Genetically engineered bacteria producing erythritol, construction method and application

Abstract

The present invention relates to a genetically engineered erythritol strain and a construction method thereof, as well as application of the strain in preparing erythritol by microbial fermentation. The present invention introduces xylose reductase, xylitol dehydrogenase and xylitol kinase into Yarrowia lipolytica to reshape the xylose metabolic pathway, strengthens the expression of transketolase TKL1, transaldolase TAL and erythrose reductase ER in the erythritol bioproduction pathway, reduces the production of byproducts mannitol and arabitol by knocking out mannitol dehydrogenase MDH and arabitol dehydrogenase ArDH, reduces the conversion of erythritol into other substances by knocking out erythritol dehydrogenase EYD, weakens the accumulation of erythritol, strengthens the expression of sugar uptake pathway genes hexokinase HK and transporters Stp1 and Stp2, and finally produces a high-yield erythritol bacterium that can utilize a mixed carbon source of glucose and xylose, with the yield increased from 50.17 g / L to 195.56 g / L. This provides an excellent strain source for the industrial production of erythritol synthesized using xylose as a substrate, and has great industrial application potential.

Description

Technical Field

[0001] The present invention relates to a genetically engineered bacterium for producing erythritol, a construction method and an application thereof. Background Art

[0002] Erythritol is a four-carbon sugar alcohol with the molecular formula C4H 10 O4 is widely found in nature. With people's increasing emphasis on health in recent years, erythritol, due to its unique properties such as zero calories, non-caries, food safety, and lack of metabolism and absorption by the human body, has become a hot topic in sweetener research in sugar substitutes. Currently, erythritol is widely used as a natural sweetener and food additive in food ingredients, with increasing application in the food, chemical, and pharmaceutical industries, and market demand is increasing year by year.

[0003] Currently, the primary microorganism synthesizing erythritol in my country is Yarrowia lipolytica, which has a well-defined genetic background. Research is being conducted in areas such as gene editing, metabolic engineering, and synthetic biology to target its diverse carbon utilization pathways. These efforts have been widely applied to the development of a variety of chemicals, making them promising strains for industrial production. While research has explored metabolic engineering of erythritol-producing strains of Yarrowia lipolytica, these efforts have primarily focused on the utilization of glucose and glycerol, with no reports of erythritol synthesis from xylose metabolism. Although Yarrowia lipolytica possesses its own xylose metabolism pathway, the expression of genes in this pathway is extremely low, preventing it from utilizing xylose for growth and production. There have also been studies using genetic engineering to engineer Yarrowia lipolytica cells to enable growth on xylose, but these studies have not been linked to industrial production, particularly erythritol production.

[0004] In Yarrowia lipolytica, the synthesis of erythritol is relatively complex and is divided into three pathways according to the type of carbon source.

[0005] The glucose metabolic pathway (6C) is a backbone pathway: glucose (Glucose) is first phosphorylated by hexokinase (HK) to glucose-6-phosphate (G-6-P), which enters the cell. It is then converted to ribulose-5-phosphate (5-P-Ru) catalyzed by glucose-6-phosphate dehydrogenase and 6-phosphogluconate dehydrogenase. Ribulose-5-phosphate is converted to the byproduct arabitol by arabitol dehydrogenase. Ribulose-5-phosphate isomerizes into ribose-5-phosphate (5-PR) and xylulose-5-phosphate (5-P-Xylu), respectively. It is then converted to sedoheptulose-7-phosphate (Sep-7-P) and glyceraldehyde-3-phosphate (3-P-GA) catalyzed by transketolase (TKL1). Finally, it is converted to fructose-6-phosphate (F-6-P) and erythrose-4-phosphate (Ery-4-P) by transaldolase. Erythrose 4-phosphate is dephosphorylated by phosphatase (EryPase) to erythrose, which is then reduced by erythrose reductase to erythritol. Simultaneously, glucose 6-phosphate is converted to fructose 6-phosphate by phosphoglucose isomerase (PGI), and then to fructose by phosphorylase. Fructose is then converted to the byproduct mannitol by mannitol dehydrogenase.

[0006] The glycerol pathway is a secondary pathway (3C): after glycerol enters the cell, under the action of glycerol kinase (GK), it consumes one ATP molecule to produce 3-glycerol phosphate, which is dehydrogenated by 3-glycerol phosphate dehydrogenase (GPD) to form dihydroxyacetone phosphate (DHAP), and then glyceraldehyde phosphate isomerase (TPI) isomerizes it to form 3-phosphoglyceraldehyde (G3P), which is then combined with fructose 6-phosphate to form 5-xylulose phosphate and 4-erythrose phosphate under the action of transketolase TKL1, and enters the pentose phosphate pathway.

[0007] The xylose pathway is a low-level expression pathway (5C): xylose enters the cell via a transporter and is reduced to xylitol by the NAD(P)H-dependent xylose reductase XR. It is then oxidized to xylulose by the NAD+-dependent xylitol dehydrogenase XDH. Xylulose is converted to 5-P-xylulose by the action of xylulose phosphokinase XK, entering the non-oxidative pentose phosphate pathway. Erythritol is then synthesized under the catalysis of transketolase (TKL1), transaldolase (TAL), phosphatase (EryP), and erythrose reductase (Erth). Although the xylose pathway exists in Yarrowia lipolytica, it is affected by carbon metabolism repression, resulting in extremely low expression of the XK gene, making it unable to utilize xylose.

