Avian adenovirus disease quadrivalent chimeric virus-like particles and preparation method and application thereof

Abstract

The tetravalent chimeric virus-like particles for avian adenovirus disease and the preparation method and application thereof belong to the field of research and development of new multivalent viral vaccines. The chimeric virus-like particles use the matrix protein M of the Newcastle disease virus NA-1 strain as the skeleton, and the Fiber-2 protein of the serotype 4 avian adenovirus of group I and the Fiber protein of the serotype 8a, 8b, and 11 avian adenovirus of group I are respectively embedded on the surface of the Newcastle disease virus-like particle carrier NDVVLPs to obtain the tetravalent chimeric virus-like particles for avian adenovirus disease. The chimeric virus-like particles have comprehensive adenovirus protection, and one immunization can prevent two types of poultry diseases. The number of vaccine immunizations is reduced, and it can protect four serotypes of group I avian adenoviruses. One shot can provide multiple protections, simplify the vaccine immunization procedure, reduce costs and increase efficiency, and have good immunogenicity. It is beneficial to help the poultry farming industry prevent and control avian adenovirus types 4, 8a, 8b, and 11, consolidate the inherent immune system of chickens, and conform to modern farming concepts.

Description

Technical Field

[0001] The present invention belongs to the technical field of research and development of novel multivalent viral vaccines, and specifically relates to a tetravalent chimeric virus-like particle of avian adenovirus disease and a preparation method and application thereof. Background Art

[0002] Fowl adenovirus group I (FAV-I) is susceptible to all ages and all kinds of poultry, resulting in decreased production performance and varying degrees of death, causing huge economic losses to the poultry industry. According to group-specific antigens, FAV-I can be divided into 5 species, A, B, C, D and E, with 12 serotypes. C (serotype 4) avian adenovirus is in a dominant epidemic position, mainly causing hydropericardium syndrome; the isolation rate of E (serotypes 8a and 8b) avian adenovirus strains is increasing, mainly causing inclusion body liver; at the same time, the isolation of D (serotype 11) avian adenovirus strains has also been reported from time to time. With the emergence of more serotypes, avian adenovirus disease is generally prevalent in the form of new animal infectious diseases.

[0003] The approved triple inactivated vaccine for Newcastle disease, avian influenza (H9 subtype), and avian adenovirus disease (group I serotype 4 avian adenovirus) (La Sota strain + YBF13 strain + YBAV-4 strain) is the first avian adenovirus disease vaccine in my country, but the single-genotype inactivated vaccine cannot meet the current prevention and control of multi-genotype avian adenovirus disease. Therefore, it is urgent to develop a new multi-component and multi-valent vaccine that matches the current epidemic strains, is green, safe, and can "protect multiple diseases with one shot". The fiber protein Fiber-2 of group I serotype 4 avian adenovirus (Fowladenovirus serotype-4, FAdV-4), the fiber protein Fiber of group I serotype 8 avian adenovirus (Fowladenovirus serotype-8, FAdV-8), and the fiber protein Fiber of group I serotype 11 avian adenovirus (Fowl adenovirus serotype-11, FAdV-11) are all receptors for avian adenovirus to connect to cells, which determines the changes in virulence and is also the main protective antigen protein. A large number of domestic and foreign studies have shown that Fiber-2 protein (F4 type) and Fiber protein (F8a type, F8b type, F11 type) have the potential to become subunit vaccines for preventing FAdV-4, FAdV-8, and FAdV-11, but how to improve their immunogenicity, especially the ability to induce cellular immune responses, is crucial to preventing intracellular replicating viral diseases.

