Transgenic maize event lp026-5 and methods for its detection
By designing specific nucleic acid sequences and primer pairs, the problem of detecting transgenic maize events that are difficult to distinguish in existing technologies has been solved, and rapid and accurate identification and stable transmission of expression characteristics of transgenic maize event LP026-5 have been achieved.
Patent Information
- Application Number
- CN202211161748.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-23
- Publication Date
- 2026-01-20
- Estimated Expiration
- 2042-09-23
AI Technical Summary
Existing technologies struggle to accurately distinguish and detect different genetically modified maize events, especially those produced using the same DNA construct, making it difficult to identify commercially viable events with superior resistance to lepidopteran pests and glyphosate herbicides.
Specific nucleic acid sequences (SEQ ID NO:1-7 and their complementary sequences) are provided for designing primer pairs and probes to rapidly and accurately identify the presence of transgenic maize event LP026-5 using PCR and DNA hybridization methods.
It enables rapid and accurate identification of the transgenic maize event LP026-5, ensuring the gene expression characteristics and phenotypic performance of offspring to meet commercialization needs, and tracks transgenic insertion fragments in the breeding population through molecular markers.
Smart Images

Figure CN116200519B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of molecular biology, and relates to a detection method of transgenic plants and products thereof, in particular to a transgenic maize event LP026-5 having insect resistance and tolerance to glyphosate herbicide application and a nucleic acid sequence and method for detecting the transgenic maize LP026-5. BACKGROUND
[0002] Maize (Zea mays L.) is a major food crop in many regions of the world. Biotechnology has been applied to maize to improve its agronomic traits and quality. Insect resistance is an important agronomic trait in maize production, particularly resistance to Lepidopteran insects (e.g., corn borer, cotton bollworm, Spodoptera eridania, armyworm, etc.). Maize resistance to Lepidopteran insects can be obtained by transgenic methods that express Lepidopteran insect resistance genes in maize plants. Another important agronomic trait is herbicide tolerance, particularly tolerance to glyphosate herbicides. Maize tolerance to glyphosate herbicides can be obtained by transgenic methods that express glyphosate herbicide tolerance genes (e.g., epsps) in maize plants.
[0003] It is known that expression of foreign genes in plants is affected by the location in the maize genome where they are inserted, possibly due to the proximity of chromatin structure (e.g., heterochromatin) or transcriptional regulatory elements (e.g., enhancers) to the integration site. As a result, it is often necessary to screen a large number of events in order to identify an event that can be commercialized (i.e., an event in which the introduced gene of interest is optimally expressed). For example, it has been observed in plants and other organisms that the amount of expression of an introduced gene can vary greatly from event to event; there can also be differences in the spatial or temporal pattern of expression, such as differences in the relative expression of a transgene in different plant tissues, which can result in an actual expression pattern that is not consistent with the expression pattern expected from the transcriptional regulatory elements in the introduced gene construct. Thus, it is often necessary to generate hundreds to thousands of different events and screen these events for a single event that has the desired amount and pattern of transgene expression for commercialization purposes. Such a transformation event that has superior lepidopteran pest (e.g., Asian corn borer, Spodoptera eridania, Oriental armyworm, Spodoptera frugiperda, cotton bollworm, Diabrotica undecimpunctata howardi, and peach potato worm) and glyphosate herbicide resistance and does not affect corn yield can be backcrossed into other genetic backgrounds using conventional breeding methods. Progeny resulting from such backcrosses maintain the transgenic expression characteristics and trait performance of the original transformant. Applying this strategy model ensures reliable gene expression in many varieties, stable lepidopteran pest (e.g., Asian corn borer, Spodoptera eridania, Oriental armyworm, Spodoptera frugiperda, cotton bollworm, Diabrotica undecimpunctata howardi, and peach potato worm) and glyphosate herbicide resistance, protection from major lepidopteran pests, and broad-spectrum weed control capability, while well-adapting to local growing conditions.
[0004] It would be beneficial to be able to detect the presence of a particular event to determine whether the progeny of a sexual cross contains the gene of interest. In addition, methods of detecting a particular event would be helpful in complying with regulations, such as the formal approval and labeling of food derived from recombinant crops prior to marketing. Detection of the presence of the transgene by any of the well-known methods of polynucleotide detection, such as the polymerase chain reaction (PCR) or DNA hybridization using a polynucleotide probe, is possible. These detection methods are typically focused on commonly used genetic elements, such as promoters, terminators, marker genes, etc. Thus, unless the sequence of the chromosomal DNA adjacent to the inserted transgenic DNA ("flanking DNA") is known, these methods cannot be used to distinguish between different events, particularly those events that were generated using the same DNA construct. Therefore, it is currently common to use PCR with a pair of primers that span the junction between the inserted T-DNA and the flanking DNA to identify a particular event of a transgene, specifically a first primer contained within the flanking sequence and a second primer contained within the inserted sequence. SUMMARY
[0005] The present application aims to provide a transgenic corn event LP026-5 and a nucleic acid sequence for detecting the corn plant LP026-5 event and a detection method thereof, which can accurately and quickly identify whether a biological sample contains a specific transgenic corn event LP026-5 DNA molecule.
[0006] To achieve the above-mentioned purpose, the present application provides a nucleic acid sequence comprising one or more selected from the sequences SEQ ID NO: 1-7 (i.e. SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7) and the complements thereof. In some embodiments, the nucleic acid sequence is derived from a plant, seed or cell comprising corn event LP026-5, and a representative sample of a seed (classified as corn seed LP026-5) comprising the event was deposited in the China Center for Type Culture Collection (CCTCC, address: Wuhan, China) on April 15, 2022 under the accession number CCTCC NO: P202210. In some embodiments, the nucleic acid sequence is an amplicon for diagnosing the presence of corn event LP026-5.
[0007] In some embodiments of the present application, the present application provides a nucleic acid sequence comprising at least 11 consecutive nucleotides of SEQ ID NO: 3 or the complement thereof, and / or at least 11 consecutive nucleotides of SEQ ID NO: 4 or the complement thereof. In some embodiments, the nucleic acid sequence comprises SEQ ID NO: 1 or the complement thereof, and / or SEQ ID NO: 2 or the complement thereof. In some embodiments, the nucleic acid sequence comprises SEQ ID NO: 3 or the complement thereof, and / or SEQ ID NO: 4 or the complement thereof. In some embodiments, the nucleic acid sequence comprises SEQ ID NO: 5 or the complement thereof.
[0008] The SEQ ID NO: 1 or its complement is a 28 nucleotide sequence located near the insertion junction at the 5' end of the insert sequence in transgenic maize event LP026-5, which spans the flanking genomic DNA sequence of the maize insertion site and the DNA sequence at the 5' end of the insert sequence, and the presence of which identifies the presence of transgenic maize event LP026-5. The SEQ ID NO: 2 or its complement is a 22 nucleotide sequence located near the insertion junction at the 3' end of the insert sequence in transgenic maize event LP026-5, which spans the DNA sequence at the 3' end of the insert sequence and the flanking genomic DNA sequence of the maize insertion site, and the presence of which identifies the presence of transgenic maize event LP026-5.
[0009] The nucleic acid sequence provided herein can be at least 11 or more contiguous polynucleotides of any portion of the transgene insert sequence of SEQ ID NO: 3 or its complement (first nucleic acid sequence), or at least 11 or more contiguous polynucleotides of any portion of the 5' flanking corn genomic DNA region of SEQ ID NO: 3 or its complement (second nucleic acid sequence). The nucleic acid sequence can further be a portion of SEQ ID NO: 3 that is homologous to or complementary to SEQ ID NO: 1. When the first nucleic acid sequence and the second nucleic acid sequence are used together, these nucleic acid sequences comprise a pair of DNA primers in a DNA amplification method to produce an amplified product. The amplified product produced in a DNA amplification method using a pair of DNA primers is an amplified product comprising SEQ ID NO: 1, the presence of transgenic corn event LP026-5 or its progeny can be diagnosed. As is well known to those skilled in the art, the first and second nucleic acid sequences need not be composed solely of DNA, but can also include RNA, a mixture of DNA and RNA, or a combination of DNA, RNA, or other nucleotides or analogs thereof that are not templates for one or more polymerases. In addition, the probes or primers described herein should be at least about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous nucleotides in length, which can be selected from the nucleotides described in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5. When selected from the nucleotides described in SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5, the probes and primers can be from about 17 to 50 or more contiguous nucleotides in length. The SEQ ID NO: 3 or its complement is a 746 nucleotide sequence located near the insertion junction at the 5' end of the insert sequence in transgenic corn event LP026-5, which is composed of a 253 nucleotide corn flanking genomic DNA sequence (nucleotides 1-253 of SEQ ID NO: 3), a 6 nucleotide unknown sequence (254-259), a 370 nucleotide pLP026 construct DNA sequence (nucleotides 260-629 of SEQ ID NO: 3), and a 117 nucleotide 3' end DNA sequence of the Nos terminator (nucleotides 630-746 of SEQ ID NO: 3), and the presence of SEQ ID NO: 3 or its complement can be identified as the presence of transgenic corn event LP026-5.
[0010] The nucleic acid sequence can be at least 11 or more contiguous polynucleotides of any portion of the transgene insert sequence of SEQ ID NO: 4 or its complement (a third nucleic acid sequence), or at least 11 or more contiguous nucleotides of any portion of the 3' flanking Zea mays genomic DNA region of SEQ ID NO: 4 or its complement (a fourth nucleic acid sequence). The nucleic acid sequence can further be a portion of SEQ ID NO: 4 that is homologous to or complementary to SEQ ID NO: 2. When the third nucleic acid sequence and the fourth nucleic acid sequence are used together, these nucleic acid sequences are used in a DNA amplification method to produce an amplification product, which includes a pair of DNA primers. The amplification product produced in the DNA amplification method using the pair of DNA primers is an amplification product comprising SEQ ID NO: 2 when the presence of transgenic Zea mays event LP026-5 or its progeny can be diagnosed. The SEQ ID NO: 4 or its complement is a 1040 nucleotide long sequence located near the insertion junction at the 3' end of the insert sequence in transgenic Zea mays event LP026-5, which consists of a 53 nucleotide tNos (nopaline synthase) transcription terminator sequence (nucleotides 1-53 of SEQ ID NO: 4), a 212 nucleotide pLP026 construct DNA sequence (nucleotides 54-265 of SEQ ID NO: 4), and a 775 nucleotide Zea mays integration site flanking genomic DNA sequence (nucleotides 266-1040 of SEQ ID NO: 4). The presence of the SEQ ID NO: 4 or its complement can be identified as the presence of transgenic Zea mays event LP026-5.
[0011] The SEQ ID NO: 5 or its complement is a 17188 nucleotide long sequence that characterizes transgenic Zea mays event LP026-5, which specifically includes genomic and genetic elements as shown in Table 1. The presence of the SEQ ID NO: 5 or its complement can be identified as the presence of transgenic Zea mays event LP026-5.
[0012] Table 1, Genomic and Genetic Elements Included in SEQ ID NO: 5
[0013]
[0014]
[0015] The nucleic acid sequence or its complement can be used in a DNA amplification method to produce an amplification product, the presence of transgenic corn event LP026-5 or its progeny in a biological sample is diagnosed by detecting the amplification product; the nucleic acid sequence or its complement can be used in a nucleotide detection method to detect the presence of transgenic corn event LP026-5 or its progeny in a biological sample.
[0016] The present application provides a pair of DNA primers comprising a first primer and a second primer, wherein the first primer and the second primer each comprise a fragment of SEQ ID NO: 5 or its complement, and when used in an amplification reaction with DNA containing corn event LP026-5, produce an amplification product for detecting corn event LP026-5 in a sample.
[0017] In some embodiments, the first primer is selected from SEQ ID NO: 1 or its complement, SEQ ID NO: 8 or SEQ ID NO: 10; and the second primer is selected from SEQ ID NO: 2 or its complement, SEQ ID NO: 11 or SEQ ID NO: 14.
[0018] In some embodiments of the present application, the amplification product comprises at least 11 consecutive nucleotides in SEQ ID NO: 3 or its complement, or at least 11 consecutive nucleotides in SEQ ID NO: 4 or its complement.
[0019] Further, the amplification product comprises consecutive nucleotides at positions 1-11 or 18-28 in SEQ ID NO: 1 or its complement, or consecutive nucleotides at positions 1-11 or 12-22 in SEQ ID NO: 2 or its complement.
[0020] Still further, the amplification product comprises SEQ ID NO: 1 or its complement, SEQ ID NO: 2 or its complement, SEQ ID NO: 6 or its complement, or SEQ ID NO: 7 or its complement.
[0021] In the above technical solution, the primer comprises at least one of the nucleic acid sequences. Specifically, the primer comprises a first primer and a second primer, the first primer is selected from SEQ ID NO: 1 or its complement, SEQ ID NO: 8 or SEQ ID NO: 12, and the second primer is selected from SEQ ID NO: 9 or SEQ ID NO: 13; or the first primer is selected from SEQ ID NO: 2 or its complement, SEQ ID NO: 10 or SEQ ID NO: 15, and the second primer is selected from SEQ ID NO: 11 or SEQ ID NO: 14.
[0022] The present application also provides a DNA probe comprising a fragment of SEQ ID NO: 5 or a complement thereof, which hybridizes to a DNA molecule comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-7 or a complement thereof under stringent hybridization conditions and does not hybridize to a DNA molecule not comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-7 or a complement thereof under stringent hybridization conditions.