[0008] Among the above metabolic pathways, modification of the glucose pathway and the glycerol pathway is more common. Many literatures (Zhang L, et al. Multiple gene integration to promote erythritol production onglycerol in Yarrowia lipolytica[J]. Biotechnology Letters, 2021 (17); Carly F, et al. Identification and characterization of EYK1, a key gene for erythritolcatabolism in Yarrowia lipolytica[J]. Applied Microbiology&Biotechnology, 2017; Wang N, et al. Metabolic engineering of Yarrowia lipolytica forthermoresistance and enhanced erythritol productivity[J]. Biotechnology forBiofuels, 2020, 13 (1).) and patents (CN 202010069250.6 and CN202011516582.0) have reported the synthesis of erythritol through metabolic engineering. These more established erythritol production methods all utilize microbial fermentation plants using glucose or glycerol as substrates. While fermentation using industrial crude glycerol as a carbon source is cost-effective, it yields low erythritol yields. Fermentation using glucose as a carbon source offers high production capacity but consumes large amounts of starchy raw materials, leading to high carbon source prices. Lignocellulosic biomass, Earth's largest renewable resource, primarily consists of glucose (60%-70%) and xylose (30%-40%). Wheat starch processing in China, in particular, generates significant amounts of waste starch. Starch is categorized into B starch and C starch based on its carbon content, with their respective carbon content percentages shown in Table 1 below. Developing a chassis cell capable of utilizing both glucose and xylose as carbon sources would not only promote the development of my country's erythritol industry but also fully utilize waste carbon sources from the starch processing industry.

[0009] Table 1: Properties of wheat starch production intermediates

[0010] intermediates Starch content protein Glucan Xylan arabinose other B starch (dry basis) 63.2% 8.9% 2.7% 13% 2.4% 9.8% C starch (dry basis) 48.2% 12.9% 1.7% 15.6% 2.2% 19.3% B+C starch (dry basis) 67.8% 7.5% 3.1% 15.2% 2.9% 3.5%

[0011] Based on the above research background, carbon source utilization in the erythritol production process has become a difficult problem that needs to be overcome in its industrialization. Based on the modification of the classic glucose metabolism pathway and the reconstruction of the xylose pathway, it is possible to increase the utilization of waste starch raw materials generated during wheat processing as a key carbon source for fermentation production, thereby promoting the deep processing of wheat starch and achieving the goal of reducing costs. Currently, there are no chassis cells that integrate glucose and xylose co-metabolism. Therefore, the industry urgently needs to design and construct chassis cells that can utilize waste starch raw materials, reduce resource waste, and improve the utilization efficiency of bioenergy. Summary of the Invention

[0012] The present invention aims to provide an engineered Yarrowia lipolytica strain having a xylose metabolic pathway (XR-XDH pathway) that can rapidly metabolize glucose and xylose to produce erythritol, as well as the use of the genetically engineered strain in the preparation of erythritol by microbial fermentation.

[0013] The technical solution adopted in the present invention is:

[0014] The genetically engineered bacteria producing erythritol are constructed by the following method:

[0015] (1) Yarrowia lipolytica ( Yarrowia lipolytica ) was used as the chassis strain, and the genes encoding xylose reductase (XR), xylitol dehydrogenase (XDH), and xylulose kinase (XK) were overexpressed to obtain the engineered strain Yarrowia lipolytica XR:XDH:XK, denoted as ERY1;

[0016] (2) The erythritol dehydrogenase (EYD) gene in the genome of the engineered bacterium ERY1 was knocked out to obtain the engineered bacterium Yarrowia lipolytica XR:XDH:XKΔEYD, which was designated as ERY2;

[0017] (3) Knock out the mannitol dehydrogenase gene (MDH) in the genome of engineered bacteria ERY2 to obtain engineered bacteria Yarrowia lipolytica XR:XDH:XKΔEYDΔMDH, denoted as ERY3;

[0018] (4) Knock out the Arabitol dehydrogenase gene (ArDH) in the genome of engineered bacteria ERY3 to obtain engineered bacteria Yarrowia lipolytica XR:XDH:XKΔEYDΔMDHΔArDH, denoted as ERY4;

[0019] (5) Using the engineered bacterium ERY4 as the base strain, the non-oxidative module genes of the pentose phosphate pathway, transketolase TKL1, transaldolase TAL, and erythrose reductase ER, were overexpressed to obtain the engineered bacterium Yarrowia lipolytica XR:XDH:XKΔEYDΔMDHΔArDH:TKL1:TAL:ER, which was recorded as ERY5;

[0020] (6) Using the engineered bacterium ERY5 as the chassis bacterium, the HK gene, the Stp1 gene, and the Stp2 gene were overexpressed to obtain the engineered bacterium Yarrowia lipolytica XR:XDH:XKΔEYDΔMDH ΔArDH:TKL1:TAL:ER:HK:Stp1:Stp2, which was recorded as ERY6, the genetically engineered bacterium producing erythritol.