[0004] Virus-like particles (VLPs) are virus-derived structures composed of one or more different molecules with self-assembly ability. They have self-assembly ability, are similar in structure and size to viruses, have no genetic material, and cannot infect host cells. The expression and self-assembly of viral structural proteins can be completed in various live or cell-free expression systems, and the viral structure can be assembled and reconstructed. VLPs are highly immunogenic and can induce antibody and cell-mediated immune responses in a way different from that induced by traditional inactivated virus vaccines. Safety, pollution-free, and protecting the breeding ecological environment are the trends in the international development of new vaccines. Newcastle disease virus-like particles (NDV VLPs) are hollow protein particles assembled with the matrix protein M of the Newcastle disease virus NA-1 strain as the skeleton. Summary of the invention

[0005] In view of the fact that the existing single-genotype inactivated vaccine cannot meet the current prevention and control of multi-genotype avian adenovirus disease, the present invention provides a tetravalent chimeric virus-like particle for avian adenovirus disease and a preparation method and application thereof.

[0006] The technical solution adopted by the present invention to solve the technical problem is as follows:

[0007] The tetravalent chimeric virus-like particles for avian adenovirus disease of the present invention use the matrix protein M of the Newcastle disease virus NA-1 strain as a skeleton, and respectively embed the fiber-2 protein of group I serotype 4 avian adenovirus, the fiber protein of group I serotype 8a avian adenovirus, the fiber protein of group I serotype 8b avian adenovirus, and the fiber protein of group I serotype 11 avian adenovirus on the surface of the Newcastle disease virus-like particle carrier NDVVLPs to obtain the tetravalent chimeric virus-like particles for avian adenovirus disease, which are named FAdV4-8a-8b-11cVLPs.

[0008] As a preferred embodiment, the Fiber-2 protein of group I serotype 4 fowl adenovirus is embedded in the surface of the Newcastle disease virus-like particle vector NDV VLPs by using an extracellular domain replacement strategy, that is, the F protein extracellular domain and the avian paramyxovirus 1HN protein extracellular domain of the Newcastle disease virus-like particle vector NDV VLPs are replaced with the Fiber-2 protein extracellular domain of group I serotype 4 fowl adenovirus, and the two are connected by overlap PCR; the Fiber protein of group I serotype 8a fowl adenovirus, the Fiber protein of group I serotype 8b fowl adenovirus, and the Fiber protein of group I serotype 11 fowl adenovirus are all embedded in the surface of the Newcastle disease virus-like particle vector NDV VLPs by using a GPI anchoring strategy.

[0009] The method for preparing the tetravalent chimeric virus-like particles of avian adenovirus disease of the present invention comprises the following steps:

[0010] Step 1: Optimization and synthesis of target gene;

[0011] Step 2: Construction of recombinant shuttle plasmid;

[0012] Step 3: Construction of recombinant bacmid;

[0013] Step 4: Rescue of recombinant baculovirus;

[0014] Step 5. Preparation and purification of avian adenovirus disease tetravalent chimeric virus-like particles.

[0015] As a preferred implementation, the specific operation steps of step one are as follows:

[0016] The M gene sequence of genotype VII Newcastle disease virus, the Fiber-2 gene sequence of group I serotype 4 fowl adenovirus HB 1510 strain, the Fiber gene sequence of group I serotype 8a fowl adenovirus TR-59 strain, the Fiber gene sequence of group I serotype 8b fowl adenovirus 764 strains, and the Fiber gene sequence of group I serotype 11 fowl adenovirus 380 strains were optimized respectively. The optimized M gene sequence, F4 gene sequence, F8a gene sequence, F8b gene sequence, and F11 gene sequence are shown in SEQ ID NO.1-SEQ ID NO.5, respectively.

[0017] As a preferred implementation, the specific operation steps of step 2 are as follows:

[0018] According to the optimized M gene sequence, F4 gene sequence, F8a gene sequence, F8b gene sequence, F11 gene sequence and pFastbac-1 vector information, pFastbac-GPI vector information, target gene specific primers and M13 universal identification primers were designed, gene amplification was performed by PCR, and the PCR products were identified as correct by agarose gel electrophoresis. Then, each synthesized plasmid was double-digested, and the target fragment was recovered using a DNA gel recovery kit. The recovered M gene and F4 gene were ligated to the pFastbac1 vector, and the recovered F8a gene, F8b gene, and F11 gene were respectively ligated to the pFastbac1-GPI vector, and transformed into DMT competent cells for PCR and double-digestion screening to obtain recombinant shuttle plasmids pFastbacl-M, pFastbac1-FcF4, pFastbac1-GPI-F8a, pFastbac1-GPI-F8b, and pFastbac1-GPI-F11.

