viability assay was used to detect the effect of the anti-aging compositions 1-6 prepared in Example 6 on the proliferation activity of HaCaT cells, and epidermal growth factor (EGF 4000 IU) was used as the positive control group.
[0176] Specific method: Prepare single cells (HaCaT cells (Ausbian Biotechnology (Shanghai) Co., Ltd.)), suspension, inoculate them into a 96-well culture plate at a concentration of 1×10 4 cells / mL, incubate at 37°C for 12 h, divide into 8 groups in total, with 6 parallel samples in each group. The 1st to 6th groups were respectively the compositions 1-6 prepared in Example 6 (10 μL per well), the 7th group was the routine culture control group, and the 8th group was the positive control group of epidermal growth factor. Add the compositions 1-6 or epidermal growth factor and continue to incubate for 24 h, then add 15 μL of CCK-8 and continue to culture for 4 h. Operate according to the CCK8 kit instructions, measure the absorbance value at a wavelength of 450 nm, define the proliferation ability of the routine culture control group as 100%, and calculate the proliferation ability of the compositions 1-6 group and the EGF group (the results are shown in Figure 2 ) The results showed that the anti-aging compositions 1-6 prepared in Example 6 could all enhance the proliferation ability of human HaCaT cells.
[0177] Example 8
[0178] Effect of the anti-aging compositions 1-6 prepared in Example 6 on the expression of SASP factors in primary human fibroblasts:
[0179] Primary human fibroblasts for proliferation were purchased from Ausbian Biotechnology (Shanghai) Co., Ltd. and routinely cultured in RPMI 1640 medium with 15% fetal bovine serum. In the culture of primary human fibroblasts, a cell aging model was constructed using tert-butyl hydroperoxide (t-BHP). Detect the effect of the anti-aging compositions 1-6 prepared in Example 6 on the expression of SASP factors in primary human fibroblasts.
[0180] Specifically, primary human fibroblasts were seeded at a density of 1.2×10 5Inoculate into a 6-well plate. After 12 hours, co-incubate human primary fibroblast cells with t-BHP (10 μM) in a 6-well cell culture plate to induce senescence. Add 40 μL of each of the anti-aging compositions 1-6 prepared in Example 6 to the corresponding wells, and continue incubation for 24 h. Lyse the cells to extract total RNA. Use the corresponding primers for qPCR to detect the mRNA expression levels of SASP factors IL-1β, MMP-1, and MMP-3. The results showed that: compared with the single t-BHP group, the mRNA expression levels of SASP factors IL-1β, MMP-1, and MMP-3 in the composition 1-6 groups decreased, indicating that the anti-aging compositions 1-6 prepared in Example 6 have anti-aging ability. The specific results are shown in Figure 3 。
[0181] Example 9
[0182] Effect of the anti-aging compositions 1-6 prepared in Example 6 on the expression of SASP factors in HaCaT cells:
[0183] HaCaT cells (from Sciencell, USA) are human immortalized epidermal cells, and are routinely cultured in DMEM medium with 15% fetal bovine serum. In the culture of HaCaT cells, a cell senescence model was constructed using tert-butyl hydroperoxide (t-BHP). Detect the effect of the anti-aging compositions 1-6 prepared in Example 6 on inhibiting the expression of SASP factors in HaCaT cells.
[0184] Specifically: Seed HaCaT cells at 1.2×10 5 / well into a 6-well plate. After 12 hours, co-incubate human primary fibroblast cells with t-BHP (10 μM) in a 6-well cell culture plate to induce senescence. One group is single t-BHP, and the remaining groups are respectively added with 40 μL of each of the anti-aging compositions 1-6 prepared in Example 6 per well, and continue incubation for 24 h. Lyse the cells to extract total RNA. Use the corresponding primers for qPCR to detect the mRNA expression levels of SASP factors IL-1β, MMP-1, and MMP-3. The results showed that: compared with the single t-BHP group, the mRNA expression levels of SASP factors IL-1β, MMP-1, and MMP-3 in the anti-aging compositions 1-6 prepared in Example 6 decreased, indicating that the anti-aging compositions 1-6 prepared in Example 6 have anti-aging ability. The specific results are shown in Figure 4 。
[0185] Example 10
[0186] Effect of the anti-aging compositions 1-6 prepared in Example 6 on the activities of SOD and MDA enzymes in human primary fibroblasts:
[0187] Human primary fibroblasts for proliferation were purchased from Ausells Biotechnology (Shanghai) Co., Ltd. and routinely cultured in RPMI 1640 medium with 15% fetal bovine serum. Superoxide dismutase (SOD) plays a crucial role in the oxidation and antioxidant balance of the body. This enzyme can scavenge superoxide anion radicals and protect cells from damage. Malondialdehyde (MDA) is an important product of lipid peroxidation and accumulates significantly during the aging process. Currently, MDA is considered an important biomarker of aging.