[0021] The present invention improves Yarrowia lipolytica by means of metabolic engineering and genetic engineering, so that the recombinant Yarrowia lipolytica can better utilize the glucose-xylose mixed culture medium to efficiently synthesize erythritol, and enhances its xylose utilization ability by (1) strengthening the xylose metabolism module of the erythritol synthesis pathway of Yarrowia lipolytica; (2) reducing the carbon diversion effect of by-products and the effect of erythritol degradation on yield; (3) strengthening the non-redox module of the pentose phosphate pathway to improve the erythritol conversion efficiency; and (4) strengthening the sugar uptake module, thereby obtaining a Yarrowia lipolytica erythritol genetically engineered strain that can metabolize a mixture of glucose and xylose. The strain efficiently synthesizes erythritol using a mixed carbon source of glucose and xylose, and no longer synthesizes by-products (such as mannitol, arabitol, etc.).

[0022] The present invention also relates to a method for constructing the genetically engineered bacteria, which comprises:

[0023] (1) Yarrowia lipolytica ( Yarrowia lipolytica ) was used as the base strain, and the xylose metabolism genes XR, XDH, and XK were expressed in tandem in multiple copies using a 26s rDNA multi-site integration plasmid. The promoters used were P TEF1 、P GPD2 、P hp4d , and obtained the engineered strain Yarrowia lipolytica XR:XDH:XK, denoted as ERY1;

[0024] (2) Homologous recombination technology was used to knock out the erythritol dehydrogenase (EYD) gene in the genome of the engineered bacterium ERY1 to obtain the engineered bacterium Yarrowia lipolytica XR:XDH:XKΔEYD::URA3d. At the same time, the reverse screening function of pentafluoroorotic acid (5-FOA) and uridine (U) was used to remove the selection marker URA3d using the knockout frame self-recombination technology to obtain the engineered bacterium Yarrowia lipolytica XR:XDH:XKΔEYD, which was recorded as ERY2.

[0025] (3) Homologous recombination technology was used to knock out the mannitol dehydrogenase (MDH) gene in the genome of the engineered bacterium ERY2, resulting in the engineered bacterium Yarrowia lipolytica XR:XDH:XKΔEYDΔMDH::URA3d. At the same time, the reverse screening function of pentafluoroorotic acid and uridine was used, and the selection marker URA3d was removed by knockout frame self-recombination technology, resulting in the engineered bacterium Yarrowia lipolytica XR:XDH:XKΔEYDΔMDH, which was recorded as ERY3.

[0026] (4) Homologous recombination technology was used to knock out the arabitol dehydrogenase gene (ArDH) in the genome of the engineered bacterium ERY3, resulting in Yarrowia lipolytica XR:XDH:XKΔEYDΔMDHΔArDH::URA3d. At the same time, the reverse screening function of pentafluoroorotic acid and uridine was used, and the selection marker URA3d was removed by knockout frame self-recombination technology, resulting in the engineered bacterium Yarrowia lipolytica XR:XDH:XKΔEYDΔMDHΔArDH, which was recorded as ERY4.

[0027] (5) Using the engineered bacteria ERY4 as the base bacteria, the ZETA sequence multi-site integration plasmid was used to express three genes in multiple copies: transketolase (TKL1), transaldolase (TAL) and erythrose reductase (ER). The promoters were P TEF1 、P GPD2 、P hp4d , and obtained the engineered strain Yarrowia lipolytica XR:XDH:XKΔEYDΔMDHΔArDH:TKL1:TAL:ER, denoted as ERY5;

[0028] (6) Using the engineered bacteria ERY5 as the base bacteria, the 26S rDNA sequence multi-site integration plasmid was used to overexpress the hexokinase gene (HK), sugar transporter 1 gene (Stp1) and sugar transporter 2 gene (Stp2). The promoters were P TEF1 、P GPD2 、P hp4d , and obtained the engineered bacterium Yarrowia lipolytica XR:XDH:XKΔEYDΔMDHΔArDH:TKL1:TAL:ER:HK:Stp1:Stp2, which is recorded as ERY6, the genetically engineered bacterium producing erythritol.

[0029] Specifically, the promoter P TEF1 The sequence is shown in SEQ ID NO. 1, promoter P GPD2 The sequence is shown in SEQ ID NO.2, and the promoter P hp4d The sequence is shown in SEQ ID NO. 3.

[0030] Specifically, the NCBI accession numbers of the XR, XDH, XK, TKL1, TAL, ER, HK, Stp1 and Stp2 gene sequences are: XP_502540.1, XP_503864.1, XP_505266.1, XP_503628.1, XP_505460.1, XP_505585.1, XP_501216.1, XP_002548209.1 and XP_002545887.1, respectively.

[0031] The present invention also relates to the application of the genetically engineered bacteria in the preparation of erythritol by microbial fermentation.