[0019] As a preferred implementation, the specific operation steps of step three are as follows:

[0020] The constructed recombinant shuttle plasmids were transformed into Escherichia coli DH10 Bac competent cells for homologous recombination, plated on triple antibody solid selection plates for culture, single white colonies were picked, and PCR identification was performed using target gene-specific primers and M13 universal identification primers. The correctly identified positive bacterial liquid plasmids were plated again on triple antibody solid selection plates, and screening was repeated until the positive rate was 100%, and recombinant bacmids rBacmid-M, rBacmid-FcF4, rBacmid-GPI-F8a, rBacmid-GPI-F8b, and rBacmid-GPI-F11 were obtained.

[0021] As a preferred implementation, the specific operation steps of step 4 are as follows:

[0022] Liposome-mediated transfection was used to transfect the constructed recombinant bacmids into the insect baculovirus expression system respectively. The supernatant was collected after three blind suspension passages, and the viral genome was extracted. PCR identification was performed using target gene-specific primers and M13 universal identification primers to obtain recombinant baculoviruses rBV-M, rBV-FcF4, rBV-GPI-F8a, rBV-GPI-F8b, and rBV-GPI-F11.

[0023] As a preferred implementation, the specific operation steps of step five are as follows:

[0024] The constructed recombinant baculoviruses rBV-M, rBV-FcF4, rBV-GPI-F8a, rBV-GPI-F8b, and rBV-GPI-F11 were inoculated into the insect baculovirus expression system at an MOI of 1 for culture; 72h-96h after infection, the supernatant was collected and purified by sucrose density gradient ultracentrifugation to obtain avian adenovirus disease tetravalent chimeric virus-like particles FAdV4-8a-8b-11cVLPs.

[0025] The invention discloses an application of the tetravalent chimeric virus-like particle for avian adenovirus disease in the preparation of a tetravalent chimeric virus-like particle vaccine for avian adenovirus disease.

[0026] As a preferred embodiment, the tetravalent chimeric virus-like particle vaccine for avian adenovirus disease is used to prevent group I serotype 4 avian adenovirus, group I serotype 8a avian adenovirus, group I serotype 8b avian adenovirus and group I serotype 11 avian adenovirus.

[0027] The beneficial effects of the present invention are:

[0028] The present invention provides a tetravalent chimeric virus-like particle for avian adenovirus disease and a preparation method and application thereof, aiming at the fact that the existing single-genotype inactivated vaccine cannot meet the current prevention and control form of multi-genotype avian adenovirus disease. The present invention utilizes advanced molecular biological technologies such as insect baculovirus expression system, virus reverse genetics operation system, extracellular domain replacement strategy, GPI anchoring strategy, target gene screening and identification and chimeric strategy, and the carrier effect of Newcastle disease virus-like particle carrier NDV VLPs, and displays the information of Fiber-2 protein (F4) of group I serotype 4 avian adenovirus, Fiber protein (F8a) of group I serotype 8a avian adenovirus, Fiber protein (F8b) of group I serotype 8b avian adenovirus, and Fiber protein (F11) of group I serotype 11 avian adenovirus on the surface of Newcastle disease virus-like particle carrier NDV VLPs, so as to improve the immunogenicity of F4, F8a, F8b and F11, especially the ability to induce cellular immune response.

