Use of MiR-410-3p in preparing drugs for preventing or treating liver damage

Abstract

The present invention belongs to the field of biotechnology, and specifically relates to a use of MiR‑410‑3p in the preparation of a drug for preventing or treating liver damage. In view of the problem that existing studies have only found that stem cell-derived exosomes have a positive effect in repairing liver damage, but the amplification time is long and not suitable for industrialization, the present invention provides a use of MiR‑410‑3p in the preparation of a drug for preventing or treating liver damage. The present invention discovered for the first time the repair effect of exosomes derived from human umbilical cord blood plasma on liver damage, and further discovered that MiR‑410‑3p therein plays a key role in repairing liver damage, thereby providing a new drug for liver damage repair. The human umbilical cord blood plasma sampling of the present invention is simple and safe, and can also be extracted industrially, is easy to use, and has good application value.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a use of MiR-410-3p in preparing a drug for preventing or treating liver damage. Background Art

[0002] The liver is one of the five major organs of the human body and plays a key role in human metabolism. Various hepatotoxic factors such as viral infection, drug poisoning, lipid deposition and autoimmune reaction can lead to acute or chronic liver injury. The clinical feature of acute liver injury (ALI) is the rapid loss of hepatocyte function in patients without liver disease, which is evaluated by the activity of hepatobiliary enzymes such as serum alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), and γ-glutamyl transpeptidase (GGT). After severe acute liver injury, liver regeneration fails and liver failure occurs. The treatment is difficult and the recovery rate is extremely low. Continuous liver damage can lead to excessive accumulation of extracellular matrix, resulting in the gradual replacement of liver parenchyma by scar tissue, thus losing normal structure and progressing to liver fibrosis. If not intervened, the condition can deteriorate rapidly and normal liver function will be lost. At present, studies have shown that exogenous hepatocyte transplantation may be a promising new method for the treatment of liver injury, but the difficulty in obtaining primary hepatocytes, the difficulty in in vitro amplification and storage, and the immune rejection reaction after cell transplantation restrict the clinical translation and application of hepatocyte transplantation. Therefore, how to use drugs to treat acute / chronic liver damage and prevent it from further progressing to liver failure is an urgent problem to be solved in the industry.

[0003] Exosomes are a subgroup of extracellular vesicles (EVs). They are tiny membrane vesicles secreted by cells. They originate from endosomes, have a lipid bilayer membrane structure, and are approximately 30-150nm in diameter. Exosomes are widely present in various body fluids such as blood, saliva, urine, and cerebrospinal fluid. They play a key role in intercellular communication by delivering miRNAs, mRNAs, and proteins to recipient cells. Recent studies have found that the use of stem cell-derived exosomes to treat damaged livers exhibits properties similar to cell transplantation therapy that can promote the regeneration and repair of damaged liver cells. Compared with cell transplantation therapy, exosome therapy has significant advantages such as better safety, modification, and long-term preservation, and has shown good prospects for translation and clinical application in the treatment of severe liver diseases.

[0004] Studies in recent years have shown that exosomes from different cell sources have good therapeutic effects on liver diseases. Among them, there are many studies on the treatment of liver injury by exosomes derived from mesenchymal stem cells (MSC-Exos). For example, a study reported that MSC-Exos derived from human umbilical cord reduced inflammation and collagen deposition in the liver of CCl4-induced liver fibrosis mice, thereby alleviating the progression of liver fibrosis. Human adipose-derived MSC-Exos improve liver fibrosis by inhibiting the PI3K / Akt / mTOR pathway and remodeling choline metabolism. Some studies have also reported that bone marrow-derived MSC-Exos can significantly reduce the expression levels of fibrosis markers Col1α1, Col3α1, TGF-β1, and p-Smad2 after treatment, thereby inhibiting the progression of liver fibrosis. Human chorionic villus-derived MSC-Exos can inhibit the abnormal activation of Hh signaling by delivering MiRNA-125b, thereby inhibiting the progression of liver fibrosis. Human menstrual blood-derived MSC-Exos can significantly downregulate the expression levels of Col1α1, Vimentin, and α-SMA in liver tissue, significantly alleviating chronic liver damage in mice. In a toxicant-induced liver injury model, In the study, bone marrow-derived MSC-Exos mainly protected the damaged liver by activating the proliferation and regeneration of hepatocytes; neonatal umbilical cord-derived MSC-Exos were rich in glutathione peroxidase 1 (GPX1), which could reduce H2O2-induced oxidative stress and CCl4-induced apoptosis, thereby preventing liver oxidative damage; mesenchymal hepatocyte-derived MSC-Exos in human menstrual blood prevented D-Gal / LPS-induced acute liver injury in mice by reducing the number of hepatic monocytes and activating Caspase-3-positive cells; in addition, bone marrow-derived MSC-Exos could enhance the stability of SLC7A11 protein through OTUB1-mediated deubiquitination, thereby preventing CCl4-induced hepatocyte death. The above research results indicate that exosomes derived from mesenchymal stem cells can treat acute / chronic liver injury through the MiRNAs or proteins carried by the exosomes, and have good prospects for clinical transformation.

[0005] Although exosomes derived from the above-mentioned stem cells, fat, bone marrow, etc. have been reported to play a repair role in liver damage, the long expansion time of the above-mentioned cells limits their clinical application.

[0006] Umbilical cord blood contains rich stem cell resources such as hematopoietic stem cells, mesenchymal stem cells, endothelial progenitor cells, etc., which are mainly used for hematopoietic stem cell transplantation treatment of blood system diseases, nervous system diseases, metabolic diseases, etc.