[0023] In some embodiments, the DNA probe comprises a sequence selected from the group consisting of SEQ ID NO: 1 or a complement thereof, SEQ ID NO: 2 or a complement thereof, SEQ ID NO: 6 or a complement thereof, and SEQ ID NO: 7 or a complement thereof.
[0024] In some embodiments, the DNA probe is labeled with a fluorescent group.
[0025] In some embodiments, the probe comprises at least 11 consecutive nucleotides in SEQ ID NO: 3 or a complement thereof, or at least 11 consecutive nucleotides in SEQ ID NO: 4 or a complement thereof; further, the probe comprises consecutive nucleotides at positions 1-11 or 18-28 in SEQ ID NO: 1 or a complement thereof, or consecutive nucleotides at positions 1-11 or 12-22 in SEQ ID NO: 2 or a complement thereof.
[0026] The present application also provides a marker nucleic acid molecule comprising a fragment of SEQ ID NO: 5 or a complement thereof, which hybridizes to a DNA molecule comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-7 or a complement thereof under stringent hybridization conditions and does not hybridize to a DNA molecule not comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-7 or a complement thereof under stringent hybridization conditions.
[0027] In some embodiments, the marker nucleic acid molecule comprises a sequence selected from the group consisting of SEQ ID NO: 1 or a complement thereof, SEQ ID NO: 2 or a complement thereof, SEQ ID NO: 6 or a complement thereof, and SEQ ID NO: 7 or a complement thereof.
[0028] In one embodiment, the marker nucleic acid molecule comprises at least 11 consecutive nucleotides in SEQ ID NO: 3 or a complement thereof, or at least 11 consecutive nucleotides in SEQ ID NO: 4 or a complement thereof;
[0029] In some embodiments, the marker nucleic acid molecule comprises the contiguous nucleotides 1-11 or 18-28 of SEQ ID NO: 1 or the complement thereof, or the contiguous nucleotides 1-11 or 12-22 of SEQ ID NO: 2 or the complement thereof.
[0030] Further, the present application provides a method for detecting the presence of DNA comprising transgenic corn event LP026-5 in a sample, comprising:
[0031] (1) contacting the sample to be detected with the DNA primer pair in a nucleic acid amplification reaction;
[0032] (2) performing the nucleic acid amplification reaction;
[0033] (3) detecting the presence of the amplification product;
[0034] The amplification product comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1-7 and the complement thereof, i.e. indicating the presence of DNA comprising transgenic corn event LP026-5 in the sample to be detected.
[0035] The present application also provides a method for detecting the presence of DNA comprising transgenic corn event LP026-5 in a sample, comprising:
[0036] (1) contacting the sample to be detected with the DNA probe, and / or the marker nucleic acid molecule;
[0037] (2) hybridizing the sample to be detected with the probe and / or the marker nucleic acid molecule under stringent hybridization conditions;
[0038] (3) detecting the hybridization of the sample to be detected with the probe and / or the marker nucleic acid molecule.
[0039] The stringent conditions can be hybridization in 6xSSC (sodium citrate), 0.5% SDS (sodium dodecyl sulfate) solution at 65°C, followed by washing the membrane with 2xSSC, 0.1% SDS and 1xSSC, 0.1% SDS each once.
[0040] wherein the hybridization of the sample to be detected with the marker nucleic acid molecule is detected, and further marker assisted breeding analysis is performed to determine that insect resistance and / or herbicide tolerance is genetically linked to the marker nucleic acid molecule.
[0041] The present application also provides a DNA detection kit, comprising: a pair of DNA primers for generating an amplicon of the diagnostic transgenic maize event LP026-5, a probe specific to SEQ ID NO: 1-7 or a labeled nucleic acid molecule specific to SEQ ID NO: 1-7. Specifically, the detection kit comprises the probe, the pair of primers or the labeled nucleic acid molecule of the present application.
[0042] In some embodiments, the present application provides a DNA detection kit, comprising at least one DNA molecule comprising at least 11 consecutive nucleotides of the homologous sequence of SEQ ID NO: 3 or the complement thereof, or at least 11 consecutive nucleotides of the homologous sequence of SEQ ID NO: 4 or the complement thereof, which can be used as a DNA primer or a probe specific to the transgenic maize event LP026-5 or its progeny.
[0043] Further, the DNA molecule comprises the 1-11th or 18-28th consecutive nucleotides of SEQ ID NO: 1 or the complement thereof, or the 1-11th or 12-22nd consecutive nucleotides of SEQ ID NO: 2 or the complement thereof.
[0044] Still further, the DNA molecule comprises the homologous sequence of SEQ ID NO: 1 or the complement thereof, the homologous sequence of SEQ ID NO: 2 or the complement thereof, the homologous sequence of SEQ ID NO: 6 or the complement thereof, or the homologous sequence of SEQ ID NO: 7 or the complement thereof. To achieve the above-mentioned purposes, the present application also provides a plant cell comprising a nucleic acid sequence encoding an insect-resistant Cry1Ab, Cry2Ab and Cry1Fa protein, a nucleic acid sequence encoding a glyphosate herbicide-tolerant EPSPS protein and a nucleic acid sequence of a specific region, wherein the nucleic acid sequence of the specific region comprises the sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6 or SEQ ID NO: 7.
[0045] The sequences provided by the present application include the sequences listed in Table 2 below:
[0046] Table 2, related sequences of the present application
[0047]
[0048]
[0049]
[0050] The present invention also provides a method for protecting maize plants from insect infestation, comprising providing at least one transgenic maize plant cell containing transgenic maize event LP026-5 in the diet of target insects; the target insects that ingest the transgenic maize plant cell are inhibited from further ingesting the maize plant.
[0051] The present invention also provides a method for protecting maize plants from damage caused by herbicides by planting at least one transgenic maize plant comprising transgenic maize event LP026-5. In some embodiments, the method includes applying an effective dose of glyphosate herbicide to a field in which at least one transgenic maize plant comprising transgenic maize event LP026-5 is planted.
[0052] The present invention also provides a method for controlling weeds in a field where maize plants are grown, comprising applying a glyphosate herbicide containing an effective dose to a field where at least one transgenic maize plant is grown, said transgenic maize plant comprising transgenic maize event LP026-5.
[0053] The present invention also provides a method for cultivating maize plants resistant to insects, comprising: planting at least one maize seed containing the transgenic maize event LP026-5;
[0054] The corn seeds are allowed to grow into corn plants;
[0055] The corn plants were attacked with target insects and / or sprayed with an effective dose of glyphosate herbicide, and the plants with reduced plant damage compared to other plants that did not contain the transgenic corn event LP026-5 were harvested.
[0056] In some embodiments, the present invention provides a method for cultivating corn plants that are resistant to insects and tolerant to glyphosate herbicides, comprising:
[0057] Plant at least one corn seed containing the genetically modified corn event LP026-5;
[0058] The corn seeds are allowed to grow into corn plants;
[0059] The corn plants were sprayed with an effective dose of glyphosate herbicide, and plants with reduced plant damage compared to other plants that did not have the transgenic corn event LP026-5 were harvested. The plants with reduced plant damage were also resistant to insect feeding damage.
[0060] In some embodiments, the present application also provides a method of producing a corn plant that is resistant to insects, comprising introducing into the genome of said corn plant transgenic corn event LP026-5, and selecting a corn plant that has reduced plant damage from insect feeding. In some embodiments, the method comprises sexually crossing a first parent corn plant that is resistant to insects with a second parent corn plant that lacks insect resistance, thereby producing a plurality of progeny plants; challenging said progeny plants with a target insect; and selecting said progeny plants that have reduced plant damage as compared to plants that do not have transgenic corn event LP026-5.
[0061] In some embodiments, the present application also provides a method of producing a corn plant that is resistant to glyphosate herbicide, comprising introducing into the genome of said corn plant transgenic corn event LP026-5, and selecting a corn plant that is resistant to glyphosate. In some embodiments, the method comprises sexually crossing a first parent corn plant that is resistant to glyphosate herbicide with a second parent corn plant that lacks glyphosate resistance, thereby producing a plurality of progeny plants; treating said progeny plants with glyphosate herbicide; and selecting said progeny plants that are resistant to glyphosate.
[0062] In some embodiments, the present application also provides a method of producing a corn plant that is resistant to insects and resistant to application of glyphosate herbicide, comprising: introducing into the genome of said corn plant transgenic corn event LP026-5, and selecting a corn plant that is resistant to glyphosate and has insect resistance. In some embodiments, the method comprises sexually crossing a first parent corn plant that is resistant to glyphosate and has insect resistance with a second parent corn plant that lacks glyphosate resistance and / or insect resistance, thereby producing a plurality of progeny plants; treating said progeny plants with glyphosate; selecting said progeny plants that are resistant to glyphosate, and said progeny plants that are resistant to glyphosate are also resistant to insect feeding damage.
[0063] The present application also provides a composition produced from transgenic corn event LP026-5, which is corn flour, corn meal, corn oil, corn silk or corn starch. In some embodiments, the composition can be corn flour, corn meal, corn oil, corn starch, corn gluten, tortillas, cosmetics or fillers, and the like agricultural products or commodities. If sufficient expression is detected in the composition, the composition is expected to contain a nucleic acid sequence capable of diagnosing the presence of transgenic corn event LP026-5 material in the composition. Specifically, the composition includes, but is not limited to, corn oil, corn meal, corn meal, corn gluten, corn starch, and any other food to be consumed by animals as a source of food, or otherwise as an ingredient in bulking agents or cosmetic compositions for cosmetic use, and the like.
[0064] The detection method and / or kit based on probe or primer pairs of the present application can be used to detect a transgenic corn event LP026-5 nucleic acid sequence such as shown in SEQ ID NO: 1 or SEQ ID NO: 2 in a biological sample, wherein the probe sequence or primer sequence is selected from the sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, to diagnose the presence of transgenic corn event LP026-5.
[0065] In summary, the transgenic corn event LP026-5 of the present application has the dual traits of insect resistance and herbicide tolerance, and has the following advantages: 1) freedom from economic losses due to Lepidopteran pests (such as the major pests in corn-growing areas, Asian corn borer, Oriental armyworm, Spodoptera frugiperda, Helicoverpa armigera, P. glaucum and P. zonata, etc.); 2) the ability to apply agricultural herbicides containing glyphosate to corn crops for broad-spectrum weed control; 3) no reduction in corn yield. Specifically, the event LP026-5 of the present application has a high level of resistance to target pests, which can cause a mortality rate of up to 100% in pests, and protect plants with a damage rate of up to 0%; has a high level of tolerance to glyphosate herbicides, which can protect plants with a damage rate of up to 0%; and plants containing the event have excellent agronomic performance, with a yield percentage of up to 100%. In addition, the genes encoding the insect resistance and glyphosate tolerance traits are linked on the same DNA segment, and are present in a single genetic locus of the transgenic corn event LP026-5 genome, which improves breeding efficiency and enables the use of molecular markers to track the transgenic insert in breeding populations and their progeny. At the same time, the primer or probe sequences provided in the detection method of the present application can produce an amplification product identified as transgenic corn event LP026-5 or its progeny, which can quickly, accurately and stably identify the presence of plant material derived from transgenic corn event LP026-5.
[0066] The term
[0067] The following definitions and methods can better define the present application and assist one of ordinary skill in the art in practicing the present application. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.
[0068] The term "maize" is intended to include all plant varieties that can be mated with maize, including wild maize species.
[0069] The term "comprising" means "including, but not limited to". The term "processed product" means a product obtained by processing a raw material such as a plant, a seed, etc., for example, a composition, etc.
[0070] The term "plant" includes whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells that are intact in plants or parts of plants such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruit, stems, roots, root tips, anthers, and the like. It is understood that plant parts within the scope of the application include, but are not limited to, plant cells, protoplasts, tissues, calli, embryos, and flowers, stems, fruits, leaves and roots, the latter three derived from the transformed genetic cells of a transgenic plant or its progeny that have been transformed with a DNA molecule of the present application.
[0071] The term "gene" refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences preceding (5' non-coding sequences) and following (3' non-coding sequences) the coding sequence. "Native gene" refers to a gene as found in nature with its own inherent regulatory sequences. "Chimeric gene" refers to any gene that is not a native gene, comprising regulatory and coding sequences that are not found together in nature. "Endogenous gene" refers to a native gene in its natural location in the genome of an organism. "Foreign gene" refers to a gene that is not normally found in an organism's genome but that has been inserted into the organism by transformation. Foreign genes can comprise native genes inserted into a non-native organism or chimeric genes. A "transgene" is a gene that has been introduced into the genome by a transformation procedure. The site in the plant genome where the recombinant DNA has been inserted can be referred to as the "insertion site" or "target site".
[0072] "Flanking DNA" can include genomic DNA that naturally occurs in an organism, e.g., a plant, or foreign (heterologous) DNA introduced by a transformation process, e.g., a segment associated with a transformation event. Thus, flanking DNA can include a combination of natural and foreign DNA. In the present invention, a "flanking region" or "flanking sequence" or "genomic border region" or "genomic border sequence" refers to a sequence of at least 3, 5, 10, 11, 15, 20, 50, 100, 200, 300, 400, 1000, 1500, 2000, 2500, or 5000 base pairs or more that is located immediately upstream or downstream of and adjacent to an originally foreign inserted DNA molecule. When the flanking region is located downstream, it can also be referred to as "left border flanking" or "3' flanking" or "3' genomic border region" or "genomic 3' border sequence" and the like. When the flanking region is located upstream, it can also be referred to as "right border flanking" or "5' flanking" or "5' genomic border region" or "genomic 5' border sequence" and the like.