[0032] Specifically, the application is as follows: the genetically engineered bacterial strain is inoculated into a fermentation medium with glucose and / or xylose as a carbon source, and fermented at 25-32°C and 180-300 rpm for 96-200 hours. After the fermentation is completed, the fermentation supernatant is separated and purified to obtain the erythritol. Before fermentation, the genetically engineered strain is usually inoculated into YPD medium and cultured overnight on a shaker at a temperature of 28-30°C and a speed of 180-250 rpm. Then, it is inoculated into the fermentation medium at a volume concentration of 10%.

[0033] Furthermore, the application is as follows: streaking the genetically engineered strain onto YPD solid medium, culturing at 30°C for 2 days, picking a single colony and inoculating it into 50 mL of liquid YPD medium, culturing at 28-30°C and 180-250 rpm for 24 hours, then transferring 30 mL to 300 mL of YPD medium, fermenting at 28-30°C and 180-250 rpm for 24 hours, and transferring the entire amount into a 5 L fermentor, with a total fermentation volume of 3 L. A chemostat culture method is used, and the fermentation conditions are controlled as follows: a rotation speed of 450-600 rpm, a pH of 6.0, a fermentation aeration rate of 0.5-1 vvm, and a fermentation time of 200 hours. After the fermentation is completed, erythritol is separated and purified to obtain erythritol.

[0034] Preferably, the fermentation medium is composed of: 100-300 g / L glucose, 50-200 g / L xylose, 1-10 g / L yeast powder, 1-10 g / L peptone, 0.5-2.0 g / L triammonium citrate, 0.05-0.2 g / L magnesium sulfate heptahydrate, 0.05-0.2 g / L zinc sulfate heptahydrate, 0.01-0.05 g / L manganese chloride tetrahydrate, water as the solvent, and natural pH.

[0035] The present invention transforms the erythritol biosynthesis network of Yarrowia lipolytica and uses a strong promoter P TEF1 、P GPD2 、P hp4d The XR, XDH, and XK genes were strongly expressed, respectively, and the erythritol biosynthesis pathway with xylose as the carbon source was remodeled. TEF1 、P GPD2 、P hp4d The promoters correspond to SEQ ID NO. 1, SEQ ID NO. 2, and SEQ ID NO. 3, respectively. By knocking out the erythritol degradation pathway gene EYD and the carbon shunt pathway genes mannitol dehydrogenase MDH and arabitol dehydrogenase ArDH, erythritol accumulation was increased. By overexpressing the TKL1, TAL, and ER genes, the precursor conversion capacity of the non-oxidative module of the pentose phosphate pathway during erythritol biosynthesis was enhanced, increasing its accumulation. Furthermore, overexpressing the HK, Stp1, and Stp2 genes enhanced sugar uptake capacity, further increasing erythritol production.

[0036] In summary, in order to further optimize the pathway for synthesizing erythritol from a mixed carbon source of glucose and xylose, the present invention selects a wild-type Yarrowia lipolytica strain as a starting strain, introduces a new pathway into Yarrowia lipolytica through metabolic engineering and genetic engineering, knocks out genes related to by-product synthesis, and expresses genes related to erythritol synthesis. This method constructs a recombinant Yarrowia lipolytica strain that can more efficiently ferment and synthesize erythritol from a mixed carbon source of glucose and xylose, thereby obtaining a strain Yarrowia lipolytica ERY6 with significantly improved erythritol production and yield.

[0037] The beneficial effects of the present invention are mainly reflected in: the present invention uses a multi-copy expression method in Yarrowia lipolytica to reshape the xylose metabolic pathway, strengthens the expression of TKL1, TAL, and ER in the erythritol bioproduction pathway, reduces the production of by-products mannitol and arabitol by knocking out MDH and ArDH, reduces the conversion of erythritol into other substances by knocking out EYD, weakens the accumulation of erythritol, and strengthens the expression of sugar uptake pathway genes HK, Stp1, and Stp2. Finally, an erythritol-producing bacterium that can utilize a mixed carbon source of glucose and xylose is obtained, and the yield is increased from 50.17 g / L to 195.56 g / L. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 is the erythritol yield of the wild-type strain in shake flask fermentation in glucose, xylose and glucose-xylose mixed medium;

[0039] Figure 2 Determination of substrate and product contents in 5 L fermentation tanks with xylose and glucose mixed carbon sources;

[0040] Figure 3 The substrate and product content were determined in a 5 L tank fermentation with wheat B starch as the carbon source. DETAILED DESCRIPTION

[0041] The present invention will be further described below with reference to specific embodiments, but the protection scope of the present invention is not limited thereto.

[0042] In the examples, the concentration of pentafluoroorotic acid (5-FOA) in the culture medium is 0.1% (w / w), the concentration of uridine (U) in the culture medium is 10 mM, the concentration of ampicillin in the culture medium is 0.10 mg / L, and the concentration of kanamycin in the culture medium is 0.05 mg / L.