[0007] There are reports showing that cord blood plasma exosomes (CBP-Exos) can play a role in bone differentiation and tissue repair, promote skin wound healing, and improve bone loss and promote osteoblast differentiation in elderly osteoporotic mice. However, there are no reports on the repair effect of cord blood plasma exosomes on liver damage. Summary of the invention

[0008] The technical problem to be solved by the present invention is: existing studies have only found that exosomes derived from stem cells have a positive effect in the repair of liver damage, but the exosomes derived from these cells have a long cell proliferation time and are not suitable for industrial application in the repair of liver damage.

[0009] The technical solution of the present invention to solve the above technical problem is: to provide a use of MiR-410-3p in preparing a drug for preventing or treating liver injury.

[0010] Among them, in the above-mentioned use, the MiR-410-3p is MiR-410-3p in exosomes derived from plasma.

[0011] Furthermore, in the above-mentioned use, the plasma source refers to human umbilical cord blood plasma.

[0012] Wherein, in the above-mentioned use, the nucleotide sequence of MiR-410-3p is shown as SEQ ID NO:1.

[0013] SEQ ID NO: 1 Nucleotide sequence of MiR-410-3p in human umbilical cord blood plasma exosomes

[0014] 5'aatataatatagatggcctgt 3'.

[0015] Wherein, in the above-mentioned use, the liver injury refers to acute liver injury or chronic liver fibrosis.

[0016] Among them, in the above-mentioned use, the dosage of MiR-410-3p is 0.2nmol / g body weight of mouse.

[0017] The present invention also provides a medicine for preventing or treating liver damage, comprising MiR-410-3p.

[0018] Furthermore, in the above-mentioned drug for preventing or treating liver injury, the MiR-410-3p is MiR-410-3p in human umbilical cord blood plasma exosomes.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The present invention first discovered the repair effect of exosomes derived from human umbilical cord blood plasma on liver damage, and further separated and identified the protective effect of CBP-Exos and OBP-Exos on H2O2-induced liver cell damage and the efficacy on CCl4-induced mouse liver damage, and by comparing the differentially expressed MiRNAs between CBP-Exos and OBP-Exos, it was found that MiR-410-3p carried by CBP-Exos can inhibit liver damage and hepatocyte apoptosis caused by oxidative stress by activating the mitochondria-mediated anti-apoptotic signaling pathway Bim-Bcl2-CytoC, and has important application prospects in the treatment of liver damage. Therefore, the present invention provides a use of MiR-410-3p in the preparation of a drug for preventing or treating liver damage, and also provides a drug for preventing or treating liver damage containing MiR-410-3p, which provides a new way for the repair of acute and chronic liver damage, and the MiR-410-3p of the present invention comes from human umbilical cord blood plasma, and the sampling is simple and safe, and it can also be extracted industrially, which is convenient to use and easy to store, and has a good application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Shown is the isolation and identification of cord blood plasma exosomes (CBP-Exos); wherein, A. the preparation steps of CBP-Exos; B. Western Blot identification and nanoparticle size analysis of CBP-Exos; C. morphological identification of CBP-Exos.

[0022] Figure 2 The figure shows that CBP-Exos improves the structure and function of the liver of mice with acute liver injury (ALI). A. Detection of serum biochemical indicators ALT and AST content in mice in the Control group (n=3), CCl4 group (n=4), and CCl4+CBP-Exos group (n=4) on the 1st, 2nd, 3rd, and 5th day after modeling; from left to right: the results of the Control group, CCl4 group, and CCl4+CBP-Exos group; B. H&E staining of liver tissues of mice in each group on the 1st, 2nd, 3rd, and 5th day after modeling.

[0023] Figure 3 The figure shows that CBP-Exos improves the apoptosis and oxidative stress levels in the liver of ALI mice. A is the expression of cleaved-caspase3 in the liver tissue of each group of mice detected by immunohistochemical staining; B is the expression level of lipid peroxide MDA in the liver tissue of each group of mice detected by MDA, n=5.

[0024] Figure 4The results show that CBP-Exos inhibited apoptosis and oxidative stress in primary mouse hepatocytes. A shows the ROS levels in the control group, H2O2 group, CBP-Exos group and OBP-Exos group detected by fluorescence microscopy, n=3; B shows the apoptosis levels in the control group, H2O2 group, CBP-Exos group and OBP-Exos group detected by Tunel staining, n=3.

[0025] Figure 5 The figure shows the differential enrichment analysis and RT-qPCR identification of MiRNAs in CBP-Exos and OBP-Exos. A is the volcano plot analysis of differential MiRNAs in CBP-Exos and OBP-Exos, n=3; B is the MiRNA-mRNA regulatory network analysis of differential MiRNAs and their target gene mRNAs in CBP-Exos and OBP-Exos in the apoptosis signaling pathway of liver injury, n=3; C is the heat map analysis of the top ten highly enriched differential MiRNAs in CBP-Exos, n=3; D is the expression of differentially expressed MiRNAs (MiR-24-3p, MiR-150-5p, MiR-181a-5p, MiR-191-5p, MiR-486-5p, MiR-410-3p) in CBP-Exos and OBP-Exos verified by RT-qPCR, n=3.

[0026] Figure 6 Shown is the functional screening of differentially expressed miRNAs in inhibiting oxidative stress and apoptosis in mouse hepatocytes.