[0073] Transformation procedures that result in random integration of foreign DNA result in transformants that contain different flanking regions that are specific to each transformant. When recombinant DNA is introduced into a plant by traditional crossing, the flanking regions are not usually altered. Transformants also contain unique junctions between the heterologous insert DNA and a segment of genomic DNA or between two segments of genomic DNA or between two segments of heterologous DNA. A "junction" is the point at which two specific DNA segments are linked. For example, a junction exists at the location where insert DNA is linked to flanking DNA. Junctions also exist in transformed organisms where two DNA segments are linked together in a manner that is modified from that found in the natural organism. "Junction DNA" refers to DNA that comprises a junction.
[0074] The present invention provides a transgenic maize event designated LP026-5, which is a maize plant LP026-5, including plants and seeds of the transgenic maize event LP026-5 and plant cells or regenerable parts thereof, plant parts of the transgenic maize event LP026-5, including but not limited to cells, pollen, ovules, flowers, shoots, roots, stems, silk, tassels, ears, leaves, and products from the maize plant LP026-5, such as corn meal, corn flour, corn oil, corn steep liquor, corn silk, corn starch, and biomass remaining in the field after harvest of a corn crop.
[0075] The transgenic maize event LP026-5 of the present invention comprises a DNA construct that, when expressed in a plant cell, confers resistance to insects and tolerance to glyphosate herbicides.
[0076] In some embodiments of the application, the DNA construct comprises four expression cassettes in tandem, the first expression cassette comprising a suitable promoter for expression in a plant and a suitable polyadenylation signal sequence, the promoter operably linked to a nucleic acid sequence of a Cry2Ab protein of Bacillus thuringiensis (cCry2Ab) that is insect resistant, the Cry2Ab protein having Lepidoptera insect resistance; the second expression cassette comprising a suitable promoter for expression in a plant and a suitable polyadenylation signal sequence, the promoter operably linked to a nucleic acid sequence of a Cryl Fa protein of Bacillus thuringiensis (cCryl Fa) that is insect resistant, the Cryl Fa protein having Lepidoptera insect resistance; the third expression cassette comprising a suitable promoter for expression in a plant and a suitable polyadenylation signal sequence, the promoter operably linked to a nucleic acid sequence of a Cryl Ab protein that is primarily resistant to Lepidoptera insects. The fourth expression cassette comprises a suitable promoter for expression in a plant and a suitable polyadenylation signal sequence, the promoter operably linked to a gene encoding a 5- enolpyruvylshikimate-3-phosphate synthase (EPSPS) protein that is tolerant to glyphosate herbicide. Further, the promoter can be a suitable promoter isolated from a plant, including constitutive, inducible, and / or tissue-specific promoters, including but not limited to, the Cauliflower Mosaic Virus (CaMV) 35S promoter, the Figwort Mosaic Virus (FMV) 35S promoter, the Ubiquitin promoter, the Actin promoter, the Agrobacterium tumefaciens Nopaline Synthase (NOS) promoter, the Octopine Synthase (OCS) promoter, the Cestrum Yellow Leaf Curling Virus promoter, the Patatin promoter, the Ribulose-1,5-bisphosphate Carboxylase / Oxygenase (RuBisCO) promoter, the Glutathione S-Transferase (GST) promoter, the E9 promoter, the GOS promoter, the alcA / alcR promoter, the Agrobacterium rhizogenes RolD promoter, and the Arabidopsis thaliana Suc2 promoter.The polyadenylation signal sequence can be a suitable polyadenylation signal sequence that functions in plants, including but not limited to, a polyadenylation signal sequence derived from the Agrobacterium tumefaciens nopaline synthase (NOS) gene, a polyadenylation signal sequence derived from the Cauliflower Mosaic Virus (CaMV) 35S terminator, a polyadenylation signal sequence derived from the protease inhibitor II (PIN II) gene, and a polyadenylation signal sequence derived from the a-tubulin gene.
[0077] In addition, the expression cassette can further include other genetic elements, including but not limited to, enhancers and signal peptide / transport peptide nucleic acid coding sequences. The enhancers can enhance the expression level of the genes, including but not limited to, the Tobacco Etch Virus (TEV) translational activator, the CaMV 35S enhancer, and the FMV 35S enhancer. The signal peptide / transport peptide can direct the CrylAb protein and / or the EPSPS protein to be transported to the outside of the cell or to specific organelles or compartments within the cell, for example, to target the chloroplast using a chloroplast transit peptide sequence, or to target the endoplasmic reticulum using a 'KDEL' retention sequence.
[0078] The CrylAb, Cry2Ab, and CrylFa genes can be isolated from Bacillus thuringiensis (Bt) and can be optimized for codon usage or otherwise altered to increase the stability and availability of the transcripts in the transformed cells.
[0079] In some embodiments of the present application, the corn cells, seeds, or plants comprising the transgenic corn event LP026-5 comprise, in order, SEQ ID NO: 1, the nucleic acid sequence of SEQ ID NO: 5 from nucleotides 260-16413, and SEQ ID NO: 2, or comprise SEQ ID NO: 5 in the genome thereof.
[0080] The "Lepidoptera", scientific name Lepidoptera, includes two classes of insects, moths and butterflies, and is the most abundant order of pests in agriculture and forestry, such as the corn borer, cotton bollworm, oriental armyworm, Spodoptera exigua, Spodoptera litura, peach fruit moth, etc.
[0081] The 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene can be isolated from Agrobacterium tumefaciens sp. strain CP4 and the polynucleotide encoding the EPSPS gene can be optimized for codon usage or otherwise altered to increase the stability and availability of the transcript in the transformed cell. The 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene can also serve as a selectable marker gene.
[0082] The term "glyphosate" refers to N-phosphonomethylglycine and its salts, and treatment with "glyphosate herbicide" refers to treatment with any one of the herbicide formulations containing glyphosate. The choice of the rate of a particular glyphosate formulation to achieve an effective biological dose is within the ordinary skill of an agronomist. Treatment of a field containing plant material derived from transgenic maize event LP026-5 with any one of the herbicide formulations containing glyphosate will control weed growth in the field and will not affect the growth or yield of plant material derived from transgenic maize event LP026-5.
[0083] The DNA construct is introduced into a plant using a transformation method, including but not limited to, Agrobacterium-mediated transformation, biolistic transformation, and pollen tube pathway transformation.
[0084] Agrobacterium-mediated transformation is a commonly used method for plant transformation. Foreign DNA to be introduced into a plant is cloned between the left and right border consensus sequences of a vector, i.e., the T-DNA region. The vector is transformed into Agrobacterium cells, which are then used to infect plant tissue, and the T-DNA region of the vector containing the foreign DNA is inserted into the plant genome.
[0085] Biolistic transformation is the bombardment of plant cells with a vector containing foreign DNA (particle-mediated biolistic transformation).
[0086] The pollen tube pathway transformation method takes advantage of the natural pollen tube pathway (also known as pollen tube guide tissue) formed after pollination of a plant to carry foreign DNA into the embryo sac via the nucellar pathway.
[0087] After transformation, transgenic plants must be regenerated from the transformed plant tissue, and the progeny with the foreign DNA are selected using an appropriate marker.
[0088] A DNA construct is a combination of DNA molecules linked together that provides one or more expression cassettes. A DNA construct is specifically a plasmid that is capable of self-replicating within a bacterial cell and contains various restriction enzyme sites for the introduction of DNA molecules that provide functional genetic elements, i.e., promoters, introns, leader sequences, coding sequences, 3' terminator regions, and other sequences. An expression cassette contained within a DNA construct includes the genetic elements necessary to provide for the transcription of a messenger RNA and can be designed for expression in prokaryotic or eukaryotic cells. The expression cassettes of the present application are designed most specifically for expression in plant cells.
[0089] A transgenic "event" is the result of transforming a plant cell with a heterologous DNA construct, i.e., including at least one nucleic acid expression cassette containing a gene of interest, inserting the transgene into the plant genome by a transgenic method to produce a plant population, regenerating the plant population, and selecting a particular plant having the characteristics of the insertion into a particular genomic site. The term "event" refers to the original transformant including the heterologous DNA and the progeny of the transformant. The term "event" also refers to the progeny resulting from a sexual cross between the transformant and other individuals containing the heterologous DNA, i.e., the inserted DNA and flanking genomic DNA from the transformant parent are present at the same chromosomal location in the progeny of the cross even after repeated backcrossing with a recurrent parent. The term "event" also refers to the DNA sequence from the original transformant that includes the inserted DNA and the flanking genomic sequence immediately adjacent to the inserted DNA that is expected to be transferred to progeny resulting from a sexual cross between a parent line containing the inserted DNA, e.g., the original transformant and its selfed progeny, and a parent line not containing the inserted DNA, and the progeny receiving the inserted DNA including the gene of interest.
[0090] "Recombinant" in the present application refers to the form of DNA and / or protein and / or organism that is not normally found in nature and thus is created by human intervention. Such human intervention can result in a recombinant DNA molecule and / or a recombinant plant. The "recombinant DNA molecule" is obtained by artificially combining two otherwise isolated segments of sequence, for example, by chemical synthesis or by manipulation of isolated nucleic acid segments using genetic engineering techniques. Techniques for manipulating nucleic acids are well known.
[0091] The term "transgenic" includes any cell, cell line, callus, tissue, plant part or plant having a genotype that is altered by the presence of heterologous nucleic acid, and includes the progeny of the first generation obtained by sexual crosses or by vegetative propagation from the first transgenic plant so altered. The term "transgenic" does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition or spontaneous mutation.
[0092] "Heterologous" in the present application means that the first molecule is not normally found in combination with the second molecule in nature. For example, a molecule can be derived from a first species and inserted into the genome of a second species. Thus the molecule is heterologous to the host and is artificially introduced into the genome of the host cell.
[0093] A transgenic maize event LP026-5 having resistance to lepidopteran insects and tolerance to glyphosate herbicide can be bred by first sexually crossing a first parent maize plant consisting of maize plants bred from the transgenic maize event LP026-5 and its progeny, which is transformed with the expression cassette of the present application for resistance to lepidopteran insects and tolerance to glyphosate herbicide, with a second parent maize plant lacking resistance to lepidopteran insects and / or tolerance to glyphosate herbicide, thereby producing a variety of first generation progeny plants. Progeny plants having resistance to lepidopteran insects and / or tolerance to glyphosate herbicide can be selected and a maize plant having resistance to lepidopteran insects and tolerance to glyphosate herbicide can be bred. These steps can further comprise backcrossing the progeny plants having lepidopteran insect resistance and / or glyphosate tolerance with a second parent maize plant or a third parent maize plant, and then selecting progeny by infestation with lepidopteran insects, application of glyphosate herbicide or by identification of trait-associated molecular markers, such as DNA molecules comprising the 5' and 3' junctions of the inserted sequence in the transgenic maize event LP026-5, thereby producing a maize plant having resistance to lepidopteran insects and tolerance to glyphosate herbicide.
[0094] It is also to be understood that two different transgenic plants can also be crossed to produce offspring containing two independently segregating, separately added foreign genes. Selfing of appropriate offspring can result in progeny plants that are homozygous for both added foreign genes. Backcrossing to the original parent plant and outcrossing to a non-transgenic plant can also be expected, as can vegetative propagation.
[0095] The term "probe" is an isolated nucleic acid molecule to which a conventional detectable label or reporter molecule, e.g., a radioisotope, ligand, chemiluminescent agent, or enzyme, can be attached. Such a probe is complementary to a strand of a target nucleic acid, and in the present application, the probe is complementary to a strand of DNA from the genome of transgenic maize event LP026-5, whether the genomic DNA is from transgenic maize event LP026-5 or seed or derived from a plant or seed or extract of transgenic maize event LP026-5. The probes of the present application include not only deoxyribonucleic or ribonucleic acids, but also polyamides and other probe materials that specifically bind to a target DNA sequence and can be used to detect the presence of that target DNA sequence.
[0096] The term "primer" is an isolated nucleic acid molecule that, upon nucleic acid hybridization, anneals to a complementary target DNA strand, forms a hybrid, and then is extended along the target DNA strand by the action of a polymerase enzyme, e.g., a DNA polymerase. Primer pairs of the present application are directed to their use in amplification of a target nucleic acid sequence, e.g., by the polymerase chain reaction (PCR) or other conventional nucleic acid amplification methods.
[0097] Methods for designing and using primers and probes are well known in the art. DNA molecules comprising the full length or fragments of SEQ ID NO: 1-7 can be used as primers and probes for detecting maize event LP026-5 and can be readily designed by one of skill in the art using the sequences provided herein.
[0098] The probes and primers are generally 11 or more polynucleotides in length, preferably 18 or more polynucleotides in length, more preferably 24 or more polynucleotides in length, and most preferably 30 or more polynucleotides in length. Such probes and primers specifically hybridize to a target sequence under high stringency hybridization conditions. Preferably, however, the probes and primers of the present application have complete DNA sequence identity to the contiguous nucleic acids of the target sequence.