[0188] Human primary fibroblasts were seeded at 1.2×10 5 / well in 6-well plates. After 12 hours, human primary fibroblasts were co-incubated with t-BHP (10 μM) in 6-well cell culture plates to induce aging. One group was treated with t-BHP alone, and the other groups were treated with 40 μL per well of the anti-aging compositions 1-6 prepared in Example 6 in addition to t-BHP. Incubation was continued for 24 h. Cells were collected and the SOD activity in skin tissues was measured by the xanthine oxidase colorimetric method, and the MDA content in skin tissues was measured by the thiobarbituric acid colorimetric method. The operations were carried out strictly according to the kit instructions (Nanjing Jiancheng Bioengineering Institute); the obtained results were standardized per milligram of tissue. The results are shown in Table 6. The results indicate that the SOD activity of the anti-aging compositions 1-6 prepared in Example 6 is higher than that of the single t-BHP group, indicating that the anti-aging compositions 1-6 prepared in Example 6 have antioxidant capacity. The MDA level of the anti-aging compositions 1-6 prepared in Example 6 is lower than that of the single t-BHP group, indicating that the anti-aging compositions 1-6 prepared in Example 6 have anti-aging capacity.
[0189] Table 6 Amounts of SOD and MDA in human primary fibroblasts
[0190] Group SOD (U / mg) MDA (nmol / mg) Single t-BHP 18.93±12.34 4.21±0.23 Composition 1 230.67±10.87 2.61±0.18 Composition 2 245.67±13.14 2.72±0.28 Composition 3 238.37±15.43 3.02±0.31 Composition 4 221.67±14.53 3.41±0.41 Composition 5 231.83±11.64 2.18±0.37 Composition 6 218.59±11.92 2.56±0.27
[0191] Example 11
[0192] The anti-aging compositions 1-6 prepared in Example 6 affect the SOD and MDA enzyme activities of HaCaT cells:
[0193] HaCaT cells (from Sciencell, USA) are human immortalized epidermal cells and are routinely cultured in DMEM medium with 15% fetal bovine serum. Superoxide dismutase (SOD) plays a crucial role in the oxidation and antioxidant balance of the body. This enzyme can scavenge superoxide anion radicals and protect cells from damage. Malondialdehyde (MDA) is an important product of lipid peroxidation and accumulates significantly during the aging process. Currently, MDA is considered an important biomarker of aging.
[0194] HaCaT cells were seeded at 1.2×105 Inoculate into a 6-well plate. After 12 hours, co-incubate primary human fibroblasts with t-BHP (10 μM) in a 6-well cell culture plate to induce senescence. Add 40 μL of each of the anti-aging compositions 1-6 prepared in Example 6 to the corresponding wells, and continue incubation for 24 h. Collect the cells and use the xanthine oxidase colorimetric method to measure the SOD activity in the skin tissue, and the thiobarbituric acid colorimetric method to measure the MDA content in the skin tissue. Operate strictly according to the kit instructions (Nanjing Jiancheng Bioengineering Institute); the obtained results are standardized per milligram of tissue. The results are shown in Table 7. The results show that the SOD activity of the anti-aging compositions 1-6 prepared in Example 6 is higher than that of the single t-BHP group, indicating that the anti-aging compositions 1-6 prepared in Example 6 have antioxidant ability. The MDA amount in the anti-aging compositions 1-6 group prepared in Example 6 is lower than that of the single t-BHP group, indicating that the anti-aging compositions 1-6 prepared in Example 6 have anti-aging ability.
[0195] Table 7 SOD and MDA of HaCaT cells
[0196] Group SOD (U / mg) MDA (nmol / mg) Single t-BHP 135.93±11.45 702±0.18 Composition 1 241.55±12.67 2.71±0.23 Composition 2 234.59±11.23 2.83±0.18 Composition 3 229.73±14.35 2.95±0.28 Composition 4 212.74±12.37 3.17±0.22 Composition 5 237.72±13.35 2.43±0.17 Composition 6 232.97±12.93 2.63±0.16
[0197] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments. Other embodiments can be obtained according to this embodiment without creative efforts, and these embodiments all fall within the protection scope of the present invention.