[0027] Among them, A is the changes in ROS levels in AML12 hepatocytes induced by H2O2 and transfected with MiR-24-3p mimic, MiR-150-5p mimic, MiR-181a-5p mimic, MiR-191-5p mimic, MiR-486-5p mimic and MiR-410-3pmimic, respectively, by fluorescence microscopy, n=3; B is the flow cytometry analysis of apoptosis in AML12 hepatocytes induced by H2O2 and transfected with MiR-24-3p mimic, MiR-150-5p mimic, MiR-181a-5p mimic, MiR-191-5p mimic, MiR-486-5p mimic and MiR-410-3pmimic, respectively, n=3.

[0028] Figure 7The figure shows the identification of MiRNAs that play a liver-protective role in CBP-Exos. A is the detection of ROS levels in AML12 hepatocytes induced by H2O2 treated with CBP-Exos and transfected with MiR-150-5p inhibitor, MiR-486-5p inhibitor and MiR-410-3p inhibitor, n=3; B is the detection of apoptosis levels in AML12 hepatocytes induced by H2O2 treated with CBP-Exos and transfected with MiR-150-5p inhibitor, MiR-486-5p inhibitor and MiR-410-3p inhibitor.

[0029] Figure 8 The figure shows the efficacy evaluation of MiR-410-3p in treating ALI mice. A shows the detection of ALT and AST levels in the serum of mice in the control group (n=3), CCl4 group (n=3), CCl4+CBP-Exos group (n=3), CCl4+NC agomir group (n=5), and CCl4+MiR-410-3p agomir group (n=5); B shows HE staining of liver tissue of mice in the control group, CCl4 group, CCl4+CBP-Exos group, CCl4+NC agomir group, and CCl4+MiR-410-3p agomir group; C shows immunohistochemical F4 / 80 staining of liver tissue of mice in the control group, CCl4 group, CCl4+CBP-Exos group, CCl4+NC agomir group, and CCl4+MiR-410-3p agomir group. DETAILED DESCRIPTION

[0030] This invention discovered for the first time that exosomes derived from human umbilical cord blood plasma play a positive role in the repair of liver damage. At present, most studies focus on the use of MSC-Exos derived from mesenchymal stem cells to conduct liver damage treatment research. In addition, some studies have also used exosomes derived from human liver stem cells, hepatocytes, and amniotic epithelial cells for treatment research.

[0031] Umbilical cord blood, as the youngest blood, contains rich stem cell resources such as hematopoietic stem cells, mesenchymal stem cells, and endothelial progenitor cells, and is widely used to treat various diseases. However, few studies have explored the role of exosomes derived from cord blood plasma in disease treatment. Our research results enrich the clinical application potential of cord blood plasma exosomes, suggesting that they can be used to treat liver diseases, and provide a new direction for the full utilization of UCB bank resources. At present, the industrially simple and easy-to-operate exosome extraction method is being improved with each passing day. In the future, when the technology is improved, plasma can be collected during the hematopoietic stem preparation process for industrial extraction of exosomes. CBP-Exos can be prepared into freeze-dried powder through freezing technology, which can be stored for a long time and used when needed, with potential clinical transformation value.

[0032] The specific implementation modes of the present invention will be further explained below through examples, but it is not intended to limit the protection scope of the present invention to the scope described in the examples.

[0033] The instruments and reagents used in the examples are all common commercially available products. The human umbilical cord blood samples used in this application were obtained from healthy maternal donors (maternal age: 22-35 years old) from Sichuan Provincial Maternal and Child Health Hospital with the consent of the donors. The exosomes derived from the plasma of the elderly were obtained from normal blood donated by healthy volunteers aged 65-85 years. The experiment has been approved by the Medical Ethics Committee of West China Hospital, Sichuan University.

[0034] Example 1 Isolation and identification of human umbilical cord blood plasma CBP-Exos

[0035] (1) Isolation of CBP-Exos. The steps are as follows:

[0036] Use an anticoagulant blood collection bag to collect human umbilical cord blood samples (50-60 ml / portion), and use citrate phosphate dextrose as the anticoagulant; transfer the umbilical cord blood sample to a 50 ml centrifuge tube, 25 ml / tube, centrifuge at 4°C, 1000g for 20 min to collect plasma, and discard the precipitate; then, centrifuge at 4°C, 3000g for 10 min, collect plasma, and discard the precipitate; centrifuge at 4°C, 12000g for 30 min in a refrigerated centrifuge, collect plasma, and discard the precipitate; dilute the plasma 6 times, centrifuge at 4°C, 120000g overnight in an ultra-high speed centrifuge, resuspend with 30 ml PBS, and filter with a 0.22 μm filter; centrifuge at 4°C, 100000g for 2 h in an ultra-high speed centrifuge, resuspend with 100 μl PBS, and store at -80°C or use in downstream experiments. (Store at 4°C for short-term storage and -80°C for long-term storage. Avoid repeated freezing and thawing). Figure 1 As shown in A.

[0037] (2) Western Blot Identification and Nanoparticle Size Analysis of CBP-Exos

[0038] like Figure 1 As shown in B, we used immunoblotting to detect the expression of CBP-Exos high-expression exosome marker proteins Alix and CD63. In addition, nanoparticle size analysis using ZetaView observed that CBP-Exos were between 30-150nm.

[0039] (3) Morphological identification of CBP-Exos

[0040] like Figure 1 As shown in Figure 3, we used transmission electron microscopy (TEM) to observe that CBP-Exos exhibited a typical cup-shaped structure of exosomes.