[0099] Primers and probes based on the flanking genomic DNA and insert sequence of the present application can be determined by conventional methods, e.g., by isolating the corresponding DNA molecule from plant material derived from transgenic maize event LP026-5 and determining the nucleic acid sequence of the DNA molecule. Fragments of the DNA molecule comprising the transgenic insert sequence and the flanking region of the maize genome can be used as primers or probes.
[0100] The nucleic acid probes and primers of the present application hybridize to the target DNA sequence under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA derived from transgenic corn event LP026-5 in a sample. A nucleic acid molecule, or fragment thereof, is capable of specifically hybridizing to another nucleic acid molecule under conditions of high stringency. As used herein, two nucleic acid molecules are capable of specifically hybridizing to each other if the two molecules so conjugated form a double-stranded nucleic acid structure under physiological conditions. If the two molecules show complete complementarity, one of the nucleic acid molecules is referred to as the "complement" of the other. As used herein, two nucleic acid molecules are said to display "complete complementarity" when every nucleotide of one of the molecules is complementary to the corresponding nucleotide of the other. Two nucleic acid molecules are said to be "minimally complementary" if they can hybridize to one another in sufficient
[0101] As used herein, a substantially homologous sequence is a nucleic acid molecule that specifically hybridizes to the complementary strand of another nucleic acid molecule under highly stringent conditions. Suitable stringent conditions to promote DNA hybridization, for example, about 6.0 x sodium chloride / sodium citrate (SSC) at 45 °C, followed by a wash of 2.0 x SSC at 50 °C, are well known to those skilled in the art. For example, the salt concentration in the wash steps can be selected from a low of about 2.0 x SSC at 50 °C for moderately stringent conditions to a high of about 0.2 x SSC at 50 °C for highly stringent conditions. Furthermore, the temperature of the wash steps can be increased from low to moderately stringent conditions of about 22 °C (room temperature) to about 65 °C. Both the temperature and the salt concentration can be varied, either together or independently. Specifically, a nucleic acid molecule of the present application can specifically hybridize to one or more of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, or the complement thereof, or any fragment of the above sequences under moderately stringent conditions, for example, about 2.0 x SSC and about 65 °C. More specifically, a nucleic acid molecule of the present application specifically hybridizes to one or more of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, or the complement thereof, or any fragment of the above sequences under highly stringent conditions. Preferred marker nucleic acid molecules of the present application have SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, or SEQ ID NO: 7, or the complement thereof, or any fragment of the above sequences. Another preferred marker nucleic acid molecule of the present application has from 80% to 100% or from 90% to 100% sequence identity to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, or SEQ ID NO: 7, or the complement thereof, or any fragment of the above sequences. SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, and SEQ ID NO: 7 can be used as markers in plant breeding methods to identify progeny of genetic crosses. Hybridization of a probe to a target DNA molecule can be detected by any method known to those skilled in the art, including, but not limited to, fluorescent, radioactive, antibody-based, and chemiluminescent labels.
[0102] "Stringent conditions" with respect to the amplification (e.g., by PCR) of a target nucleic acid sequence using a particular primer pair refers to conditions in a DNA thermal amplification reaction that allow hybridization of the primer pair only to the target nucleic acid sequence, the primer having a wild-type sequence (or its complement) corresponding to the target nucleic acid sequence, to bind to the target nucleic acid sequence, and preferably to produce a unique amplification product, i.e., an amplicon.
[0103] The term "specifically binds" (a target sequence) means that a probe or primer hybridizes only to the target sequence in a sample comprising the target sequence under stringent hybridization conditions.
[0104] As used herein, "amplified DNA", "amplification product" or "amplicon" refers to a nucleic acid amplification product of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine whether a maize plant was produced by sexual crossing involving a transgenic maize event LP026-5 containing the present invention, or whether a maize sample taken from a field contains the transgenic maize event LP026-5, or whether a maize extract, such as meal, flour or oil, contains the transgenic maize event LP026-5, DNA extracted from a maize plant tissue sample or extract can be subjected to a nucleic acid amplification method using a primer pair to produce an amplicon that is diagnostic for the presence of DNA of the transgenic maize event LP026-5. The primer pair includes a first primer derived from a flanking sequence adjacent to the insertion site of the inserted foreign DNA in the plant genome, and a second primer derived from the inserted foreign DNA. The amplicon has a length and a sequence that is also diagnostic for the transgenic maize event LP026-5. The length of the amplicon can range from the combined length of the primer pair plus one nucleotide base pair, preferably plus about fifty nucleotide base pairs, more preferably plus about two hundred fifty nucleotide base pairs, most preferably plus about four hundred fifty nucleotide base pairs or more.
[0105] Alternatively, the primer pair can be derived from flanking genomic sequences on both sides of the inserted DNA to produce an amplicon that includes the entire inserted nucleic acid sequence. One of the primer pair derived from a plant genomic sequence can be located at a distance from the inserted DNA sequence that can range from one nucleotide base pair to about twenty thousand nucleotide base pairs. The use of the term "amplicon" specifically excludes primer dimers formed in a DNA thermal amplification reaction.
[0106] Nucleic acid amplification reactions can be accomplished by any of the nucleic acid amplification reaction methods known in the art, including polymerase chain reaction (PCR). Various nucleic acid amplification methods are well known to those skilled in the art. PCR amplification methods have been developed to amplify 22 kb of genomic DNA and 42 kb of bacteriophage DNA. These methods, as well as other DNA amplification methods in the art, can be used in the present application. The inserted foreign DNA sequence and flanking DNA sequence from transgenic corn event LP026-5 can be amplified from the genome of transgenic corn event LP026-5 using the primer sequences provided, and the PCR amplicons or cloned DNA can be subjected to standard DNA sequencing.
[0107] DNA detection kits based on DNA amplification methods can contain DNA primer molecules that specifically hybridize to the target DNA under appropriate reaction conditions and amplify a diagnostic amplicon. The kits can provide for detection methods based on agarose gel or any of the methods known in the art for detecting diagnostic amplicons. Kits containing DNA primers that are homologous or complementary to any portion of the corn genomic region of SEQ ID NO: 3 or SEQ ID NO: 4, and to any portion of the transgene insert region of SEQ ID NO: 5 are provided by the present application. In particular, the primer pair identified as useful in DNA amplification methods is SEQ ID NO: 8 and SEQ ID NO: 9, which amplify a diagnostic amplicon homologous to a portion of the 5' transgene / genomic region of transgenic corn event LP026-5, wherein the amplicon includes SEQ ID NO: 1. Other DNA molecules useful as DNA primers can be selected from SEQ ID NO: 5.
[0108] Amplicons produced by these methods can be detected by a variety of techniques. One such method is Genetic Bit Analysis, which involves designing a DNA oligonucleotide strand that spans the insert DNA sequence and the adjacent flanking genomic DNA sequence. The oligonucleotide strand is immobilized in the wells of a microtiter plate, and after PCR amplification of the target region (using one primer in the insert sequence and one in the adjacent flanking genomic sequence), single-stranded PCR product can hybridize to the immobilized oligonucleotide strand and serve as a template for single base extension reactions using DNA polymerase and ddNTPs labeled with a specific label for the next expected base. Results can be obtained by fluorescence or ELISA-like methods. The signal represents the presence of the insert / flanking sequence, indicating that amplification, hybridization, and single base extension reactions were successful.
[0109] Another method is the Pyrosequencing technique. This method entails the design of an oligonucleotide chain that spans the junction between the inserted DNA sequence and the adjacent genomic DNA. The oligonucleotide chain and a single-stranded PCR product of the region of interest (one primer in the inserted sequence and one in the adjacent flanking genomic sequence) are hybridized and then incubated with DNA polymerase, ATP, sulfurylase, luciferase, apyrase, adenosine-5'-phosphosulfate, and luciferin. dNTPs are added individually and the light generated is measured. The light signal represents the presence of the insert / flanking sequence, indicating that amplification, hybridization, and single base or multiple base extension reactions were successful.
[0110] The fluorescence polarization phenomenon described by Chen et al. (Genome Res. 9:492-498, 1999) is also a method that can be used to detect the amplicons of the present application. This method entails the design of an oligonucleotide chain that spans the junction between the inserted DNA sequence and the adjacent genomic DNA. The oligonucleotide chain and a single-stranded PCR product of the region of interest (one primer in the inserted sequence and one in the adjacent flanking genomic sequence) are hybridized and then incubated with DNA polymerase and a fluorescently labeled ddNTP. Single base extension results in the incorporation of the ddNTP. This incorporation can be measured by a fluorometer as a change in polarization. The change in polarization represents the presence of the insert / flanking sequence, indicating that amplification, hybridization, and single base extension reactions were successful.
[0111] Taqman is described as a method for detecting and quantifying the presence of a DNA sequence in the manufacturer's instructions for use. Briefly, a FRET oligonucleotide probe is designed that spans the junction between the inserted DNA sequence and the adjacent genomic flanking sequence. The FRET probe and PCR primers (one in the inserted sequence and one in the adjacent flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in the separation of the fluorescent and quencher moieties of the FRET probe and the release of the fluorescent moiety. The generation of a fluorescent signal represents the presence of the insert / flanking sequence, indicating that amplification and hybridization were successful.
[0112] Suitable techniques for detecting plant material derived from transgenic corn event LP026-5 based on hybridization principles can also include Southern blot hybridization, Northern blot hybridization, and in situ hybridization. In particular, the suitable techniques involve incubating a probe with a sample, washing to remove unbound probe, and detecting whether the probe has hybridized. The detection method depends on the type of label attached to the probe, e.g., a radioactively labeled probe can be detected by X-ray film exposure and development, or an enzyme-labeled probe can be detected by a color change resulting from substrate conversion.
[0113] Tyangi et al. (Nat. Biotech. 14:303-308, 1996) describe the use of molecular markers in sequence detection. Briefly, a FRET oligonucleotide probe is designed that spans the inserted DNA sequence and the adjacent genomic flanking junction. The unique structure of the FRET probe results in a secondary structure that holds the fluorescent and quencher moieties in close proximity. The FRET probe and PCR primers (one in the inserted sequence and one in the adjacent flanking genomic sequence) are subjected to cycling in the presence of a thermostable polymerase and dNTPs. Upon successful PCR amplification, hybridization of the FRET probe to the target sequence results in the loss of the probe secondary structure, thereby spatially separating the fluorescent and quencher moieties, resulting in a fluorescent signal. The production of a fluorescent signal is indicative of the presence of the insert / flanking sequence, which indicates that amplification and hybridization were successful.
[0114] Other described methods, such as microfluidics, provide methods and devices for isolating and amplifying DNA samples. Light dyes are used to detect and measure specific DNA molecules. Electronic sensors that contain DNA molecules for detection or nanotube devices that bind specific DNA molecules and thus can be detected are useful for detecting the DNA molecules of the present application.
[0115] DNA detection kits can be developed using the compositions described herein and methods described or known in the art of DNA detection. The kits are useful for identifying whether a sample contains DNA from transgenic corn event LP026-5 and can also be used to breed corn plants that contain DNA from transgenic corn event LP026-5. The kits can contain DNA primers or probes that are homologous to or complementary to at least a portion of SEQ ID NO: 1, 2, 3, 4, or 5, or other DNA primers or probes that are homologous to or complementary to DNA contained in the transgenic genetic elements of the DNA, which can be used in DNA amplification reactions or as probes in DNA hybridization methods.
[0116] DNA sequences contained in the corn genome and in theFigure 1 and the DNA structure of the transgenic insert sequence and the genomic binding site described in Table 1 comprises: a corn LP026-5 flanking genomic region located at the 5' end of the transgenic insert sequence, a portion of the insert sequence from the right border region (RB) of Agrobacterium, a first expression cassette consisting of a figwort mosaic virus 35s promoter (prFMV), operably linked to a corn heat shock protein gene HSP70 intron (iZmHSP70), operably linked to a corn chloroplast transit peptide 2 (spZmCTP2), operably linked to a Bacillus thuringiensis insect resistance Cry2Ab protein (cCry2Ab), operably linked to a nopaline synthase transcription terminator (tNos); a second expression cassette consisting of a corn ubiquitin gene promoter Ubi with tandem repeats of an enhancer region (prZmUbi), operably linked to a Bacillus thuringiensis insect resistance gene CrylFa (cCrylFa), operably linked to a terminator ORF25 Poly A from Agrobacterium pTi15955; a third expression cassette consisting of a cauliflower mosaic virus 35S promoter (pr35S), operably linked to a 5' untranslated leader sequence of a wheat chloroplast a / b binding protein (lWtCab), operably linked to a rice actin 1 intron (iOsActl), operably linked to a Bacillus thuringiensis insect resistance CrylAb protein (cCrylAb), and operably linked to a benzylsulfonamide inducible gene 2 terminator (tIn2); a fourth expression cassette consisting of a rice actin 1 promoter (prOsActl), operably linked to an Arabidopsis chloroplast transit peptide (spAtCTP2), operably linked to a soil bacterium CP4 strain glyphosate tolerance 5-enol-pyruvyl shikimate-3-phosphate synthase (cEPSPS), and operably linked to a nopaline synthase transcription terminator (tNos). A portion of the insert sequence from the left border region (LB) of Agrobacterium, and a corn plant LP026-5 flanking genomic region located at the 3' end of the transgenic insert sequence (SEQ ID NO: 5). In the DNA amplification method, the DNA molecule as a primer can be any portion derived from the transgenic insert sequence in the transgenic corn event LP026-5, or any portion derived from the DNA region of the flanking corn genome in the transgenic corn event LP026-5.