[0043] Table 2: Genes and related functions involved in genetic engineering

[0044] Gene name NCBI ID Function XR XP_502540.1 Xylose reductase XD XP_503864.1 Xylitol dehydrogenase XK XP_505266.1 Xylulose kinase EYD YALI0_F01650g Erythritol dehydrogenase MDH YALI0_B16192g Mannitol dehydrogenase ArDH YALI0_F02211g Arabinitol dehydrogenase TKL1 XP_503628.1 Transketolase TAL XP_505460.1 Transaldolase ER XP_505585.1 Erythrose reductase HK XP_501216.1 Hexokinase Spt1 XP_002548209.1 Sugar transporter 1 Spt2 XP_002545887.1 Sugar transporter 2

[0045] Table 3: Primer sequences used in the present invention

[0046] Primer name Primer sequence (5'→3') pMD20-ArDH-up1kb-F tagtcatatggattGGGCCCGACATTCTCACCAGACTGAGA ArDH-up1kb-R ATGTTCACCTCCTTCATCCTCACCACGGAGTTCCCTTCCA ArDH-redown-F AGGATGAAGGAGGTGAACATGAC ArDH-redown-R gctctgtacaccgagaaacaATTGAGGTCTTCCTGGACAAGTAC ArDH-down1kb-F gagactgaaataaatttagtAGGATGAAGGAGGTGAACATGAC ArDH-down1kb-R ccggggatccgattctagaGCGTGGACTGTAGCTAATACTGT pMD20-MDH-up1kb-F tagtcatatggattGGGCCCCATCTCTGGCAACCCTATTTGA MDH-up1kb-R GACTTGGATGATTCTTCGTTGTGTTCGAGGGAGCACACCCA MDH-redown-F CAACGAAGATCATCCAAGTCTG MDH-redown-R gctctgtacaccgagaaacaTGTGAGTGGAGCAGCATCCTATA MDH-down1kb-F gagactgaaataaatttagtCAACGAAGATCATCCAAGTCTG MDH-down1kb-R ccggggatccgattctagaGCTTCTGAGCTCCTCCAGCTTG EYD-up1kb-pMD20-F agtcatatggattGGGCCCAATCGCACCTTTCAAACCTCC EYD-up1kb-R TGTCAGTCGGGATGAGGAGCcgttgGCGGCTGAACCATAGA EYD-reDown500-F GCTCCTCATCCCGACTGACA EYD-reDown500-URA3d1-R gctctgtacaccgagaaacaCTCTGCCTGGTCGGGTTGCT URA3d1-F tgtttctcggtgtacagagctt URA3d1-R actaaatttatttcagtctcctctt EYD-Down1Kb-URA3d1-F gagactgaaataaatttagtGCTCCTCATCCCGACTGACA EYD-Down1Kb-PMD20-R ccggggatccgattctagaGTCATGTGCTCTGTAAGTGAAATTG .

[0047] Example 1: Shake flask fermentation of wild-type strain erythritol and erythritol production performance test

[0048] Bacterial culture: Take Yarrowia lipolytica po1f (ATCC20260) stored at -80℃, streak it onto YPD medium, and culture it at 28℃ for 2 days. Pick a single colony and transfer it to 50 mL of YPD liquid medium. Culture it at 200 rpm and 28℃ for 24 h.

[0049] Shake flask fermentation: Inoculate 5 mL of the cultured seed solution into a 250 mL convex bottom shake flask containing 50 mL of fermentation medium. The fermentation medium composition is divided into three groups:

[0050] A: glucose 350 g / L, yeast extract 10 g / L, peptone 5 g / L, ammonium citrate tribasic 1 g / L, magnesium sulfate heptahydrate 0.1 g / L, zinc sulfate heptahydrate 0.1 g / L, manganese chloride tetrahydrate 0.02 g / L;

[0051] B: glucose 250 g / L, xylose 100 g / L, yeast extract 10 g / L, peptone 5 g / L, ammonium citrate tribasic 1 g / L, magnesium sulfate heptahydrate 0.1 g / L, zinc sulfate heptahydrate 0.1 g / L, manganese chloride tetrahydrate 0.02 g / L;

[0052] C: Xylose 100 g / L, yeast powder 10 g / L, peptone 5 g / L, ammonium citrate tribasic 1 g / L, magnesium sulfate heptahydrate 0.1 g / L, zinc sulfate heptahydrate 0.1 g / L, manganese chloride tetrahydrate 0.02 g / L.

[0053] The culture was continued in a shaker at 28°C and 200 rpm. After 5 days, the fermentation was terminated and the fermentation broth was collected for erythritol HPLC analysis.

[0054] HPLC analysis: 1 mL of fermentation broth was centrifuged, the supernatant was removed, diluted 100-fold, and filtered through a 0.22 μm aqueous membrane into a liquid phase flask for later use. 1 L of 5 mM sulfuric acid was prepared as the mobile phase, filtered through a 0.22 μm membrane, and sonicated for 30 min. Chromatographic conditions: an Aminex HPX-87H carbohydrate analysis column (300 mm × 7.8 mm), column temperature at 35°C, mobile phase 5 mM H₂SO₄, flow rate 0.6 mL / min, injection volume 10 μL, and detector temperature at 30°C using a differential refractive index detector.