[0029] The tetravalent chimeric virus-like particles FAdV4-8a-8b-11cVLPs for avian adenovirus disease prepared by the present invention have comprehensive adenovirus protection. One immunization of the tetravalent chimeric virus-like particles for avian adenovirus disease can prevent two types of poultry diseases, reduce the number of vaccine immunizations, and protect four serotypes of avian adenovirus in group I (type 4, type 8a, type 8b, and type 11) at the same time. One shot can prevent multiple diseases, simplify the vaccine immunization procedure, reduce costs and increase efficiency, and help the poultry farming industry prevent and control type 4, type 8a, type 8b, and type 11 avian adenoviruses, consolidate the inherent immune system of chickens, conform to modern farming concepts, and can be suspended and cultured on a large scale and mass-produced. At the same time, the tetravalent chimeric virus-like particles FAdV4-8a-8b-11cVLPs for avian adenovirus disease prepared by the present invention have good immunogenicity, do not contain viral nucleic acids, are safe, green, and efficient, and have a high degree of matching between the vaccine seed virus and the epidemic strain. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The results of double restriction enzyme digestion of the recombinant shuttle plasmid. M: Plus DNA Marker; (a) pFastbac1-M plasmid double enzyme digestion results; (b) pFastbac1-FcF4 plasmid double enzyme digestion results; (c) pFastb ac1-GPI-F8a plasmid double enzyme digestion results; (d) pFastbac1-GPI-F8b plasmid double enzyme digestion results; (e) pF astbac1-GPI-F11 plasmid double enzyme digestion results.

[0031] Figure 2 The PCR amplification results of the specific primers for the recombinant baculovirus genome and the M13 universal identification primer. Plus DNA Marker; (a) PCR amplification results of recombinant baculovirus rBV-M, lane 1 is the fragment amplified by M gene specific primers with a length of about 1100 bp, and lane 2 is the fragment amplified by M13 universal identification primers with a length of about 3600 bp; (b) PCR amplification results of recombinant baculovirus rBV-FcF4, lane 1 is the fragment amplified by FcF4 gene specific primers with a length of about 2000 bp, and lane 2 is the fragment amplified by M13 universal identification primers with a length of about 4500 bp; (c) PCR amplification results of recombinant baculovirus rBV-GPI-F8a, lane 1 is the fragment amplified by GPI-F8a gene specific primers with a length of about 1850 bp, and lane 2 is the fragment amplified by M13 universal identification primers with a length of about 4350 bp; (d) PCR amplification results: Lane 1 is the fragment amplified by the GPI-F8b gene specific primers with a length of approximately 1850 bp, and Lane 2 is the fragment amplified by the M13 universal identification primers with a length of approximately 4350 bp; (e) PCR amplification results of the recombinant baculovirus rBV-GPI-F11: Lane 1 is the fragment amplified by the GPI-F8b gene specific primers with a length of approximately 1900 bp, and Lane 2 is the fragment amplified by the M13 universal identification primers with a length of approximately 4400 bp.

[0032] Figure 3 The immunoblotting results of the recombinant baculovirus-expressed proteins of the avian adenovirus disease tetravalent chimeric virus-like particles FAdV4-8a-8b-11cVLPs are shown in Figure 1. (a) M protein band; (b) FcF4 protein band; (c) F8a-GPI protein band; (d) F8b-GPI protein band; (e) F811-GPI protein band.

[0033] Figure 4 This is a transmission electron micrograph of the avian adenovirus disease tetravalent chimeric virus-like particles FAdV4-8a-8b-11cVLPs.

[0034] Figure 5 This is a graph monitoring the antibody titer after immunization with the avian adenovirus disease tetravalent chimeric virus-like particles FAdV4-8a-8b-11cVLPs. DETAILED DESCRIPTION

[0035] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0036] Before introducing the specific embodiments, some experimental principles, biological materials and experimental equipment involved in the following embodiments are briefly described as follows.

[0037] Biological samples: E. coli DH10bac competent cells, sf9 insect cells, pFastbac1 vector and pFastbac1-GPI vector were all frozen by the Preventive Veterinary Infectious Disease Laboratory of Jilin University; SPF chicken embryos were purchased from Harbin Veterinary Research Institute; DMT competent cells were purchased from Beijing Quanshijin Biotechnology Co., Ltd.