[0117] The transgenic corn event LP026-5 can be combined with other transgenic corn varieties, such as corn tolerant to herbicides (e.g., glufosinate ammonium, dicamba, etc.), or transgenic corn varieties carrying other insect resistance genes (e.g., against scarab beetles, chrysomelid beetles, etc.). All these different combinations of various transgenic events, together with the transgenic corn event LP026-5 of the present application, can provide improved hybrid transgenic corn varieties that are resistant to multiple pests and tolerant to multiple herbicides. These varieties can exhibit superior characteristics, such as yield enhancement, compared to non-transgenic varieties and single trait transgenic varieties.
[0118] The present application provides a transgenic corn event LP026-5, a nucleic acid sequence for detecting corn plants comprising the event and a method for detecting the same. The transgenic corn event LP026-5 is resistant to feeding damage by Lepidopteran pests and tolerant to the phytotoxic effects of glyphosate-containing agricultural herbicides. The dual trait corn plants express Bacillus thuringiensis CrylAb, Cry2Ab and CrylFa proteins, which provide resistance to feeding damage by Lepidopteran pests (e.g., Asian corn borer, Spodoptera eridania); and express a glyphosate-resistant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) protein from Agrobacterium sp. strain CP4, which confers tolerance to glyphosate in plants. The dual trait corn has the following advantages: 1) freedom from economic losses due to Lepidopteran pests (e.g., Asian corn borer, Oriental armyworm, Spodoptera eridania, corn earworm, black cutworm and peach potato worm, etc.); 2) the ability to apply glyphosate-containing agricultural herbicides to corn crops for broad-spectrum weed control; and 3) no reduction in corn yield. Specifically, the event LP026-5 of the present application is resistant to target pests at a high resistance level, which can result in a mortality rate of pests up to 100%, and protects the plants with a damage rate as low as 0%; is tolerant to glyphosate herbicide at a high level, which can protect the plants with a damage rate as low as 0%; and the plants comprising the event have excellent agronomic performance, with a yield percentage as high as 100%. Furthermore, the genes encoding the insect resistance and glyphosate tolerance traits are linked on the same DNA segment and present at a single genetic locus in the genome of the transgenic corn event LP026-5, which provides enhanced breeding efficiency and enables the use of molecular markers to track the transgenic insert in breeding populations and their progeny. Meanwhile, the primer or probe sequences provided in the detection method of the present application can produce an amplification product diagnostic for the transgenic corn event LP026-5 or its progeny, which can quickly, accurately and stably identify the presence of plant material derived from the transgenic corn event LP026-5. BRIEF DESCRIPTION OF DRAWINGS
[0119] Figure 1 Structure diagram of the transgenic insert sequence of the present application for detecting the nucleic acid sequence of corn plant LP026-5 and the binding site of the corn genome;
[0120] Figure 2 Structure diagram of recombinant expression vector pLP026 for detecting nucleic acid sequence of corn plant LP026-5 and detection method thereof of the present application;
[0121] Figure 3 In vitro resistance effect of transgenic corn containing transgenic corn event LP026-5 of the present application on lepidopteran pests;
[0122] Figure 4 Field effect diagram of transgenic corn containing transgenic corn event LP026-5 of the present application on corn borer under artificial infestation;
[0123] Figure 5 Field effect diagram of transgenic corn containing transgenic corn event LP026-5 of the present application on corn borer under artificial infestation;
[0124] Figure 6 Field effect diagram of transgenic corn containing transgenic corn event LP026-5 of the present application on corn borer under artificial infestation;
[0125] Figure 7 Field effect diagram of transgenic corn containing transgenic corn event LP026-5 of the present application on corn borer under artificial infestation;
[0126] Figure 8 Field effect diagram of transgenic corn containing transgenic corn event LP026-5 of the present application on corn borer under artificial infestation;
[0127] Figure 9 Field effect diagram of transgenic corn containing transgenic corn event LP026-5 of the present application on corn borer under artificial infestation;
[0128] Figure 10 Schematic diagram of the present application. DETAILED DESCRIPTION
[0129] The present application will be further described in detail by the following examples. The features and advantages of the present application will become more apparent from the following examples.
[0130] The word "exemplary" is used herein to mean "serving as an example, instance, or illustration." Any implementation described herein as "exemplary" is not necessarily to be construed as preferred or advantageous over other implementations.
[0131] Moreover, the technical features involved in the different implementations of the present application described below can be combined with each other as long as there is no conflict.
[0132] The technical solution of the present invention for detecting the nucleic acid sequence of maize plant LP026-5 and its detection method is further illustrated below through specific embodiments.
[0133] Example 1 Cloning and Transformation
[0134] 1.1 Vector Cloning
[0135] The recombinant expression vector pLP026 was constructed using standard gene cloning techniques. Figure 2 (As shown). The vector pLP026 contains four tandem transgenic expression cassettes. The first expression cassette consists of the Scrophularia mosaic virus 35S promoter (prFMV), operably linked to the intron of the maize heat shock protein gene HSP70 (iZmHSP70), operably linked to maize chloroplast transport peptide 2 (spZmCTP2), operably linked to the insect resistance Cry2Ab protein of Bacillus thuringiensis (cCry2Ab), and operably linked to the transcription terminator of alkaloid synthase (tNos). The second expression cassette consists of the maize ubiquitin gene promoter Ubi (prZmUbi) containing a tandem repeat of the enhancer region, operably linked to the insect resistance gene Cry1Fa of Bacillus thuringiensis (cCry1Fa), and operably linked to the terminator ORF25PolyA from Agrobacterium rhizogenes pTi15955. The third expression cassette consists of the cauliflower mosaic virus 35S promoter (pr35S), operably linked to the 5' untranslated leading strand sequence (lWtCab) of wheat chloroplast a / b binding protein, operably linked to the intron of rice actin gene 1 (iOsAct1), operably linked to the insect resistance Cry1Ab protein (cCry1Ab) of Bacillus thuringiensis, and operably linked to the terminator (tIn2) of benzenesulfonamide-induced gene 2; the fourth expression cassette consists of the rice actin 1 promoter (prOsAct1), operably linked to the Arabidopsis chloroplast transport peptide (spAtCTP2), operably linked to the glyphosate-resistant 5-enol-pyruvylshikimate-3-phosphate synthase (cEPSPS) of Agrobacterium CP4 strain, and operably linked to the transcription terminator (tNos) of carmine synthase. The vector pLP026 was transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA; Cat. No: 18313-015) using liquid nitrogen, and the transformed cells were screened using 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) as a selectable marker.
[0136] 1.2 Plant Transformation
[0137] Aseptic corn embryos are co-cultivated with Agrobacterium as described in Example 1.1 to introduce the T-DNA in the recombinant expression vector pLP026 into the corn genome to produce transgenic corn events.
[0138] For Agrobacterium-mediated corn transformation, briefly, immature embryos are isolated from corn and contacted with an Agrobacterium suspension, wherein the Agrobacterium is capable of delivering a nucleic acid sequence of a crylAb, cry2Ab, crylFa gene and a nucleic acid sequence of an epsps gene to at least one cell of one of the embryos (Step 1 : Infection Step), in which step the embryos are specifically immersed in the Agrobacterium suspension (OD660= 0.4-0.6, Infection Medium (MS Salts 4.3 g / L, MS Vitamins, Casein 300 mg / L, Sucrose 68.5 g / L, Glucose 36 g / L, Acetyl-sinapone (AS) 40 mg / L, 2,4-Dichlorophenoxyacetic acid (2,4-D) 1 mg / L, pH 5.3) to initiate inoculation. The embryos are co-cultivated with the Agrobacterium for a period of time (3 days) (Step 2: Co-cultivation Step). Specifically, the embryos are cultured on solid medium (MS Salts 4.3 g / L, MS Vitamins, Casein 300 mg / L, Sucrose 20 g / L, Glucose 10 g / L, Acetyl-sinapone (AS) 100 mg / L, 2,4-Dichlorophenoxyacetic acid (2,4-D) 1 mg / L, Agar 8 g / L, pH 5.8) after the infection step. Following this co-cultivation phase, there can be an optional "recovery" step. In the "recovery" step, a recovery medium (MS Salts 4.3 g / L, MS Vitamins, Casein 300 mg / L, Sucrose 30 g / L, 2,4-Dichlorophenoxyacetic acid (2,4-D) 1 mg / L, Phytagar 3 g / L, pH 5.8) is provided that contains at least one antibiotic known to inhibit the growth of Agrobacterium (e.g., Cefotaxime) without the addition of a selection agent for plant transformants (Step 3: Recovery Step). Specifically, the embryos are cultured on solid medium with the antibiotic but without the selection agent to eliminate Agrobacterium and provide a recovery period for the infected cells. Next, the inoculated embryos are cultured on medium containing the selection agent (N-(phosphonomethyl)glycine) and growing transformed callus is selected (Step 4: Selection Step). Specifically, the embryos are cultured on selection solid medium (MS Salts 4.3 g / L, MS Vitamins, Casein 300 mg / L, Sucrose 30 g / L, N-(phosphonomethyl)glycine 0.25 mol / L, 2,4-Dichlorophenoxyacetic acid (2,4-D) 1 mg / L, Phytagar 3 g / L, pH 5.8) with the selection agent, resulting in the selective growth of transformed cells. Then, the callus is regenerated into plants (Step 5: Regeneration Step), specifically, the callus grown on medium with the selection agent is cultured on solid medium (MS Differentiation Medium and MS Rooting Medium) to regenerate plants.
[0139] The resistant calli obtained by screening were transferred to MS differentiation medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 6-benzylaminopurine 2 mg / L, N-(phosphonomethyl)glycine 0.125 mol / L, phytagel 3 g / L, pH=5.8) and cultured to differentiate at 25°C. The seedlings differentiated were transferred to MS rooting medium (MS salts 2.15 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, indole-3-acetic acid 1 mg / L, agar 8 g / L, pH=5.8) and cultured at 25°C until about 10 cm high, and then moved to a greenhouse for cultivation until seed setting. In the greenhouse, the plants were cultured at 28°C for 16 hours and at 20°C for 8 hours per day.
[0140] 1.3, Identification and screening of transgenic events
[0141] A total of 1500 independent transgenic T0 plants were generated. After molecular detection (including target gene copy number, insertion site, etc.), target trait (pest resistance and herbicide tolerance) and agronomic trait evaluation were performed on all T0 plants, and abnormal transformant plants were removed, LP026-5 was screened.
[0142] Example 2: Detection of transgenic maize event LP026-5 by TaqMan
[0143] About 100 mg of leaf of transgenic maize event LP026-5 was taken as a sample, and its genomic DNA was extracted by Qiagen DNeasy Plant Maxi Kit. The copy numbers of cry1Ab, cry2Ab, cry1Fa and epsps were detected by Taqman probe fluorescence quantitative PCR method. At the same time, wild type maize plants were used as controls, and the detection and analysis were performed according to the above method. The experiment was set up in triplicate, and the average value was taken.
[0144] The specific method is as follows:
[0145] Step 11: 100 mg of leaf of transgenic maize event LP026-5 was taken and ground into homogenate in a mortar with liquid nitrogen, and 3 replicates were taken for each sample;
[0146] Step 12: The genomic DNA of the above sample was extracted by Qiagen DNeasy Plant Mini Kit, and the specific method was referred to the product manual;
[0147] Step 13: The concentration of genomic DNA of the above sample was determined by NanoDrop 2000 (Thermo Scientific);
[0148] Step 14, adjust the genomic DNA concentration of the above samples to the same concentration value, the concentration value ranges from 80 to 100 ng / μl;
[0149] Step 15, identify the copy number of the samples by using Taqman probe fluorescence quantitative PCR method, use the samples with identified known copy number as standard, use the sample of wild type corn plant as control, 3 repeats for each sample, and take the average value; the fluorescence quantitative PCR primer and probe sequences are as follows:
[0150] The following primer and probe are used to detect cry1Ab gene sequence:
[0151] Primer 1: TGGGAGGACGGAATGATATTG as shown in SEQ ID NO: 16 in the sequence listing;
[0152] Primer 2: AACTCGTCCGTGAGCATCATC as shown in SEQ ID NO: 17 in the sequence listing;
[0153] Probe 1: AACTCCGCGCTGCGATGAATCC as shown in SEQ ID NO: 18 in the sequence listing;
[0154] The following primer and probe are used to detect cry2Ab gene sequence:
[0155] Primer 3: GGACAGAGGCACCGCATT as shown in SEQ ID NO: 19 in the sequence listing;
[0156] Primer 4: CGGGTCTGCAAGCAAACG as shown in SEQ ID NO: 20 in the sequence listing;
[0157] Probe 2: TCCACTTGGCGGTTGAACTCCTCC as shown in SEQ ID NO: 21 in the sequence listing;
[0158] The following primer and probe are used to detect cry1Fa gene sequence:
[0159] Primer 5: GCTATGTCCAGTCCCCAACCT as shown in SEQ ID NO: 22 in the sequence listing;
[0160] Primer 6: CAAGCTGCTAACCTGCACTTGT as shown in SEQ ID NO: 23 in the sequence listing;
[0161] Probe 3: CCCAAACGACACAGCGTCGCG as shown in SEQ ID NO: 24 in the sequence listing;
[0162] The following primers and probes were used to detect the epsps gene sequence:
[0163] Primer 7: GCAAATCCTCTGGCCTTTCC as set forth in SEQ ID NO: 25 of the Sequence Listing;
[0164] Primer 8: TGAAGGACCGGTGGGAGAT as set forth in SEQ ID NO: 26 of the Sequence Listing;
[0165] Probe 4: CGTCCGCATTCCCGGCGA as set forth in SEQ ID NO: 27 of the Sequence Listing;
[0166] The PCR reaction system was
[0167]
[0168] The 50x primer / probe mixture contained 45 μL of each primer at 1 mM concentration, 50 μL of the probe at 100 μM concentration, and 860 μL of 1x TE buffer, and was stored at 4°C in amber tubes.