[0041] The results of Example 1 show that we have isolated exosomes derived from human umbilical cord blood plasma, namely CBP-Exos.

[0042] Example 2 CBP-Exos treatment of CCl4-induced acute liver injury (ALI) mice

[0043] The specific steps are as follows:

[0044] (1) Acute liver injury (ALI) mouse model

[0045] CCl4 and olive oil were prepared into working solution in a volume ratio of 1:5 and prepared before use; male mice aged 8-10 weeks and weighing 20-25g were selected and randomly divided into groups. The model group was intraperitoneally injected with 3μL / g CCl4 working solution once a day. When the blood biochemical indicators increased rapidly and liver tissue necrosis occurred, it indicated that the modeling was successful; the blank control group was intraperitoneally injected with an equal volume of olive oil; the treatment group was given tail vein CBP-Exos infusion at the same time as CCl4 modeling and 1 day after modeling, with a therapeutic dose of 10μg / g body weight.

[0046] (2) Determination of serum biochemical indicators ALT and AST levels in each group of mice on the 1st, 2nd, 3rd, and 5th day after modeling

[0047] On the 1st, 2nd, 3rd and 5th day after injection of CCl4 working solution, mouse blood was collected by eyeball bleeding in 1.5 ml EP tubes, placed at 4°C overnight, centrifuged at 3000 rpm at 4°C for 15 min, and the upper serum was taken for the detection of alanine aminotransferase ALT and aspartate aminotransferase AST. ALT and AST were carried out in the GLP workshop of the National Center for Safety Evaluation of New Drugs (Chengdu Huaxi Haiqi Pharmaceutical Technology Co., Ltd.).

[0048] The experimental results of ALT and AST are as follows Figure 2 A. ALT and AST are the main indicators of liver damage. When both are elevated, it indicates liver damage; the higher the values, the more serious the damage. Figure 2The results of A showed that the ALT and AST levels in the serum of mice infused with CBP-Exos were significantly higher than those in the control group on the second day of modeling. This shows that the liver injury model has been successfully established in mice infused with CBP-Exos since the second day.

[0049] (3) H&E staining of liver tissues of mice in each group on day 1, day 2, day 3, and day 5 after modeling

[0050] On the 1st, 2nd, 3rd, and 5th day after injection of CCl4 working solution, mice were killed and liver tissues were collected. After washing with PBS, liver tissues were fixed with 4% paraformaldehyde. After fixation for 48 h, liver tissues were embedded in paraffin. Liver tissue sections and H&E staining (such as Figure 2 B).

[0051] H&E staining results showed that the liver of normal mice was cord-like. The liver structure began to become disordered 1 day after CCl4 modeling, with a small number of bleeding spots. The liver tissue structure after CBP-Exos treatment remained basically normal, and no bleeding spots were observed. The liver necrosis area increased significantly 2 days after modeling, the bleeding spots increased, and a large number of inflammatory cells infiltrated. The liver necrosis area was significantly reduced after CBP-Exos treatment, and the inflammatory infiltration decreased. The liver structure was restored 3 days after modeling, but there were still a large number of necrotic areas. The liver tissue structure after CBP-Exos treatment was restored to a cord-like shape, and a small number of necrotic areas were observed. The liver tissue structure was almost completely restored to normal 5 days after modeling, with a small amount of inflammatory cell infiltration in the liver tissue. The liver tissue structure was completely restored after CBP-Exos treatment, and no inflammatory cell infiltration was observed in the liver tissue. The above results collectively indicate that CBP-Exos treatment can significantly reduce the area of ​​liver necrosis, inflammatory cell infiltration and bleeding spots in ALI mice, and restore the cord-like structure of liver tissue.

[0052] Example 3 CBP-Exos improve apoptosis and oxidative stress levels in the liver of ALI mice

[0053] The specific steps are as follows:

[0054] (1) Immunohistochemical staining to detect the expression of cleaved-caspase3 in the liver tissue of each group of mice

[0055] On the first, second and third day after the injection of CCl4 working solution, mice were killed and liver tissues were collected. After washing with PBS, liver tissues were fixed with 4% paraformaldehyde. After fixation for 48 hours, liver tissues were embedded in paraffin. Liver tissue sections and immunohistochemical staining of cleaved-caspase3 were performed ( Figure 3 A).

[0056] The results of immunohistochemical staining of cleaved-caspase3 showed that we performed immunohistochemical staining of cleaved-caspase3, a cell apoptosis marker, on paraffin sections of mouse livers. Since the liver tissue structure of mice basically returned to normal on the fifth day after modeling, we only selected the time points of 1d, 2d, and 3d after modeling for IHC staining. The results showed that 1d after modeling, both the modeling group and the treatment group showed a small number of cleaved-caspase3-positive cells; 2d after modeling, a large number of cleaved-caspase3-positive cell areas appeared in the CCl4 group, while the positive area of ​​the CBP-Exos treatment group was significantly reduced; 3d after modeling, the positive cell area of ​​the CCl4 group was reduced compared with 2d, while the CBP-Exos treatment group almost did not observe the cleaved-caspase3-positive cell area.

[0057] The above experimental results collectively indicate that CBP-Exos treatment can significantly reduce the level of liver tissue apoptosis.