[0038] Experimental reagents: -Seamless cloning kit, DNA Marker, Easy II protein quantification kit were purchased from Beijing Quanshijin Biotechnology Co., Ltd.; protein marker was purchased from Thermo Fisher Scientific; DNA purification and recovery kit and plasmid extraction kit were purchased from Tiangen Biochemical Technology Co., Ltd.; BeyoECL Plus was purchased from Biyuntian Biotechnology; mouse anti-His tag antibody and HRP-labeled goat anti-mouse IgG (H+L) were purchased from im munoway; Sf-900 TM II insect cell culture medium was purchased from Gibco; BacPAK baculovirus titer determination kit was purchased from Bao Biotechnology Co., Ltd.; X-treme GENE HPDNA transfection reagent was purchased from Roche.

[0039] Experimental equipment: -40℃ refrigerator was purchased from Shanghai Lishen Scientific Instrument Co., Ltd.; gel imaging system and chemiluminescence imager were purchased from Shanghai Tianneng Life Science Co., Ltd.; electric constant temperature water bath was purchased from Shanghai Yiheng Scientific Instrument Co., Ltd.; cell culture incubator and refrigerated high-speed centrifuge were purchased from Thermo Fisher Scientific, USA; protein electrophoresis instrument and membrane transfer instrument were purchased from BioRed, USA; and microplate reader was purchased from BioTek, USA.

[0040] Example 1 Optimization and synthesis of target genes

[0041] According to the sequence of the genotype VII Newcastle disease virus M gene (GenBank No.: DQ659677) published in GenBank, the sequence of the Fiber-2 gene (named as the F4 gene) of the group I serotype 4 avian adenovirus HB 1510 strain (GenBank No.: KU587519.1), the sequence of the Fiber gene (named as the F8a gene) of the group I serotype 8a avian adenovirus TR-59 strain (GenBank No.: KT862810), the sequence of the Fiber gene (named as the F8b gene) of the group I serotype 8b avian adenovirus 764 strain (GenBank No.: KT862811), the sequence of the Fiber gene (named as the F11 gene) of the group I serotype 11 avian adenovirus 380 strain (GenBank No.: KT862812) and the insect cell codon preference, the target gene was optimized and artificially synthesized; the optimized M gene sequence information is shown in SEQ ID NO.1, and the optimized F4 gene sequence information is shown in SEQ ID NO. The optimized F8a gene sequence information is shown in SEQ ID NO.3, the optimized F8b gene sequence information is shown in SEQ ID NO.4, and the optimized F11 gene sequence information is shown in SEQ ID NO.5; the optimized gene sequences were synthesized by Shanghai Sangon Biotechnology (Shanghai) Co., Ltd.

[0042] Example 2 Construction of recombinant shuttle plasmid

[0043] (1) Primer design

[0044] According to the optimized M gene sequence (SEQ ID NO.1), the optimized F4 gene sequence (SEQ ID NO.2), the optimized F8a gene sequence (SEQ ID NO.3), the optimized F8b gene sequence (SEQ ID NO.4) and the optimized F11 gene sequence (SEQ ID NO.5) as well as the pFastbac-1 vector information and the pFastbac-GPI vector information, and referring to -Design target gene-specific primers according to the instructions of the seamless cloning kit, and design M13 universal identification primers.

[0045] The M gene-specific primer sequences are:

[0046] M-EcoR IF: 5'-CCGAAGCGCGCGGAATTCGCCACCATGGATTCTTCTCGTA-3',

[0047] M-Kpn IR: 5'-TACTTCTCGACAAGCTTGGTACCTTACTTGCGGAATGGGT-3';

[0048] The FcF4 gene-specific primer sequences are:

[0049] F4-BamH IF: 5'-ACCATCGGGCGCGGATCCGCCACCATGGACC-3',

[0050] F4-Kpn IR: 5'-CTTCTCGACAAGCTTGGTACCTTAGGGGACACTCGCA-3';

[0051] The GPI-F8a gene-specific primer sequences are:

[0052] F8a-Sal IF: 5'-GCTGCCTTTATTTGGGGTACCGCTCACGTCAGCTG-3', F8a-Kpn IR: 5'-TGCCTTTATTTGGGGTACCGCTCACGTCAGCTGTT-3';

[0053] The GPI-F8b gene-specific primer sequences are:

[0054] F8b-Sal IF: 5'-GGCAAGGGCTCTGTCGACATGGCTACTTCAACCCCTC-3',

[0055] F8b-Kpn IR: 5'-CTGCCTTTATTTGGGGTACCAGGAGCGTTAGCCGT-3';

[0056] The GPI-F11 gene-specific primer sequences are:

[0057] F11-Sal IF: 5'-AGGGCAAGGGCTCTGTCGACATGGCTAAGAGC-3',

[0058] F11-Kpn IR: 5'-GCTGCCTTTATTTGGGGTACCCGTTGGCCTGG-3'.

[0059] The sequence of the M13 universal identification primer is:

[0060] M13-F: 5'-GTTTTCCCAGTCACGAC-3',

[0061] M13-R: 5'-CAGGAAACAGCTATGAC-3'.

[0062] (2) Gene amplification and purification

[0063] Gene amplification was performed using PCR, and the PCR reaction procedure was as follows: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 45 seconds, annealing at 65°C for 45 seconds, and extension at 72°C for 1 minute, for a total of 35 cycles; and extension at 72°C for another 10 minutes. After the PCR was completed, the PCR product was identified by agarose gel electrophoresis, and the target fragment was recovered and purified.

[0064] (3) Construction of recombinant shuttle plasmid

[0065] The plasmids containing each gene identified correctly in step (2), the pFastbac1 vector plasmid and the pFastbac1-GPI vector plasmid were double-digested respectively. Specifically, the plasmid containing the optimized M gene sequence was double-digested with EcoR I and Kpn I, the plasmid containing the optimized F4 gene sequence was double-digested with BamH I and Kp n I, the plasmid containing the optimized F8a gene sequence was double-digested with Kpn I and Kpn I, the plasmid containing the optimized F8b gene sequence was double-digested with Kpn I and Kpn I, and the plasmid containing the optimized F11 gene sequence was double-digested with Kpn I and Kpn I; the pFastbac1 vector was double-digested with EcoR I and Kp n I, BamH I and Kpn I, and the pFastbac1-GPI vector was double-digested with Kpn I and Kpn I. The enzyme digestion system was: 25 μL of plasmid, ddH 2 O 15μL, enzyme 2μL each, buffer 6μL, at 37 ℃ enzyme digestion for 90 minutes after agarose gel electrophoresis, using DNA gel recovery kit to recover M gene, F4 gene, F8a gene, F8b gene and F11 gene.

[0066] The recovered M gene was connected to the pFastbac1 vector double-digested with EcoR I and Kpn I using a seamless cloning kit (obtaining pFastbacl-M plasmid), the recovered F4 gene was connected to the pFastbac1 vector double-digested with BamH I and Kpn I using a seamless cloning kit (obtaining pFastbac1-F cF4 plasmid), and the recovered F8a gene, F8b gene and F11 gene were respectively connected to the pFastbac1-GPI vector double-digested with Kpn I and Kpn I using a seamless cloning kit (obtaining pFastbac1-GPI-F8a plasmid, pFastbac1-GPI-F8b plasmid and pFastbac1-GPI-F11 plasmid, respectively). The connection system is: 1μL of vector, 4μL of target gene, 5μL of 2×Assembly Mix, react at 50℃ for 15min, then transform into DMT competent cells, plate on Amp selection plate, incubate at 37℃ for 24h, pick single colonies for PCR identification. The PCR reaction procedure is: pre-denaturation at 94℃ for 5 minutes; denaturation at 94℃ for 45 seconds, annealing at 65℃ for 45 seconds, extension at 72℃ for 1 minute, a total of 30 cycles; extension at 72℃ for another 10 minutes; extract and identify the correct positive bacterial liquid plasmid, and use double enzyme digestion for identification.