[0055] Example 2: Construction of xylose metabolizing strain Y. lipolytica ERY1

[0056] The gene sequences of Yarrowia lipolytica XR, XDH and XK were retrieved from NCBI website, and the nucleic acid sequence pUC19-RDK for co-expression of XR, XDH and XK genes was designed and synthesized: SEQ ID NO.4. TEF1 、P GPD2 、P hp4d Drive the transcription of XR, XDH and XK to achieve strong expression; at the same time, the flanking 26S rDNA sequence serves as a multi-copy insertion site. Extract the plasmid containing the expression vector pUC19-RDK and perform double enzyme digestion with endonuclease KpnI to obtain a linearized expression framework: upstream 26S rDNA sequence → P TEF1 →XR gene sequence→Tleu→P GPD2 →XDH gene sequence→Tmig1→P hp4d →XK gene sequence→Txpr2→26SrDNA sequence.

[0057] The expression construct was introduced into the erythritol-producing yeast Yarrowia lipolytica (AJD) via lithium acetate-mediated chemical transformation. Transformants were screened on SD medium (6.7 g / L YNB, 5 g / L (NH₄)₂SO₄, and 15 g / L agar) containing xylose (the wild-type strain is unable to grow in xylose). The screening medium consisted of 20 g / L xylose, 6.7 g / L YNB, 5 g / L (NH₄)₂SO₄, and 15 g / L agar, pH 6.0. Since Yarrowia lipolytica itself cannot utilize xylose, transformants that grew in xylose-containing medium were considered capable of xylose metabolism, thus obtaining the Yarrowia lipolytica ERY1 strain.

[0058] Example 3: Construction of Erythritol Degradation Gene and Carbon Diversion Branch Gene Knockout Bacteria and Shake Flask Fermentation

[0059] Using the primers listed in Table 2, a knockout cassette (SEQ ID NO. 7) for the erythritol dehydrogenase gene EYD was constructed by PCR and one-step cloning. The knockout cassette structure consists of a 1 kb upstream homology arm of EYD, a 500 bp downstream homology arm (redown), a URA3d marker, and a 1 kb downstream homology arm of EYD. Under the selective pressure of 0.1% pentafluoroorotic acid (5-FOA) and 10 mM uridine (U), the redown sequence can self-recombine with the downstream homology arm, thereby completing the self-recombination removal of the URA3d marker and achieving comparative recycling. The EYD gene was knocked out in the engineered strain ERY1, and the EYD gene knockout strain was verified by PCR to confirm that homologous recombination had occurred. Subsequently, the correct transformants were diluted and plated onto SD plates containing 0.1% pentafluoroorotic acid (5-FOA) and 10 mM uridine (U). After resistance pressure screening, the transformants underwent self-recombination, achieving the removal and recycling of the marker, and the EYD knockout strain Yarrowia lipolytica XR:XDH:XKΔEYD without the URA marker was obtained. The transformant was recorded as ERY2.

[0060] Furthermore, the same method was used to construct knockout cassettes for the mannitol dehydrogenase gene MDH (SEQ ID NO. 8) and the arabinitol dehydrogenase gene ArDH (SEQ ID NO. 9). Following the aforementioned method, the MDH and ArDH knockout vectors, which had been double-digested with the endonuclease XbaI, were sequentially introduced into the ERY2 engineered strain. After marker removal and transformant identification, Yarrowia lipolytica XR:XDH:XKΔEYDΔMDH (ERY3) and Yarrowia lipolytica XR:XDH:XKΔEYDΔMDHΔArDH (ERY4) strains were obtained, respectively.

[0061] The obtained ERY4 engineered strain was used to ferment erythritol, and the fermentation medium and fermentation conditions were the same as in Example 2. The results showed that compared with strain ERY1, knocking out the degradation genes and byproduct genes could significantly increase the yield of erythritol (8.24 g / L) and reduce the amount of byproducts produced, including mannitol (0.023 g / L) and arabitol (0.002 g / L), and basically eliminate the accumulation of byproducts.

[0062] Example 4: Erythritol Precursor Conversion Module Enhances Metabolic Flow

[0063] An expression framework containing transketolase TKL1, transaldolase TAL and erythrose reductase gene ER was designed and synthesized, and its sequence is SEQ ID NO.5, including DNA elements for the expression of three genes of transketolase TKL1, transaldolase TAL and erythrose reductase. The expression vector linearized with endonuclease NotI was introduced into the engineered strain ERY4 after DNA transformation, and the three-gene co-expression strain Yarrowia lipolytica XR:XDH:XKΔEYDΔMDHΔArDH:TKL1:TAL:ER was obtained by PCR identification and designated as ERY5. The correct transformant obtained was subjected to fermentation and synthesis of erythritol, and the fermentation medium and fermentation conditions were the same as in Example 2. The results showed that, compared with the starting strain, the enhanced metabolic flow by the precursor conversion module could significantly improve the synthesis efficiency of erythritol, and the shake flask yield was increased to 19.8 g / L.