[0169] The PCR reaction conditions were
[0170]
[0171] The data was analyzed using SDS 2.3 software (Applied Biosystems) to obtain a single copy of the transgenic corn event LP026-5.
[0172] Example 3 Detection of transgenic corn event LP026-5
[0173] 3.1, Genomic DNA extraction
[0174] DNA extraction was performed according to the CTAB (cetyltrimethylammonium bromide) method commonly used: 2 grams of young transgenic corn event LP026-5 leaves were ground into powder in liquid nitrogen, then 0.5 mL of DNA extraction CTAB Buffer [20 g / L CTAB, 1.4 M NaCl, 100 mM Tris-HCl, 20 mM EDTA (ethylenediaminetetraacetic acid)] preheated at a temperature of 65°C was added, pH was adjusted to 8.0 with NaOH, mixed thoroughly, then extracted at a temperature of 65°C for 90 min; 0.5 times the volume of phenol and 0.5 times the volume of chloroform were added and mixed thoroughly; centrifuged at a speed of 12,000 rpm for 10 min; the supernatant was aspirated, 1 times the volume of isopropanol was added, the centrifuge tube was gently shaken, and the tube was placed at a temperature of -20°C for 30 min; centrifuged at a speed of 12,000 rpm for another 10 min; the DNA was collected at the bottom of the tube; the supernatant was discarded, the precipitate was washed with 0.5 mL of 70% ethanol; centrifuged at a speed of 12,000 rpm for 5 min; vacuum dried or blown dry on a clean bench; the DNA precipitate was dissolved in an appropriate amount of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) and stored at a temperature of -20°C.
[0175] 3.2, Analysis of flanking DNA sequences
[0176] The extracted DNA samples were subjected to concentration determination to have the concentration of the sample to be tested between 80-100 ng / μL. The genomic DNA was digested with selected restriction enzymes Spe I, Pst I, BssHII (5' end analysis) and Sac I, Kpn I, Xma I, Nhe I (3' end analysis), respectively. In each digestion system, 26.5 μL of genomic DNA, 0.5 μL of the selected restriction enzyme and 3 μL of the digestion buffer were added, and the enzyme was digested for 1 hour at an appropriate temperature. After the digestion was completed, 70 μL of absolute ethanol was added to the digestion system, and the system was subjected to ice-bath for 30 min, centrifuged at 12000 rpm for 7 min, the supernatant was discarded, and then 8.5 μL of double distilled water (ddH2O), 1 μL of 10X T4 Buffer and 0.5 μL of T4 ligase were added, and the system was connected at 4°C overnight. A series of nested primers were used to amplify and isolate 5' and 3' transgene / genomic DNA. Specifically, the primer combination for isolating 5' transgene / genomic DNA included SEQ ID NO: 13, SEQ ID NO: 34 as the first primer, SEQ ID NO: 35, SEQ ID NO: 36 as the second primer, and SEQ ID NO: 13 as the sequencing primer. The primer combination for isolating 3' transgene / genomic DNA included SEQ ID NO: 15, SEQ ID NO: 37 as the first primer, SEQ ID NO: 38, SEQ ID NO: 39 as the second primer, and SEQ ID NO: 15 as the sequencing primer. The PCR reaction conditions are shown in Table 3.
[0177] The obtained amplicons were electrophoresed on 2.0% agarose gels to separate the PCR reaction products, and then the target fragments were isolated from the agarose matrix using a QIAquick Gel Extraction Kit (Cat # 28704, Qiagen Inc., Valencia, CA). The purified PCR products were then sequenced (e.g., ABI Prism™ 377, PE Biosystems, Foster City, CA) and analyzed (e.g., DNASTAR sequence analysis software, DNASTAR Inc., Madison, WI).
[0178] Standard PCR methods were used to confirm the 5' and 3' flanking sequences and junction sequences. The 5' flanking sequence and junction sequence can be confirmed using SEQ ID NO: 8 or SEQ ID NO: 12 in combination with SEQ ID NO: 9, SEQ ID NO: 13, or SEQ ID NO: 34. The 3' flanking sequence and junction sequence can be confirmed using SEQ ID NO: 11 or SEQ ID NO: 14 in combination with SEQ ID NO: 10, SEQ ID NO: 15, or SEQ ID NO: 37. PCR reaction mixtures and amplification conditions are shown in Table 3. Those skilled in the art will appreciate that other primer sequences can also be used to confirm the flanking sequences and junction sequences.
[0179] DNA sequencing of the PCR products provides DNA that can be used to design other DNA molecules that are useful as primers and probes for the identification of corn plants or seeds derived from transgenic corn event LP026-5.
[0180] It was found that the corn genomic sequence shown at nucleotides 1-253 of SEQ ID NO: 5 is flanking the right border of the insert sequence of transgenic corn event LP026-5 (5' flanking sequence), and the corn genomic sequence shown at nucleotides 17116-17188 of SEQ ID NO: 5 is flanking the left border of the insert sequence of transgenic corn event LP026-5 (3' flanking sequence). The 5' junction sequence is set forth in SEQ ID NO: 1 and the 3' junction sequence is set forth in SEQ ID NO: 2.
[0181] 3.3. PCR Junction Assay
[0182] The junction sequences are relatively short polynucleotide molecules that are new DNA sequences diagnostic for the DNA of transgenic corn event LP026-5 when detected in a polynucleic acid detection assay. The junction sequence of SEQ ID NO: 1 is composed of 11 bp flanking the 5' end of the T-DNA RB region insertion site of transgenic corn event LP026-5 and 11 bp flanking the insertion site of the corn genomic DNA. The junction sequence of SEQ ID NO: 2 is composed of 11 bp flanking each of the T-DNA LB region insertion site of transgenic corn event LP026-5 and the insertion site of the corn genomic DNA. Longer or shorter polynucleotide junction sequences can be selected from SEQ ID NO: 3 or SEQ ID NO: 4. The junction sequences (5' junction region SEQ ID NO: 1, and 3' junction region SEQ ID NO: 2) are useful in DNA detection methods as DNA probes or as DNA primer molecules. The junction sequences SEQ ID NO: 6 and SEQ ID NO: 7 are also new DNA sequences in transgenic corn event LP026-5 that can also be used as DNA probes or as DNA primer molecules to detect the presence of transgenic corn event LP026-5 DNA. The SEQ ID NO: 6 (nucleotides 260-746 of SEQ ID NO: 3) spans the LP026 construct DNA sequence and the tNos transcriptional termination sequence, and the SEQ ID NO: 7 (nucleotides 1-265 of SEQ ID NO: 4) spans the tNos transcriptional termination sequence and the LP026 construct DNA sequence.
[0183] Furthermore, by using primers from at least one of SEQ ID NO: 3 or SEQ ID NO: 4 to generate amplicons that when used in a PCR method produce diagnostic amplicons for transgenic corn event LP026-5.
[0184] Specifically, a PCR product is generated from the 5' end of the transgenic insert sequence that is a portion of genomic DNA flanking the 5' end of the T-DNA insertion sequence that is derived from the genome of a plant material of transgenic corn event LP026-5. This PCR product comprises SEQ ID NO: 3. To perform the PCR amplification, primer 11 (SEQ ID NO: 8) is designed to hybridize to the genomic DNA sequence flanking the 5' end of the transgenic insert sequence, and primer 12 (SEQ ID NO: 9) is designed to pair with the transgenic tNos transcriptional termination sequence.
[0185] A PCR product was generated from the 3' end of the transgenic insert sequence that contained a portion of the genomic DNA flanking the 3' end of the T-DNA insert sequence in the genome of plant material derived from transgenic corn event LP026-5. This PCR product contained SEQ ID NO: 4. To perform the PCR amplification, primer 14 (SEQ ID NO: 11) was designed to hybridize to the genomic DNA sequence flanking the 3' end of the transgenic insert sequence, and primer 13 (SEQ ID NO: 10) was designed to hybridize to the tNos transcriptional termination sequence at the 3' end of the insert.
[0186] The DNA amplification conditions described in Tables 3 and 4 can be used in the PCR junctional assay described above to generate diagnostic amplicons for transgenic corn event LP026-5. Detection of the amplicons can be performed using a Stratagene Robocycle, MJ Engine, Perkin-Elmer 9700, or Eppendorf Mastercycler Gradien thermal cycler, etc., or by methods and equipment known to those skilled in the art.
[0187] Table 3, PCR steps and reaction mixture conditions for identification of the 5' transgenic insert / genomic junction region for transgenic corn event LP026-5
[0188]
[0189] Table 4, Perkin-Elmer 9700 thermal cycler conditions
[0190]
[0191]
[0192] Mix gently and add 1-2 drops of mineral oil over each reaction if no cap is present on the thermocycler. Perform PCR using the cycling parameters in Table 4 on a Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ Research-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermocycler. The MJ Engine or Eppendorf Mastercycler Gradient thermocyclers should be run in the calculated mode. The Perkin-Elmer 9700 thermocycler should have the ramp speed set to maximum when running.
[0193] The results of the experiments show that primers 11 and 12 (SEQ ID NO: 8 and 9) produce an amplified product of a 746 bp fragment when used in a PCR reaction with the genomic DNA of transgenic corn event LP026-5, and no fragment is amplified when used in a PCR reaction with untransformed corn genomic DNA and non-LP026-5 corn genomic DNA; primers 13 and 14 (SEQ ID NO: 10 and 11) produce an amplified product of a 1040 bp fragment when used in a PCR reaction with the genomic DNA of transgenic corn event LP026-5, and no fragment is amplified when used in a PCR reaction with untransformed corn genomic DNA and non-LP026-5 corn genomic DNA.
[0194] PCR Joining Assays can also be used to identify whether material derived from transgenic corn event LP026-5 is homozygous or heterozygous. Primers 15 (SEQ ID NO: 12), primer 16 (SEQ ID NO: 13), and primer 17 (SEQ ID NO: 14), or primers 16 (SEQ ID NO: 13), primer 17 (SEQ ID NO: 14), and primer 18 (SEQ ID NO: 15) are used in an amplification reaction to produce diagnostic amplicons for transgenic corn event LP026-5. The DNA amplification conditions described in Tables 5 and 6 can be used in the joining assays described above to produce diagnostic amplicons for transgenic corn event LP026-5.
[0195] Table 5, Joining Assay Reactions
[0196]
[0197]
[0198] Table 6. Perkin-Elmer 9700 thermocycler conditions for junctional assays
[0199]
[0200] PCR was performed using the Table 6 cycling parameters on a Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ Research-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermocycler. The MJ Engine or Eppendorf Mastercycler Gradient thermocyclers should be run in the calculated mode. The Perkin-Elmer 9700 thermocycler should have the ramp speed set to maximum when running.
[0201] In the amplification reaction, the biological sample containing the template DNA contains DNA diagnostic for the presence of transgenic corn event LP026-5 in the sample. Alternatively the reaction will produce two different DNA amplicons from a biological sample containing DNA derived from the corn genome that is heterozygous for the allele corresponding to the insert DNA present in transgenic corn event LP026-5. The two different amplicons will correspond to a first amplicon derived from the wild type corn genomic locus and a second amplicon diagnostic for the presence of transgenic corn event LP026-5 DNA. A corn DNA sample that produces only a single amplicon corresponding to the second amplicon described for the heterozygous genome can be diagnostic for the presence of transgenic corn event LP026-5 in the sample and was produced from a corn seed that is homozygous for the allele corresponding to the insert DNA present in transgenic corn plant LP026-5. It is noted that primer pairs for transgenic corn event LP026-5 are used to produce amplicons diagnostic for transgenic corn event LP026-5 genomic DNA in the described DNA amplification methods. These primer pairs include, but are not limited to, primers 11 and 12 (SEQ ID NO: 8 and 9), and primers 13 and 14 (SEQ ID NO: 10 and 11) for use in the described DNA amplification methods. In addition, a control primer 9 and 10 (SEQ ID NO: 28 and SEQ ID NO: 29) for amplification of a corn endogenous gene is included as an internal control for reaction conditions. Analysis of transgenic corn event LP026-5 DNA extraction samples should include a positive tissue DNA extraction control for transgenic corn event LP026-5, a negative DNA extraction control derived from a non-transgenic corn event LP026-5 and a negative control without template corn DNA extraction. In addition to these primer pairs, any primer pair from SEQ ID NO: 3 or SEQ ID NO: 4, or the complement thereof, can be used when they are used in a DNA amplification reaction to produce an amplicon comprising SEQ ID NO: 1 or SEQ ID NO: 2 diagnostic for tissue derived from transgenic event corn plant LP026-5, respectively. The DNA amplification conditions described in Tables 2-5 can be used to produce diagnostic amplicons for transgenic corn event LP026-5 using the appropriate primer pairs. Extracts putatively containing corn plant or seed DNA comprising transgenic corn event LP026-5, or products derived from transgenic corn event LP026-5, that when tested in a DNA amplification method produce an amplicon diagnostic for transgenic corn event LP026-5 can be used as template for amplification to determine the presence or absence of transgenic corn event LP026-5.