[0067] The identification results are as follows Figure 1 As shown, through Figure 1 As shown in a, after double restriction digestion of pFastbacl-M plasmid, the size of the obtained pFastbac1 vector fragment is about 4700 bp, and the size of the obtained optimized M gene sequence fragment is about 1100 bp; Figure 1 As shown in Figure b, after double restriction digestion of the pFastbac1-FcF4 plasmid, the size of the obtained pFastbac1 vector fragment is about 4700 bp, and the size of the obtained FcF4 gene fragment is about 2000 bp; Figure 1 As shown in Figure c, the pFastbac1-GPI-F8a plasmid was double-digested, and the resulting pFastbac1 vector fragment was about 4700 bp in size, and the resulting GPI-F8a gene fragment was about 1850 bp in size; Figure 1 As shown in Figure d, the obtained pFastbac1-GPI-F8b plasmid was double-digested, and the obtained pFastbac1 vector fragment size was about 4700 bp, and the GPI-F8b gene fragment size was about 1850 bp; Figure 1As shown in Figure e, the size of the obtained pFastbac1 vector fragment is about 4700 bp, and the size of the obtained GPI-F11 gene fragment is about 1900 bp. The results are consistent with the theoretical values, indicating that the recombinant shuttle plasmids pFastbacl-M, pFastbac1-FcF4, pFastbac1-GPI-F8a, pFastbac1-GPI-F8b and pFastba c1-GPI-F11 were successfully constructed.

[0068] Example 3 Construction of recombinant baculovirus

[0069] (1) Construction of recombinant bacmid

[0070] Each recombinant shuttle plasmid constructed in Example 2 was transformed into Escherichia coli DH10 Bac competent cells for homologous recombination, and after heat shock at 42°C for 90s, 0.5mL of liquid LB medium without antibiotics was added, and the cells were placed in a 30°C shaker for 3h, and plated on a three-antibody solid selection plate (100μg / mL X-gal, 40μg / mL IPTG, 20μg / mL TET, 30μg / mL GM, 100μg / mL Kan), and cultured at 37°C for 24h. White single colonies were picked and PCR identified using the target gene-specific primers designed in Example 1 and the M13 universal identification primers. The PCR reaction program was: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 45 seconds, annealing at 55°C for 45 seconds, and extension at 72°C for 150 seconds, for a total of 30 cycles; and extension at 72°C for another 10 minutes. The correctly identified positive bacterial liquid plasmid was re-plated on a triple antibody solid selection plate (100 μg / mL X-gal, 40 μg / mL IPTG, 20 μg / mL TET, 30 μg / mL GM, 100 μg / mL Kan) and screened repeatedly until the positive rate was 100%. Finally, recombinant bacmids rBacmid-M, rBacmid-FcF4, rBacmid-GPI-F8a, rBacmid-GPI-F8b, and rBacmid-GPI-F11 were obtained.

[0071] (2) Rescue of recombinant baculovirus

[0072] Referring to the instruction manual of X-treme GENEHP DNA Transfection Reagent, the recombinant bacmids constructed in the above step (1) were transfected into adherent sf9 insect cells (density 70%-80%), and the cell supernatant was collected after culturing at 27°C for 72h-96h, which was the P1 generation recombinant baculovirus. The supernatant was collected after three blind suspension passages, and the viral genome was extracted. PCR identification was performed using the target gene-specific primers designed in Example 1 and the M13 universal identification primer. The PCR reaction procedure was: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 45 seconds, annealing at 55°C for 45 seconds, and extension at 72°C for 150 seconds, for a total of 30 cycles; and extension at 72°C for another 10 minutes to obtain recombinant baculoviruses rBV-M, rBV-FcF4, rBV-GPI-F8a, rBV-GPI-F8b, and rBV-GPI-F11.