[0058] (2) Detection of the expression level of lipid peroxide MDA in the liver tissue of each group of mice

[0059] On the second day after modeling, mice were sacrificed and liver tissues were collected. The tissues were washed with PBS and crushed in liquid nitrogen. 20 mg of liver tissue powder was collected, and an appropriate amount of protein lysis solution was added. After mixing, the mixture was further lysed using an ultrasonic crusher and ultrasonicated at 4°C for 5 minutes. After ultrasonication, centrifuged at 4°C and 12,000 rpm for 15 minutes, and the supernatant was collected and purified by Amplite TM The fluorescent malondialdehyde (MDA) quantitative kit was used to detect the level of MDA in liver tissue. Figure 3 As shown in B.

[0060] Combined with the previous efficacy evaluation results, we found that in the efficacy evaluation at different sampling points (1d, 2d, 3d, 5d), 2d after modeling was the time point when liver damage was most severe, and its typical symptoms were significantly restored after CBP-Exos treatment. Therefore, in subsequent experiments, we used 2d after modeling as the sampling point for research. Since the level of free ROS in the liver changes sharply after ex vivo, it is not conducive to detection. Therefore, we used the determination of lipid peroxide malondialdehyde MDA to reflect the level of oxidative stress in liver tissue. Malondialdehyde (MDA) is one of the natural byproducts of lipid peroxidation. The quantification of MDA can evaluate the level of oxidative stress in pathological and physiological processes and is a reliable biomarker reflecting the level of oxidative stress. The MDA test results showed that compared with the control group (76.1μmol / g), the MDA level in liver tissue of the CCl4 group was significantly increased (121.3μmol / g), and CBP-Exos treatment significantly reduced the accumulation level of MDA in liver tissue (50.7μmol / g) (P<0.001). The above studies show that CBP-Exos treatment can reduce the level of apoptosis and oxidative stress in liver tissue, and has the function of protecting the liver against oxidative damage.

[0061] Example 4 Effects of CBP-Exos and exosomes derived from elderly plasma (OBP-Exos) on hydrogen peroxide (H2O2)-induced oxidative stress in primary mouse hepatocytes

[0062] Since the oxidative stress signal induced by drugs (such as CCl4) is the main factor leading to acute liver injury and liver toxicity, we simulated the CCl4-induced liver injury model in vivo by inducing oxidative stress in hepatocytes by H2O2 to clarify the protective effect of CBP-Exos on oxidatively damaged hepatocytes in vitro.

[0063] (1) Fluorescence microscopy was used to detect the ROS levels in primary hepatocytes of the control group, H2O2 group, CBP-Exos group, and elderly OBP-Exos group

[0064] We isolated primary hepatocytes (PHs) from mice by in situ perfusion. The isolated primary hepatocytes were inoculated into wells coated with rat tail collagen in advance. After 3 hours, the primary hepatocytes adhered to the wall. CBP-Exos and OBP-Exos were added to co-incubate with the primary hepatocytes respectively. After 16 hours of co-incubation, 200nM H2O2 was used to induce oxidative stress in the primary hepatocytes. After 5 hours of induction, DCFH-DA was used to detect the intracellular ROS level. DCFH-DA, 2,7-dichlorofluorescein diacetate, also known as reactive oxygen species ROS fluorescent probe (2.7-dichlorofluorescein dihydrodiacetate, is a cell-permeable fluorescent probe used to detect reactive oxygen species (ROS) and nitric oxide (·NO) and determine the overall degree of oxidative stress.

[0065] Fluorescence microscopy results Figure 4 As shown in A, the results showed that the level of ROS in primary mouse hepatocytes induced by H2O2 increased significantly (P<0.01), while the level of ROS decreased significantly after the addition of CBP-Exos treatment (P<0.05). In addition, considering the subsequent mechanism study, we used exosomes OBP-Exos derived from the plasma of the elderly as a control to explore the effect of OBP-Exos on oxidative stress in hepatocytes. The results showed that the OBP-Exos treatment group was consistent with the H2O2 group, and the intracellular ROS level was significantly increased compared with the Control group (P<0.01), indicating that OBP-Exos could not reduce the level of ROS in primary hepatocytes induced by H2O2. It shows that CBP-Exos can inhibit the level of oxidative stress in hepatocytes induced by H2O2.

[0066] (2) Tunel staining to detect apoptosis levels of primary hepatocytes in the control group, H2O2 group, CBP-Exos group, and OBP-Exos group

[0067] After mouse primary hepatocytes adhered to the wall, CBP-Exos and OBP-Exos were added and co-incubated with the primary hepatocytes; after 16 hours of co-incubation, 200nM H2O2 was used to induce oxidative stress in mouse primary hepatocytes; 5 hours after induction, Tunel staining was used to detect cell apoptosis.

[0068] The steps of Tunel staining are as follows:

[0069] 1) For the adherent cell slides to be tested, wash once with PBS, then fix the cells with 4% paraformaldehyde for 30 min, and wash three times with PBS, 3 min each time;

[0070] 2) Permeabilize the cells with PBS containing 0.3% Triton X-100, incubate at room temperature for 10 min, and wash with PBS three times, 3 min each time;

[0071] 3) Prepare Tunel test solution: as shown in Table 1.

[0072] Table 1 Reaction system composition

[0073] Reagents 1 sample TdT enzyme 5μL Fluorescent labeling solution 45μL Tunel test solution 50μL

[0074] 4) Take out the cell slide, place it on a glass slide with the front side facing up, add 50 μL of Tunel detection solution, and incubate in a wet box at 37°C in the dark for 60 minutes;

[0075] 5) Place the cell slides back into the well plate and wash with PBS three times, 3 min each time; use DAPI to stain the cell nuclei, incubate at room temperature in the dark for 15 min, and wash with PBS three times, 3 min each time;

[0076] 6) Use a clean and marked slide, add a drop of anti-fluorescence quenching sealing agent, carefully remove the slide, absorb excess water, and place the cells face down on the slide with the anti-fluorescence quenching sealing agent, allowing the sealing agent to spread naturally to avoid bubbles;

[0077] 7) After standing for 5 minutes, collect images. If it is not possible to take pictures in time, store them at -20℃. It is still necessary to collect images as soon as possible to avoid loss of fluorescence signals.