[0202] Example 4 Transgenic corn event LP026-5 detection by Southern blot hybridization
[0203] 4.1 DNA extraction for Southern blot hybridization
[0204] Southern blot analysis was performed using T4, T5 generation homozygous transformation events. Approximately 5 to 10 g of plant tissue was ground in liquid nitrogen using a mortar and pestle. The plant tissue was resuspended in 12.5 mL of extraction buffer A (0.2 M Tris pH = 8.0, 50 mM EDTA, 0.25 M NaCl, 0.1 % v / v beta-mercaptoethanol, 2.5 % w / v polyvinylpyrrolidone) and centrifuged at 4000 rpm for 10 minutes (2755 g). After discarding the supernatant, the pellet was resuspended in 2.5 mL of extraction buffer B (0.2 M Tris pH = 8.0, 50 mM EDTA, 0.5 M NaCl, 1 % v / v beta-mercaptoethanol, 2.5 % w / v polyvinylpyrrolidone, 3 % sarcosyl, 20 % ethanol) and incubated at 37 °C for 30 minutes. During the incubation, the sample was mixed once with a sterile loop. After the incubation, an equal volume of chloroform / isoamyl alcohol (24: 1) was added, mixed gently by inversion, and centrifuged at 4000 rpm for 20 minutes. The aqueous layer was collected and the DNA was precipitated by centrifugation at 4000 rpm for 5 minutes after the addition of 0.54 volumes of isopropanol. The supernatant was discarded and the DNA pellet was resuspended in 500 μL of TE. To degrade any RNA present, the DNA was incubated with 1 μL of 30 mg / mL RNAase A at 37 °C for 30 minutes, centrifuged at 4000 rpm for 5 minutes, and the DNA was precipitated by centrifugation at 14000 rpm for 10 minutes in the presence of 0.5 volumes of 7.5 M ammonium acetate and 0.54 volumes of isopropanol. After discarding the supernatant, the pellet was washed with 500 μL of 70 % ethanol by mass and dried before resuspension in 100 μL of TE.
[0205] 4.2 Restriction enzyme digestion
[0206] DNA concentration was quantitatively determined using a spectrophotometer or fluorometer (using 1 x TAE and GelRED dye). Five μg of DNA was digested per reaction in a 100 μL reaction. Genomic DNA was digested with restriction enzymes BamHI and HindIII for the Cry2Ab and EPSPS partial sequences on the T-DNA, respectively, and AvrII and HindIII for the CrylAb and CrylFa partial sequences on the T-DNA, respectively. Digests were incubated overnight at the appropriate temperature for each enzyme. The samples were spun to reduce the volume to 30 μL using a speed vacuum.
[0207] 4.3, Gel electrophoresis
[0208] Bromophenol blue loading dye was added to each sample from Example 4.2 and each sample was loaded onto a 0.7% agarose gel containing ethidium bromide and electrophoresed in TBE running buffer overnight at 20 volts.
[0209] The gel was washed in 0.25 M HCI for 15 minutes to depurinate the DNA and then washed with water. The Southern blot hybridization was set up as follows: 20 sheets of thick dry blotting paper were placed in a tray and 4 sheets of thin dry blotting paper were placed on top. One sheet of thin blotting paper was pre-wetted in 0.4 M NaOH and placed on top of the paper stack followed by one sheet of Hybond-N+ transfer membrane (Amersham Pharmacia Biotech, #RPN303B) pre-wetted in 0.4 M NaOH. The gel was placed on top, making sure there were no air bubbles between the gel and the membrane. Three more pre-soaked sheets of blotting paper were placed on top of the gel and the buffer tray was filled with 0.4 M NaOH. The gel stack was connected to the buffer tray with a lamp wick pre-soaked in 0.4 M NaOH to transfer the DNA to the membrane. The DNA transfer was carried out at room temperature for approximately 4 hours. After transfer, the Hybond membrane was rinsed in 2xSSC for 10 seconds and the DNA was cross-linked to the membrane by UV.
[0210] 4.4, Hybridization
[0211] PCR-amplified appropriate DNA sequences were used for probe preparation. The DNA probes were SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, and SEQ ID NO: 33, or a portion of the above sequences that is homologous or complementary. Twenty-five nanograms of probe DNA was boiled in 45 μL TE for 5 minutes, placed on ice for 7 minutes, and then transferred to a Rediprime II (Amersham Pharmacia Biotech, #RPN1633) tube. After adding 5 μl of32P-labeled dCTP to the Rediprime tube, the probe was incubated at 37°C for 15 minutes. The probe was purified by microcentrifugation through a G-50 column (Amersham Pharmacia Biotech, #27-5330-01) to remove unincorporated dNTPs, according to the manufacturer's instructions. Probe activity was measured using a scintillation counter. The Hybond membrane was prehybridized by wetting the membrane with 20 mL of prewarmed Church prehybridization solution (500 mM Na3P04, 1 mM EDTA, 7% SDS, 1% BSA) at 65°C for 30 minutes. The labeled probe was boiled for 5 minutes and placed on ice for 10 minutes. The prehybridization buffer was supplemented with the appropriate amount of probe (1 million counts per 1 mL of prehybridization buffer), and the hybridization was performed overnight at 65°C. The next day, the hybridization buffer was discarded, and the membrane was rinsed with 20 mL of Church rinse solution 1 (40 mM Na3P04, 1 mM EDTA, 5% SDS, 0.5% BSA) and washed in 150 mL of Church rinse solution 1 at 65°C for 20 minutes. The process was repeated twice with Church rinse solution 2 (40 mM Na3P04, 1 mM EDTA, 1% SDS). The membrane was exposed to phosphor screens or X-ray film to detect the location of probe binding.
[0212] Two control samples were included on each Southern: (1) DNA from a negative (untransformed) segregant, which was used to identify any endogenous corn sequences that could hybridize to the element-specific probes; (2) DNA from a positive segregant, in which Hindlll-digested pLP026 was introduced in an amount equivalent to one copy number based on probe length, to illustrate the sensitivity of the assay in detecting a single gene copy within the corn genome.
[0213] Hybridization data provide confirmatory evidence supporting TaqMan TMPCR analysis indicated that corn plant LP026-5 contained a single copy of the Cry2Ab, CrylFa, CrylAb and EPSPS genes. Using the Cry2Ab probe, BamHI and HindIII digestion produced single bands of approximately 10.4 kb and 7.1 kb, respectively; using the CrylFa probe, AvrII and HindIII digestion produced single bands of approximately 9.4 kb and 13.5 kb, respectively; using the CrylAb probe, AvrII and HindIII digestion produced single bands of approximately 8.1 kb and 13.5 kb, respectively; and using the EPSPS probe, BamHI and HindIII digestion produced single bands of approximately 4.6 kb and 13.5 kb, respectively. This indicated that one copy of each of CrylAb, Cry2Ab, CrylFa and EPSPS was present in corn transformation event LP026-5.
[0214] Example 5 Insect resistance test
[0215] 5.1 Bioassay of corn plant LP026-5
[0216] Transgenic corn event LP026-5 and wild type corn plants (non-transgenic, transformation recipient control (CK-)) were subjected to bioassay against Ostrinia furnacalis, Spodoptera frugiperda, Conogethes punctiferalis, Athetis lepigone, Mythimna seperata, Agrotis ypsilon, Helicoverpa armigera and Spodoptera exigua according to the following methods:
[0217] Fresh leaves (V3-V4 stage) of transgenic maize event LP026-5 and wild type maize plants (non-transgenic, transformation recipient control (CK-)) were washed with sterile water and the water on the leaves was absorbed with absorbent paper, then the maize leaves were removed of the veins and cut into about 1 cm x 3 cm long strips, 1-3 pieces of the cut long strips of leaves (depending on the amount of food consumed by the insects) were placed on filter paper at the bottom of a round plastic culture dish, the filter paper was moistened with distilled water, 10 artificially reared newly hatched larvae were introduced into each culture dish, the insect test culture dishes were covered and placed in a temperature of 26-28°C, relative humidity of 70%-80%, light cycle (light / dark) of 16:8 for 5 days, then the results were counted. The mortality rate was counted, the resistance level was identified by correcting the mortality rate (corrected mortality rate (%) = (1-survival number / number of insects introduced-wild type control mortality rate) / (1-wild type control mortality rate) x 100%), and the results are shown in Table 7 and Figure 3
[0218] Table 7, insect resistance bioassay results of transgenic maize event LP026-5 - mortality rate (%)
[0219]
[0220] 5.2, field insect resistance effect determination of transgenic maize event LP026-5
[0221] (1) corn borer
[0222] The resistance of transgenic maize event LP026-5 to the main target pest of Asian corn borer in the field was identified by live insect introduction method. Insect introduction was performed at the 4-6 leaf stage and silking stage (silk 3-5 cm) of corn, 50 insects were introduced at each time, and the interval between the two introductions was one week. After 14 days of insect introduction at the heart leaf stage, the feeding of Asian corn borer on the upper leaves of corn plants was investigated, and the leaf feeding grade of Asian corn borer was recorded. After insect introduction at the silking stage, the degree of damage to the female ear and the plant was investigated before harvesting, including the damaged length of the female ear, the number of bore holes, the length of the bore hole tunnel, the survival larval stage and the survival number. The resistance of transgenic maize event LP026-5 to Asian corn borer was evaluated by "Classification Standard for the Damage of Asian Corn Borer to Corn Heart Leaves" as an index, and the results are shown in Figure 4 and Table 12. The ear dissection was carried out at silking stage, and the results are shown in Table 13. The results showed that at the heart leaf stage, the average leaf feeding level of the transgenic corn event LP026-5 was significantly lower than that of the transformation receptor control (CK-); at the silking stage, the ear damage rate, larval survival number, tunnel length, and ear damage level of the transgenic corn event LP026-5 were all significantly lower than those of the transformation receptor control (CK-). Overall, at the heart leaf stage and the silking stage, the transgenic corn event LP026-5 had good resistance to the Asian corn borer.
[0223] Table 8, Classification standard for the damage degree of the Asian corn borer to the corn heart leaf
[0224] Leaf feeding level Description of symptoms 1 No damage on leaf, or only pinhead (≤1mm) holes on leaf 2 Only a few holes (≤5mm) on individual leaf 3 A few holes (≤5mm) on a few leaves 4 Notching (≤10mm) on individual leaf 5 Notching (≤10mm) on a few leaves 6 Notching (≤10mm) on part of leaves 7 Part of individual leaf eaten, notching (≤10mm) on a few leaves 8 A few leaves eaten, notching (≤10mm) on part of leaves 9 Most of leaves eaten
[0225] Table 9, Evaluation standard for the resistance of corn to the Asian corn borer
[0226] Average of leaf feeding level in heart leaf stage Resistance level 1.0-2.9 Highly resistant (HR) 3.1-4.9 Resistant (R) 5.0-6.9 Moderately resistant (MR) 7.0-8.9 Susceptible (S) 9.0 Highly susceptible (HS)
[0227] Table 10, Classification standard for the damage degree of the Asian corn borer to the corn ear
[0228]
[0229]
[0230] Table 11, Evaluation standard for the resistance of corn to the Asian corn borer at the ear stage
[0231] Average of ear damage level Resistance type 1-2.0 Highly resistant (HR) 2.1-3.0 Resistant (R) 3.1-5.0 Moderately resistant (MR) 5.1-7.0 Susceptible (S) ≥7.1 Highly susceptible (HS)
[0232] Table 12, Resistance results of the transgenic corn event LP026-5 to the Asian corn borer at the heart leaf stage
[0233] Item / plant LP026-5 CK- Average of leaf feeding level 1.3 8.6 Resistance level Highly resistant Highly susceptible
[0234] Table 13, Resistance results of the transgenic corn event LP026-5 to the Asian corn borer at the silking stage
[0235] Item / plant LP026-5 CK- Ear damage rate (%) 0 100 Survival number of larvae 0 14 Tunnel length (cm) 0 1.7 Ear damage level 0 6.4 Resistance level Highly resistant Susceptible
[0236] The results showed that the transgenic corn event LP026-5 had good resistance to the Asian corn borer at both the heart leaf stage and the silking stage; at the heart leaf stage, the average leaf feeding level of the transgenic corn event LP026-5 was significantly lower than that of the transformation receptor control. At the silking stage, the ear damage rate, larval survival number, tunnel length, and ear damage level of the transgenic corn event LP026-5 were all significantly lower than those of the transformation receptor control.
[0237] (2) Oriental armyworm
[0238] Artificial inoculation was carried out at the corn heart leaf stage (4-6 leaf stage), and a total of 2 times of inoculation was carried out, and 20 two-year-old oriental armyworms artificially bred were inoculated on each corn heart leaf. After 3 days of inoculation, the second inoculation was carried out, and the number of inoculation was the same as the first time. After 14 days of inoculation, the damage degree of corn leaves to oriental armyworm was investigated. According to the damage degree of corn leaves to oriental armyworm, the average value of the damage level of oriental armyworm to corn leaves in each plot was calculated, the judgment standard was shown in Table 14, and then the resistance level of corn to oriental armyworm was determined according to the standard of Table 15. The resistance results of transgenic corn event LP026-5 to oriental armyworm at the heart leaf stage were shown in Table 16. The results showed that the transgenic corn event LP026-5 had good resistance level to oriental armyworm, and the notch ratio and leaf damage level of the transgenic corn event LP026-5 were significantly lower than those of the transformation receptor control (CK-).