Claims
1. An anti-aging composition, characterized in that, The components are in the following parts by mass: Ganoderma lucidum polysaccharide 6 - 10 parts, Astragalus polysaccharide 6 - 10 parts, β - nicotinamide mononucleotide 1 - 2 parts, recombinant human lysozyme 2 - 4 parts, carnosine 1 - 2 parts, glutathione 1 - 2 parts; the recombinant human lysozyme is obtained by purification after expression from a nucleotide sequence shown in SEQ ID NO.
1.
2. The anti-aging composition according to claim 1, wherein The mass content of polysaccharide in the Ganoderma lucidum polysaccharide is ≥95%.
3. The anti-aging composition according to claim 1 or 2, characterized in that, The preparation method of the Ganoderma lucidum polysaccharide comprises the following steps: Immerse Ganoderma lucidum powder in an organic solvent to obtain a Ganoderma lucidum mixed solution; the organic solvent is ethanol and ether; Heat the Ganoderma lucidum mixed solution for defatting, after solid - liquid separation, collect the solid phase component to obtain defatted Ganoderma lucidum powder; Disperse the defatted Ganoderma lucidum powder in water to obtain a defatted Ganoderma lucidum powder aqueous dispersion; Boil and extract the defatted Ganoderma lucidum powder aqueous dispersion, after solid - liquid separation, collect the liquid phase component to obtain a Ganoderma lucidum extract; Concentrate the Ganoderma lucidum extract to obtain a Ganoderma lucidum concentrated solution; Mix the Ganoderma lucidum concentrated solution with an organic extractant for extraction to obtain a Ganoderma lucidum extraction aqueous phase; Mix the Ganoderma lucidum extraction aqueous phase with ethanol for alcohol precipitation, collect the ethanol precipitate to obtain a crude Ganoderma lucidum polysaccharide; Dissolve the crude Ganoderma lucidum polysaccharide in water, perform column chromatography purification to obtain an eluate containing Ganoderma lucidum polysaccharide; the eluate for column chromatography purification is an aqueous sodium chloride solution; Dialyze the eluate containing Ganoderma lucidum polysaccharide, collect the dialysate and dry it to obtain a pure product of Ganoderma lucidum polysaccharide.
4. The anti-aging composition according to claim 1, wherein The mass content of polysaccharide in the Astragalus polysaccharide is ≥96%.
5. The anti-aging composition according to claim 1 or 4, characterized in that, The preparation method of the Astragalus polysaccharide comprises the following steps: Immerse Astragalus powder in an organic solvent to obtain an Astragalus mixed solution; the organic solvent is ethanol and ether; Heat the Astragalus mixed solution for defatting, after solid - liquid separation, collect the solid phase component to obtain defatted Astragalus powder; Disperse the defatted Astragalus powder in an alkaline aqueous solution to obtain a defatted Astragalus powder dispersion; the pH value of the alkaline aqueous solution is ≥9; Boil and extract the defatted Astragalus powder dispersion, after solid - liquid separation, collect the liquid phase component to obtain an Astragalus extract; Adjust the pH value of the Astragalus extract to 6 - 7 and then concentrate it to obtain an Astragalus concentrated solution; Mix the Astragalus concentrated solution with an organic extractant for extraction to obtain an Astragalus extraction aqueous phase; Mix the Astragalus extraction aqueous phase with ethanol for alcohol precipitation, collect the ethanol precipitate to obtain a crude Astragalus polysaccharide; Dissolve the crude Astragalus polysaccharide in water, perform column chromatography purification to obtain an eluate containing Astragalus polysaccharide; the eluate for column chromatography purification is an aqueous sodium chloride solution; Dialyze the eluate containing Astragalus polysaccharide, collect the dialysate and dry it to obtain a pure product of Astragalus polysaccharide.
6. The anti-aging composition according to claim 1, characterized in that, The purity of the recombinant human lysozyme is ≥99%; the specific activity of the recombinant human lysozyme is ≥120000 U / mg.
7. Use of the anti - aging composition according to any one of claims 1 - 6 in anti - aging cosmetics.
8. The application according to claim 7, wherein The mass percentage content of the anti - aging composition in anti - aging cosmetics is 5 - 30%.
9. The application according to claim 8, wherein The anti - aging cosmetics include one or more of skin care lotion, skin care milk, cream, essence, facial cleanser, facial mask, lipstick and eyeshadow.
Citation Information
Patent Citations
Anti-ageing traditional Chinese medicine composition fermentation primary pulp as well as preparation and application
CN109316417A
Anti-aging essence containing nicotinamide mononucleotide (NMN) and preparation method of anti-aging essence
CN111184677A
Recombinant pichia pastoris engineering bacterium integrated with high-copy human lysozyme gene and construction method thereof
CN113637598A
Facial antibacterial care solution containing recombinant human lysozyme
CN114159337A