[0078] We conducted a Tunel staining experiment. The principle is that genomic DNA will break during cell apoptosis, and the exposed 3'-OH can be added with fluorescein (FITC)-labeled dUTP under the catalysis of terminal deoxynucleotidyl transferase. The higher the degree of cell apoptosis, the stronger the fluorescence intensity and the more positive cells there are, so the level of cell apoptosis can be detected by fluorescence microscopy. The results of Tunel staining are shown in Figure 1. Figure 4 As shown in B, the results showed that the number of Tunel-positive cells increased significantly after H2O2 induction, while the number of Tunel-positive cells decreased significantly after CBP-Exos treatment, and the OBP-Exos treatment group was consistent with the H2O2 group. These results show that in vitro CBP-Exos treatment can significantly reduce hepatocyte apoptosis in the H2O2-induced oxidative damage model, while OBP-Exos has no effect.

[0079] Example 5 Differential enrichment analysis and RT-qPCR identification of miRNAs in CBP-Exos and exosomes derived from elderly plasma (OBP-Exos)

[0080] The specific steps are as follows:

[0081] (1) Volcano plot analysis of differentially expressed miRNAs in CBP-Exos and OBP-Exos

[0082] It can be seen from Examples 3 and 4 that CBP-Exos has a hepatoprotective effect on mice with acute liver injury. In order to further clarify the key molecules in the contents of CBP-Exos that play a hepatoprotective role, we conducted the following experiments.

[0083] We extracted exosomes from umbilical cord blood plasma and plasma from elderly people in the control group, and used MiRNAs high-throughput sequencing technology to analyze the differentially expressed MiRNAs in CBP-Exos and OBP-Exos. Since the volcano plot can conveniently and intuitively display the distribution of differentially expressed MiRNAs between two samples, we performed a volcano plot analysis on the differentially expressed MiRNAs between CBP-Exos and OBP-Exos. MiRNAs with a difference of more than 2 times and a p value of less than 0.05 were considered statistically different.

[0084] The experimental results are as follows Figure 5 As shown in A, the results show that there are 34 differentially expressed MiRNAs, of which 16 MiRNAs are significantly upregulated in CBP-Exos, and 18 MiRNAs are significantly downregulated in CBP-Exos. We further screened the 18 MiRNAs that were significantly upregulated in CBP-Exos: ① Select the differential MiRNAs homologous to humans and mice; ② Select the data point in the upper right corner of the volcano plot (since the gene t-test with a larger difference is more significant, the data points in the upper left and upper right corners are often more biologically meaningful), and the final screened MiRNA is MiR-410-3p. )

[0085] (2) Analysis of the miRNA-mRNA regulatory network of differentially expressed miRNAs and their target gene mRNAs in CBP-Exos and OBP-Exos in the apoptosis signaling pathway of liver injury

[0086] Since CBP-Exos were found to have a liver-protective effect in previous phenotypic studies, we next performed a MiRNA-mRNA regulatory network analysis related to the liver injury apoptosis pathway on the differentially expressed MiRNAs and their target gene mRNAs.

[0087] The results of regulatory network analysis are as follows Figure 5 As shown in Figure B, it can be seen that MiR-24-3p (difference more than 2 times) may also be involved in oxidative stress and cell apoptosis signaling pathways.

[0088] (3) Heat map analysis of the top ten differentially expressed miRNAs in CBP-Exos

[0089] In order to screen out functional MiRNAs with high enrichment in CBP-Exos and possible liver-protective effects, we further analyzed the top ten differential MiRNAs with high enrichment in CBP-Exos and drew a heat map for screening.

[0090] The results are as follows Figure 5 As shown in C, we finally screened out four MiRNAs that may be involved in liver injury pathways and are homologous to mice, namely MiR-181a-5p, MiR-150-5p, MiR-191-5p and MiR-486-5p.

[0091] (4) RT-qPCR verification of the expression levels of differentially expressed MiRNAs (MiR-24-3p, MiR-150-5p, MiR-181a-5p, MiR-191-5p, MiR-486-5p, MiR-410-3p) in CBP-Exos and OBP-Exos

[0092] According to the above differential analysis results, we screened out a total of 6 differentially expressed MiRNAs (MiR-24-3p, MiR-150-5p, MiR-181a-5p, MiR-191-5p, MiR-486-5p, MiR-410-3p) that may play a liver-protective role. To further verify the expression levels of these differentially expressed MiRNAs in CBP-Exos and OBP-Exos, we extracted exosomal RNA and performed RT-qPCR verification of MiRNAs. The results are shown in Figure 5 As shown in D, the expression levels of these six differentially expressed MiRNAs in CBP-Exos were significantly higher than those in OBP-Exos.