[0064] Example 5: Enhancement of the sugar uptake module further improves the erythritol production capacity of the engineered strain

[0065] An expression cassette containing hexokinase HK, sugar transporter Stp1, and Stp2 genes was designed and synthesized, and its sequence is SEQID NO.6. The expression vector linearized with the endonuclease EcoRI was introduced into the engineered strain ERY5 after DNA transformation. PCR identification obtained the HK, Stp1, and Stp2 three-gene co-expression strain Yarrowia lipolytica XR:XDH:XKΔEYDΔMDHΔArDH:TKL1:TAL:ER:HK:Stp1:Stp2. The obtained strain was designated as Yarrowia lipolytica ERY6, and the correct transformant obtained was subjected to a fermentation experiment to synthesize erythritol. The fermentation medium and fermentation conditions were the same as in Example 2. The results showed that strengthening the sugar uptake module can significantly increase the yield to 23.5 g / L.

[0066] Example 6: Application of engineered strain ERY6 in the production of erythritol by fermentation

[0067] The recombinant Yarrowia lipolytica ERY6 strain was inoculated at 10% in a 2-L Erlenmeyer flask containing 300 mL of fermentation medium. The initial bacterial concentration (OD600) was controlled between 0.8 and 1. The fermentation medium composition was as follows: 250 g / L glucose, 100 g / L xylose, 3 g / L yeast extract, 2 g / L peptone, 1 g / L ammonium citrate tribasic, 0.1 g / L magnesium sulfate heptahydrate, 0.1 g / L zinc sulfate heptahydrate, and 0.02 g / L manganese chloride tetrahydrate. The initial pH was natural. The culture was incubated at 30°C and 220 rpm for 24 h. The culture was then transferred to a fermentor containing 2.7 L of fermentation medium and fermented at 30°C, pH 6.0, with an aeration rate of 1 vvm and a rotation speed of 500 rpm / min for 204 h. Samples were taken regularly to determine the glucose, xylose, and erythritol contents ( Figure 2 By 168 hours (day 7), glucose and xylose in the fermenter were completely consumed. At this time, the erythritol content was 195.56 g / L, and the erythritol synthesis efficiency was 1.16 g / L / h.

[0068] Example 7: 5 L chemostat fermentation test of engineered strain ERY6 to produce erythritol from B starch

[0069] The ERY6 engineered strain, cultured in YPD, was inoculated at a 10% inoculum into a 2-L Erlenmeyer flask containing 300 mL of fermentation medium. The initial bacterial concentration (OD600) was controlled between 0.8 and 1. The fermentation medium composition consisted of 500 mL / L beta-starch, 3 g / L yeast extract, 2 g / L peptone, 1 g / L triammonium citrate, 0.1 g / L magnesium sulfate heptahydrate, 0.1 g / L zinc sulfate heptahydrate, and 0.02 g / L manganese chloride tetrahydrate. The initial pH was 6.0. The beta-starch required hydrolysis: 350 mL of beta-starch was slowly heated in a boiling water bath until it formed a starch milk. Continued boiling, 0.5 g of high-temperature α-amylase was added, and the mixture was stirred until the starch liquefied and became clear. The mixture was then cooled to 55°C, and 0.5 g of mesophilic β-amylase, 0.2 g of pullulanase, and 0.5 g of xylanase were added for saccharification. The mixture was kept warm for 5 h before being used as a fermentation feedstock. Under the conditions of 30℃, pH=6.0 and rotation speed of 500 rpm / min, the fermentation was carried out for 144 hours, and samples were taken regularly to determine the contents of glucose, xylose and erythritol ( Figure 3 By 96 hours (day 4), glucose and xylose in the fermenter were completely consumed, and the erythritol content was determined to be 151.83 g / L, with an erythritol synthesis efficiency of 1.58 g / L / h.

[0070] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and the inventors may make various modifications or variations within the scope of the claims without affecting the essence of the present invention.

Claims

1. Genetically engineered bacteria producing erythritol are constructed by the following method: (1) Yarrowia lipolytica ( Yarrowia lipolytica ) AJD was used as the base strain, and the gene XR encoding xylose reductase, the gene XDH encoding xylitol dehydrogenase, and the gene XK encoding xylulokinase were overexpressed to obtain the engineered strain Yarrowialipolytica XR:XDH:XK, which was designated as ERY1; (2) The erythritol dehydrogenase EYD gene in the genome of the engineered bacterium ERY1 was knocked out to obtain the engineered bacterium Yarrowialipolytica XR:XDH:XKΔEYD, which was recorded as ERY2; (3) Knock out the mannitol dehydrogenase gene MDH in the genome of engineered bacteria ERY2 to obtain engineered bacteria Yarrowia lipolytica XR:XDH:XKΔEYDΔMDH, denoted as ERY3; (4) Knock out the arabinitol dehydrogenase gene ArDH in the genome of the engineered bacterium ERY3 to obtain the engineered bacterium Yarrowia lipolytica XR:XDH:XKΔEYDΔMDHΔArDH, denoted as ERY4; (5) Using the engineered bacterium ERY4 as the base strain, the non-oxidative module genes of the pentose phosphate pathway, transketolase TKL1, transaldolase TAL, and erythrose reductase ER, were overexpressed to obtain the engineered bacterium Yarrowia lipolytica XR:XDH:XKΔEYDΔMDHΔArDH:TKL1:TAL:ER, which was recorded as ERY5; (6) Using the engineered bacterium ERY5 as the chassis bacterium, the hexokinase gene HK, the sugar transporter 1 gene Stp1, and the sugar transporter 2 gene Stp2 were overexpressed to obtain the engineered bacterium Yarrowia lipolytica XR:XDH:XKΔEYDΔMDH ΔArDH:TKL1:TAL:ER:HK:Stp1:Stp2, which was recorded as ERY6, the genetically engineered bacterium producing erythritol.