[0239] Table 14, Grading standard of corn leaf damage degree to oriental armyworm
[0240] Ear damage level Description of symptoms 1 No damage on leaf, or only pinhead (≤1mm) holes on leaf 2 Only a few holes (≤5mm) on individual leaf 3 A few holes (≤5mm) on a few leaves 4 Notching (≤10mm) on individual leaf 5 Notching (≤10mm) on a few leaves 6 Notching (≤10mm) on part of leaves 7 Part of individual leaf eaten, notching (≤10mm) on a few leaves 8 A few leaves eaten, notching (≤10mm) on part of leaves 9 Most of leaves eaten
[0241] Table 15, Evaluation standard of corn resistance to oriental armyworm
[0242] Average of ear damage level Resistance type 1.0-2.0 Highly resistant (HR) 2.1-4.0 Resistant (R) 4.1-6.0 Moderately resistant (MR) 6.1-8.0 Susceptible (S) 8.1-9.0 Highly susceptible (HS)
[0243] Table 16, Resistance results of transgenic corn event LP026-5 to oriental armyworm at the heart leaf stage
[0244] Item / plant LP026-5 CK- Average of leaf feeding level 1.5 7.8 Resistance level Highly resistant Susceptible
[0245] (3) Cotton bollworm
[0246] Artificial inoculation was carried out on the transgenic corn event LP026-5 at the corn spinning stage, and a total of 2 times of inoculation was carried out, and 20 newly hatched larvae artificially bred were inoculated in each corn silk, and after 3 days of inoculation, the second inoculation was carried out, and the number of inoculation was the same as the first time. After 14-21 days of inoculation, the female ear damage rate, the number of surviving larvae per female ear, and the female ear damage length were investigated. Generally, the investigation was started 14 days after inoculation, if the damage level of the negative control material (CK-) reached sensitive or high sensitive, it was considered effective, if it did not reach, the investigation could be appropriately delayed, but if it did not reach the corresponding level after 21 days of inoculation, the inoculation was considered invalid. According to the female ear damage rate, the number of surviving larvae, and the female ear damage length (cm), the average value of the damage level of corn ear stage cotton bollworm to female ear in each plot was calculated, the judgment standard was shown in Table 17, and then the resistance level of corn ear stage to cotton bollworm was determined according to the standard of Table 18. The resistance results of transgenic corn event LP026-5 to cotton bollworm at the spinning stage were shown in Table 19. Figure 5and Table 19. The results showed that the transgenic corn event LP026-5 had a high level of resistance to cotton bollworm, and the ear damage rate, larval survival number, ear damage length and ear damage level of the transgenic corn event LP026-5 were significantly lower than those of the transformation receptor control (CK-).
[0247] Table 17, Grading standard for the degree of corn ear damage by cotton bollworm
[0248] Ear damage level Description of symptoms 0 No damage on ear 1 Only filament damaged 2 1cm of ear tip damaged 3+ Corresponding damage level increased by 1 level for every 1cm of ear tip damaged …N
[0249] Table 18, Evaluation standard for corn ear resistance to cotton bollworm
[0250]
[0251]
[0252] Table 19, Resistance results of transgenic corn event LP026-5 to cotton bollworm at spinning stage
[0253] Item / plant LP026-5 CK- Ear damage rate (%) 0 100 Survival number of larvae 0 15 Tunnel length (cm) 0 2.4 Ear damage level 0 6.3 Resistance level Highly resistant Susceptible
[0254] (4) Peach borer
[0255] In July 2021, a field natural infestation test of peach borer was conducted in the transgenic corn planting base in Jianan District, Xuchang City, Henan Province. After 14-21 days of the initial occurrence of insect damage, and when the control (CK-) plants were mostly damaged by 4-5 instar old larvae, the damage rate of peach borer to corn plants was investigated on a plant-by-plant basis. The resistance results of transgenic corn event LP026-5 to peach borer are shown in Figure 6 and Table 20. The results showed that, under the natural occurrence conditions of peach borer, the damage rate of peach borer to transgenic corn event LP026-5 was significantly reduced compared with the control (CK-), indicating that transgenic corn event LP026-5 had a high resistance to peach borer.
[0256] Table 20, Resistance results of transgenic corn event LP026-5 to peach borer under natural infestation conditions
[0257] Item / plant LP026-5 CK- Damage rate (%) 0 75
[0258] (5) Beet armyworm
[0259] In March 2021, a field natural infestation test of beet armyworm was conducted in the transgenic corn planting base in Yizhou District, Sanya City, Hainan Province. After 10-15 days of the initial occurrence of insect damage, and when the control (CK-) plants were mostly damaged by 4-6 instar old larvae, the damage rate of beet armyworm to corn plants was investigated on a plant-by-plant basis. The resistance results of transgenic corn event LP026-5 to beet armyworm are shown in Figure 7and Table 21. The results show that, under the natural occurrence of beet armyworm, the damage rate of beet armyworm to transgenic corn event LP026-5 is significantly reduced compared with the control (CK-), thereby indicating that the transgenic corn event LP026-5 has high resistance to beet armyworm.
[0260] Table 21, Resistance of transgenic corn event LP026-5 to beet armyworm under natural insect exposure conditions
[0261]
[0262]
[0263] (6) Spodoptera exigua
[0264] In March 2021, a field natural insect exposure test of Spodoptera exigua was conducted in a transgenic corn planting base in Yizhou District, Sanya City, Hainan Province. After 10-15 days of initial insect damage and when the control (CK-) was mostly damaged by 4-6 age old larvae, the damage rate of Spodoptera exigua to corn plants was investigated on a per plant basis. The resistance of transgenic corn event LP026-5 to Spodoptera exigua is shown in Table 22, and the field resistance effect is shown in Figure 8 The results show that, under the natural occurrence of Spodoptera exigua, the damage rate of Spodoptera exigua to transgenic corn event LP026-5 is significantly reduced compared with the control (CK-), thereby indicating that the transgenic corn event LP026-5 has high resistance to Spodoptera exigua.
[0265] Table 22, Resistance of transgenic corn event LP026-5 to Spodoptera exigua under natural insect exposure conditions
[0266] Item / plant LP026-5 CK- Damage rate (%) 0 100
[0267] Example 6 Herbicide tolerance detection of corn transformation event
[0268] In this test, Nongda herbicide (41% glyphosate isopropylammonium salt aqueous solution) was used for spraying. Randomized block design was used with 3 replicates. The plot area was 15 m 2(5m x 3m), row spacing 60cm, plant spacing 25cm, normal cultivation management, and 1m wide isolation belt between plots. The transgenic corn event LP026-5 was treated as follows: 1) no spraying; 2) spraying Roundup herbicide at a dose of 1680 ga.e. / ha at V3 leaf stage, and then spraying Roundup herbicide at the same dose at V8 stage. It should be noted that the different contents and formulations of glyphosate herbicide are converted into the same amount of glyphosate acid, which is applicable to the following conclusions. The phytotoxicity symptoms were investigated at 1 week and 2 weeks after spraying, and the yield of the plot was determined at harvest. The phytotoxicity symptom classification is shown in Table 23. The herbicide injury rate was used as an evaluation index to evaluate the herbicide tolerance of the transformed event, specifically, the herbicide injury rate (%) =∑(number of plants with the same level of injury x level number) / (total number of plants x highest level); wherein the herbicide injury rate refers to the glyphosate injury rate, which is determined according to the phytotoxicity investigation results 2 weeks after glyphosate treatment. The corn yield of each plot is the total weight of the corn kernels in the middle 3 rows of each plot, and the yield difference between different treatments is measured in the form of yield percentage, yield percentage (%) = sprayed yield / unsprayed yield. The results of herbicide tolerance and corn yield of transgenic corn event LP026-5 are shown in Table 24. Figure 9 and Table 24.
[0269] Table 23, Classification Standard for Glyphosate Herbicide Phytotoxicity to Corn
[0270]
[0271]
[0272] Table 24, Results of Glyphosate Herbicide Tolerance and Corn Yield of Transgenic Corn Event LP026-5
[0273] Item / plant LP026-5 CK- Glyphosate damage rate (%) (spraying water) 0 0 Glyphosate damage rate (%) (Nongda 800ml / acre, recommended concentration 150-250ml / acre) 0 100 Yield percentage (%) (Nongda 800ml / acre, recommended concentration 150-250ml / acre) 100 0
[0274] The results show that in terms of herbicide (glyphosate) injury rate: 1) the transgenic corn event LP026-5 has an injury rate of substantially 0 under glyphosate herbicide (800 ml / acre) treatment, and thus the transgenic corn event LP026-5 has good glyphosate herbicide tolerance.
[0275] In terms of yield: there is no significant difference in yield between the transgenic corn event LP026-5 under no spraying and spraying 800 ml / acre glyphosate treatment, and the yield of the transgenic corn event LP026-5 is substantially not reduced after spraying glyphosate herbicide, and thus it is further indicated that the transgenic corn event LP026-5 has good glyphosate herbicide tolerance.
[0276] In summary, by TaqMan TMThe presence of the crylAb, cry2Ab, crylFa, and epsps genes in the regenerated transgenic maize plants was detected by analysis (see Example 2) and the copy number of the insect resistance and glyphosate herbicide tolerance lines was characterized. Based on the copy number of the genes of interest, good insect resistance, glyphosate herbicide tolerance, and agronomic performance (see Examples 5 and 6), event LP026-5 was selected by screening as superior having a single copy of the transgenes, good insect resistance, glyphosate herbicide tolerance, and agronomic performance (Examples 5 and 6).
[0277] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present application and are not limiting. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or equivalently replaced without departing from the spirit and scope of the technical solutions of the present application.
Claims
1. A nucleic acid molecule of genetically modified maize event LP026-5, characterized in that, The nucleic acid molecule comprises the sequence shown in SEQ ID NO:5 or its complementary sequence, and the nucleic acid molecule is derived from a transgenic plant, seed or cell containing transgenic maize event LP026-5, and the maize seed containing the event has been deposited with accession number CCTCC NO:P202210.
2. A DNA primer pair comprising a first primer and a second primer, characterized in that, When the first primer and the second primer are used together with DNA containing the transgenic maize event LP026-5 in an amplification reaction, an amplicon for detecting the transgenic maize event LP026-5 in the sample is generated. The first primer is selected from SEQ ID NO:8 or SEQ ID NO:12, and the second primer is selected from SEQ ID NO:9 or SEQ ID NO:13; or the first primer is selected from SEQ ID NO:10 or SEQ ID NO:15, and the second primer is selected from SEQ ID NO:11 or SEQ ID NO:14, and the maize seeds containing the event have been deposited with accession number CCTCC NO:P202210.
3. A method for detecting the presence of DNA from the transgenic maize event LP026-5 in a sample, characterized in that, include: (1) The sample to be tested is brought into contact with the DNA primer pair described in claim 2 during a nucleic acid amplification reaction; (2) Perform nucleic acid amplification reaction; (3) Detect the presence of amplification products; The sequence of the amplified product includes any one of the sequences SEQ ID NO:1-4 or their complementary sequences, which indicates that the test sample contains DNA of the transgenic maize event LP026-5. The DNA contains the sequence shown in SEQ ID NO:5 or its complementary sequence. The maize seeds containing the event have been deposited with the accession number CCTCC NO:P202210.
4. A DNA detection kit, characterized in that, include: The DNA primer pair as described in claim 2.
5. A method for protecting corn plants from insect infestation, characterized in that, The invention includes providing at least one transgenic maize plant cell containing the nucleic acid molecule of the transgenic maize event LP026-5 as described in claim 1 to the diet of the target insect; the target insect that feeds on the transgenic maize plant cell is inhibited from further feeding on the maize plant, the maize seeds containing the event have been deposited with accession number CCTCC NO: P202210, and the insect is a lepidopteran insect.
6. A method for protecting corn plants from damage caused by herbicides, characterized in that, Planting at least one transgenic maize plant containing the nucleic acid molecule of transgenic maize event LP026-5 as described in claim 1, applying an effective dose of glyphosate herbicide, wherein the maize seeds containing said event have been deposited with accession number CCTCC NO: P202210, and said herbicide is glyphosate.
7. A method for controlling weeds in fields where corn is planted, characterized in that, This includes applying an effective dose of glyphosate herbicide to a field in which at least one transgenic maize plant is planted, the transgenic maize plant containing the nucleic acid molecule of the transgenic maize event LP026-5 as described in claim 1, and the maize seeds containing the event have been deposited with accession number CCTCC NO: P202210.
8. A method for cultivating maize plants that are resistant to insects and / or tolerant to glyphosate herbicides, characterized in that, include: Plant at least one maize seed containing the nucleic acid molecule of the transgenic maize event LP026-5 as described in claim 1; The corn seeds are allowed to grow and develop into corn plants; the corn plants are attacked with target insects and / or sprayed with an effective dose of glyphosate herbicide; plants with reduced plant damage compared to other plants that do not have the transgenic corn event LP026-5 are harvested; the corn seeds containing the event have been deposited with the accession number CCTCC NO: P202210; the insects are lepidopteran insects.
Citation Information
Patent Citations
Nucleic acid sequence and detection methods for detecting corn plant DBN9501
CN109868273A
Transgenic maize event LP007-4 and detection method thereof
CN112831585A