[0093] Example 6 Functional screening of differentially expressed MiRNAs to inhibit oxidative stress and apoptosis in mouse hepatocytes

[0094] (1) ROS level detection

[0095] In order to clarify the functions of the six differentially expressed MiRNAs screened out, we used MiRNAmimics for identification. MiRNA mimics are mimics of MiRNAs. They are double-stranded small RNAs designed and synthesized for the mature structure of endogenous MiRNAs. They can form single-stranded MiRNAs under the action of DICER enzymes, thereby increasing MiRNA abundance for functional gain studies. We synthesized the mimics of these six MiRNAs. The sequences are based on the following sequences, with "u" replacing "t". The sequences are as follows:

[0096] SEQ ID NO:2, SEQ ID NO:3

[0097] MiR-24-3p:3'gacaaggacgacttgactcggt 5';3'accgagtcaagtcgtccttgtc 5'。

[0098] SEQ ID NO:4、SEQ ID NO:5

[0099] MiR-150-5p:3'gtgaccatgttcccaaccctct 5';3'agagggttgggaacatggtcac 5'。

[0100] SEQ ID NO:6、SEQ ID NO:7

[0101] MiR-181a-5p:3'tgagtggctgtcgcaacttacaa 5';3'ttgtaagttgcgacagccactca5'。

[0102] SEQ ID NO:8、SEQ ID NO:9

[0103] MiR-191-5p:3'gtcgacgaaaaccctaaggcaac 5';3'gttgccttagggttttcgtcgac 5'。

[0104] SEQ ID NO:10、SEQ ID NO:11

[0105] MiR-486-5p:3'gagccccgtcgagtcatgtcct 5';3'aggacatgactcgacggggctc 5'。

[0106] SEQ ID NO:12、SEQ ID NO:13

[0107] MiR-410-3p:3'tgtccggtagacacaatataa5';3'ttatattgtgtctaccggaca5'。

[0108] NC mimic (Raybo, miR1N0000001-1-5micrON mimic NC#22,5nmol) was synthesized as a negative control. Next, we observed the effect of MiRNAs mimic on the level of oxidative stress in hepatocytes induced by H2O2. After 24 hours of transfection of AML12 hepatocytes with MiRNAs mimic (100nM), 200nM H2O2 was used to induce oxidative stress in hepatocytes, and DCFH-DA was used to detect changes in intracellular ROS levels 2 hours later.

[0109] The results are as follows Figure 6 As shown in A, the results showed that MiR-150-5p, MiR-486-5p and MiR-410-3p all significantly reduced the intracellular ROS levels compared with the NC group.

[0110] (2) Flow cytometry detection of cell apoptosis

[0111] 24 hours after miRNAs mimic transfection into AML12 hepatocytes, 200 nM H2O2 was used to induce oxidative stress in hepatocytes, and flow cytometry was used to detect cell apoptosis levels 2 hours later.

[0112] The results are as follows Figure 6 As shown in B, the results showed that compared with the number of apoptotic cells in the NC group, MiR-150-5p, MiR-181a-5p, and MiR-486-5p all reduced hepatocyte apoptosis to varying degrees, but only MiR-410-3p had a significant inhibitory effect on cell apoptosis (P < 0.05).

[0113] Example 7 Identification of MiRNAs that Play a Liver-Protective Role in CBP-Exos

[0114] According to the functional validation results of the above-mentioned MiRNAs mimics acting on damaged AML12 hepatocytes and primary hepatocytes, it is shown that MiR-410-3p has the function of significantly inhibiting oxidative stress and apoptosis of damaged hepatocytes, while MiR-150-5p and MiR-486-5p may have a liver protective effect. In order to confirm whether the three MiRNAs we screened play a decisive role in the liver protective function of CBP-Exos, we used MiRNA inhibitors for identification. We synthesized the corresponding MiRNA inhibitors of these three MiRNAs respectively. The nucleotide sequences are based on the following sequences, with "u" replacing "t", and the sequences are as follows:

[0115] SEQ ID NO:14

[0116] MiR-150-5p:3'agagggttgggaacatggtcac 5'.

[0117] SEQ ID NO:15

[0118] MiR-486-5p:3'aggacatgactcgacggggctc 5'.

[0119] SEQ ID NO:16

[0120] MiR-410-3p:3'ttatattgtgtctacccggaca5'.

[0121] At the same time, NC inhibitor (Ribo Company, miR2N0000001-1-5micrOFF inhibitor NC#22,5nmol) was used as a negative control.

[0122] (1) ROS level detection

[0123] CBP-Exos were pre-incubated with AML12 hepatocytes, and the inhibitors of the three miRNAs and the negative control NC inhibitor were transfected respectively. 200 nM H2O2 was used to induce oxidative stress in hepatocytes 24 hours after transfection, and the intracellular ROS level was detected using a fluorescence microscope 2 hours later.

[0124] The results are shown in 7A. The results showed that compared with the NC inhibitor group, the CBP-Exos+NC inhibitor group, CBP-Exos+MiR-150-5p inhibitor group and CBP-Exos+MiR-486-5p inhibitor group all significantly reduced the intracellular ROS level (P<0.05); while there was no difference between the CBP-Exos+MiR-410-3p inhibitor group and the NC inhibitor group; indicating that the effect of CBP-Exos on reducing the ROS level in damaged liver cells will disappear only after inhibiting the function of MiR-410-3p.

[0125] (2) Flow cytometry detection of cell apoptosis

[0126] CBP-Exos were pre-incubated with AML12 hepatocytes, and the inhibitors of the three miRNAs (100 nM) and the negative control NC inhibitor (100 nM) were transfected respectively. 24 h after transfection, 200 nM H2O2 was used to induce oxidative stress in hepatocytes, and 2 h later, the Tunel staining method was used to detect the level of cell apoptosis.