2. A method for constructing the genetically engineered bacteria according to claim 1, comprising: (1) Yarrowia lipolytica ( Yarrowia lipolytica ) AJD was used as the base strain, and the xylose metabolism genes XR, XDH, and XK were expressed in tandem in multiple copies using a 26s rDNA multi-site integration plasmid. The promoters used were P TEF1 、P GPD2 、P hp4d , and obtained the engineered strain Yarrowia lipolytica XR:XDH:XK, denoted as ERY1; (2) Homologous recombination technology was used to knock out the erythritol dehydrogenase EYD gene in the genome of the engineered bacterium ERY1 to obtain the engineered bacterium Yarrowia lipolytica XR:XDH:XKΔEYD::URA3d. At the same time, the reverse screening function of pentafluoroorotic acid and uridine was used, and the selection marker URA3d was removed by knockout frame self-recombination technology to obtain the engineered bacterium Yarrowialipolytica XR:XDH:XKΔEYD, which was recorded as ERY2; (3) Homologous recombination technology was used to knock out the mannitol dehydrogenase gene MDH in the genome of the engineered bacterium ERY2, resulting in the engineered bacterium Yarrowia lipolytica XR:XDH:XKΔEYDΔMDH::URA3d. At the same time, the reverse screening function of pentafluoroorotic acid and uridine was used, and the selection marker URA3d was removed by knockout frame self-recombination technology, resulting in the engineered bacterium Yarrowia lipolytica XR:XDH:XKΔEYDΔMDH, which was recorded as ERY3. (4) Homologous recombination technology was used to knock out the arabinitol dehydrogenase gene ArDH in the genome of the engineered bacterium ERY3, resulting in Yarrowia lipolytica XR:XDH:XKΔEYDΔMDHΔArDH::URA3d. At the same time, the reverse screening function of pentafluoroorotic acid and uridine was used, and the selection marker URA3d was removed by knockout frame self-recombination technology, resulting in the engineered bacterium Yarrowia lipolytica XR:XDH:XKΔEYDΔMDHΔArDH, which was recorded as ERY4. (5) Using the engineered bacteria ERY4 as the base bacteria, the ZETA sequence multi-site integration plasmid was used to express the transketolase gene TKL1, the transaldolase gene TAL and the erythrose reductase gene ER in multiple copies. The promoters were P TEF1 、P GPD2 、P hp4d , and obtained the engineered strain Yarrowia lipolytica XR:XDH:XKΔEYDΔMDHΔArDH:TKL1:TAL:ER, denoted as ERY5; (6) Using the engineered bacteria ERY5 as the base bacteria, the hexokinase gene HK, sugar transporter 1 gene Stp1 and sugar transporter 2 gene Stp2 were overexpressed using the 26S rDNA sequence multi-site integration plasmid. The promoters were P TEF1 、P GPD2 、P hp4d , and obtained the engineered bacterium Yarrowia lipolytica XR:XDH:XKΔEYDΔMDHΔArDH:TKL1:TAL:ER:HK:Stp1:Stp2, recorded as ERY6, which is the genetically engineered bacterium producing erythritol.

3. The method according to claim 2, wherein Promoter P TEF1 The nucleotide sequence is shown in SEQ ID NO. 1, and the promoter P GPD2 The nucleotide sequence is shown in SEQ ID NO. 2, the promoter P hp4d The nucleotide sequence is shown in SEQ ID NO.

3.

4. Use of the genetically engineered bacteria according to claim 1 in the production of erythritol by microbial fermentation.

5. The use according to claim 4, characterized in that The application is as follows: the genetically engineered bacterial strain is inoculated into a fermentation medium with glucose and / or xylose as carbon sources, fermented and cultured at 25-32°C and 180-300 rpm for 96-200 hours, and after the fermentation is completed, the supernatant of the fermentation liquid is separated and purified to obtain the erythritol.

6. The use according to claim 5, characterized in that The fermentation medium is composed of: 100-300 g / L glucose, 50-200 g / L xylose, 1-10 g / L yeast powder, 1-10 g / L peptone, 0.5-2.0 g / L triammonium citrate, 0.05-0.2 g / L magnesium sulfate heptahydrate, 0.05-0.2 g / L zinc sulfate heptahydrate, and 0.01-0.05 g / L manganese chloride tetrahydrate; the solvent is water; and the pH is natural.

Images