[0127] The results are as follows Figure 7 As shown in B, the results showed that compared with the NC inhibitor group, the CBP-Exos+NC inhibitor, CBP-Exos+MiR-150-5p inhibitor and CBP-Exos+MiR-486-5p inhibitor groups all significantly reduced cell apoptosis (P<0.05); while the CBP-Exos+MiR-410-3p inhibitor group could not reduce the number of apoptotic cells, and there was no significant difference with the NCinhibitor group; this indicates that the function of CBP-Exos in inhibiting hepatocyte apoptosis will disappear only after inhibiting the function of MiR-410-3p.

[0128] Example 8 MiR-410-3p agomir can restore the normal structure and function of the liver in ALI mice

[0129] We confirmed in Examples 6 and 7 that MiR-410-3p has a hepatoprotective effect of inhibiting oxidative stress and apoptosis of hepatocytes. In order to further verify whether MiR-410-3p can also play a hepatoprotective role in vivo, we continued to study in ALI mice. We used MiR-410-3p agomir to explore the therapeutic effect of MiR-410-3p on ALI mice, and used NC agomir as a control (Ruibo Company, miR4N0000001-4-5micrON agomir NC#22, in vivo, 5nmol). MiR-410-3p agomir has higher stability than MiR-410-3p mimic used in in vitro studies, and can maintain activity for a longer time in a complex environment. At the same time, it has a higher cell permeability. In the absence of a transfection reagent, it can also overcome obstacles such as cell membranes to enter target cells and play a role, and is more suitable for animal in vivo experiments.

[0130] (1) Detection of serum biochemical indicators ALT and AST levels in mice in each group on the second day after modeling

[0131] CCl4 and olive oil were prepared into working solution at a volume ratio of 1:5 and prepared immediately before use; male mice aged 8-10 weeks and weighing 20-25g were randomly divided into groups, and the model group was intraperitoneally injected with 3μL / g CCl4 working solution; the blank control group was intraperitoneally injected with an equal volume of olive oil; the MiR-410-3p agomir treatment group was given a tail vein CBP-Exos infusion of 5nmol MiR-410-3p agomir / mouse for treatment at the same time as CCl4 modeling, and the efficacy was evaluated 2 days after modeling. On the second day after modeling, mouse blood was collected by eyeball blood sampling in a 1.5ml EP tube, placed at 4℃ overnight, centrifuged at 4℃ 3000rpm for 15 minutes, and the upper serum was taken for the detection of alanine aminotransferase ALT and aspartate aminotransferase AST.

[0132] The results are as follows Figure 8 As shown in A, the results of mouse serum ALT and AST level detection showed that MiR-410-3p treatment can significantly reduce the blood biochemical ALT and AST levels of ALI mice, restore liver function, and is superior to the CBP-Exos treatment group. The reason may be that CBP-Exos is more complex and there are large individual differences after CBP-Exos treatment, resulting in a less significant difference than the MiR-410-3p group.

[0133] (2) H&E staining of liver tissues of mice in each group on day 2 after modeling

[0134] The mice were sacrificed on the second day after modeling, and the mouse liver tissues were collected, washed with PBS and fixed with 4% paraformaldehyde; the liver tissues were embedded in paraffin after fixation for 48 hours; and the liver tissues were sectioned and stained with H&E.

[0135] The results are as follows Figure 8 As shown in B, H&E staining results showed that MiR-410-3p could significantly restore liver tissue structure, reduce the area of ​​liver necrosis and inflammatory cell infiltration, which was comparable to the effect of CBP-Exos treatment.

[0136] (3) F4 / 80 immunohistochemical staining of liver tissue of mice in each group on day 2 after modeling

[0137] The mice were sacrificed on the second day after modeling, and the mouse liver tissues were collected, washed with PBS and fixed with 4% paraformaldehyde; the liver tissues were paraffin-embedded after fixation for 48 hours; liver tissue sections and F4 / 80 immunohistochemical staining were performed.

[0138] To evaluate the level of inflammation in liver tissue, we performed immunohistochemical staining for the macrophage marker F4 / 80. Figure 8 As shown in C, MiR-410-3p treatment can significantly reduce the expression of macrophage marker F4 / 80, suggesting that inflammation is alleviated after MiR-410-3p treatment.

[0139] In summary, the present invention discovered for the first time the role of exosomes derived from human umbilical cord blood plasma in liver damage repair, and further discovered that the key factor in exosomes derived from human umbilical cord blood plasma is MiR-410-3p. Based on the discovery of the present invention, a new use of MiR-410-3p in the preparation of drugs for preventing or treating liver damage can be developed, which provides new ideas for liver damage repair and provides conditions for industrial implementation, which is a significant improvement.

Claims

1. Use of MiR-410-3p in the preparation of a drug for preventing or treating liver injury; the nucleotide sequence of the MiR-410-3p is based on the sequence shown in SEQ ID NO: 12, with "u" replacing "t"; the liver injury refers to acute liver injury.

2. The use of MiR-410-3p according to claim 1 in preparing a drug for preventing or treating liver injury, characterized in that: The MiR-410-3p is derived from plasma exosomes.

3. The use of MiR-410-3p in the preparation of a drug for preventing or treating liver injury according to claim 2, characterized in that: The plasma exosomes are cord blood plasma exosomes.

4. The use of MiR-410-3p according to any one of claims 1 to 3 in the preparation of a drug for preventing or treating liver injury, characterized in that: The dosage of MiR-410-3p is 0.2 nmol / g body weight of mouse.

Images