[0073] The results are as follows Figure 2 As shown, through Figure 2 As shown in a, after PCR amplification of the recombinant baculovirus rBV-M, the size of the amplified fragment using the M13 universal identification primer is about 3600 bp, and the size of the amplified fragment using the M gene specific primer is about 1100 bp; Figure 2 As shown in Figure b, after PCR amplification of the recombinant baculovirus rBV-FcF4, the size of the amplified fragment using the M13 universal identification primer was about 4500 bp, and the size of the amplified fragment using the FcF4 gene specific primer was about 2000 bp; Figure 2 As shown in Figure c, after PCR amplification of the recombinant baculovirus rBV-GPI-F8a, the size of the amplified fragment using the M13 universal identification primer was about 4350 bp, and the size of the amplified fragment using the GPI-F8a gene specific primer was about 1850 bp; Figure 2 As shown in Figure d, after PCR amplification of the recombinant baculovirus rBV-GPI-F8b, the size of the amplified fragment using the M13 universal identification primer was about 4350 bp, and the size of the amplified fragment using the GPI-F8b gene specific primer was about 1850 bp; Figure 2 As shown in Figure e, after PCR amplification of the recombinant baculovirus rBV-GPI-F11, the size of the amplified fragment using the M13 universal identification primer was about 4400 bp, and the size of the amplified fragment using the GPI-F11 gene specific primer was about 1900 bp. The results were consistent with the expected bands, indicating that the recombinant baculovirus rBV-M, rBV-F cF4, rBV-GPI-F8a, rBV-GPI-F8b, and rBV-GPI-F11 were successfully rescued.

[0074] The expression of target proteins carried by each recombinant baculovirus was analyzed by immunoblotting. Figure 3 As shown, through Figure 3 As can be seen in a, the M protein is about 40 kDa; Figure 3As can be seen in b, the FcF4 protein is approximately 71 kDa; Figure 3 As shown in Figure c, the F8a-GPI protein is approximately 65 kDa; Figure 3 As shown in Figure d, the F8b-GPI protein is approximately 65 kDa; Figure 3 As can be seen in Figure e, the F811-GPI protein is approximately 67 kDa; the results are consistent with the expected size.

[0075] Example 4 Preparation and purification of avian adenovirus disease tetravalent chimeric virus-like particles

[0076] (1) Preparation of tetravalent chimeric virus-like particles FAdV4-8a-8b-11cVLPs

[0077] The recombinant baculovirus rBV-M, rBV-FcF4, rBV-GPI-F8a, rBV-GPI-F8b, and rBV-GPI-F11 constructed in Example 3 were inoculated into suspended sf9 insect cells (density 2×10 6 / mL), wherein the virus titer ratio of recombinant baculovirus rBV-M, rBV-FcF4, rBV-GPI-F8a, rBV-GPI-F8b, and rBV-GPI-F11 is 5:1:1:1:1. After shaking culture at 28°C and 120r / min for 72h, the culture supernatant containing avian adenovirus disease tetravalent chimeric virus-like particles FAdV4-8a-8b-11cVLPs was collected and centrifuged at 3000×g for 10min to remove cell debris.

[0078] (2) Purification of tetravalent chimeric virus-like particles FAdV4-8a-8b-11cVLPs

[0079] Sucrose density gradient (20%-30%-60%) ultracentrifugation was used to purify the tetravalent chimeric virus-like particles FAdV4-8a-8b-11cVLPs of avian adenovirus disease. Specifically, the cell supernatant containing the tetravalent chimeric virus-like particles FAdV4-8a-8b-11cVLPs of avian adenovirus disease was centrifuged at 4°C and 100,000×g for 2h, the supernatant was aspirated, an appropriate amount of PBS was added to resuspend the precipitate, and it was placed at 4°C overnight to fully dissolve. The next day, 60% sucrose solution, 40% sucrose solution, 20% sucrose solution, and FAdV4-8a-8b-11cVLPs dissolving solution were added from bottom to top in sequence, and centrifuged at 4°C and 100,000×g for 90min. 4 The tetravalent chimeric virus-like particles FAdV4-8a-8b-11cVLPs of avian adenovirus disease between the 0% sucrose layer and the 60% sucrose layer were dissolved with an appropriate amount of PBS, centrifuged at 4°C and 100,000 g for 2 h, the supernatant was aspirated, and an appropriate amount of PBS was added to resuspend the tetravalent chimeric virus-like particles FAdV4-8a-8b-11cVLPs of avian adenovirus disease. The morphological structure of the tetravalent chimeric virus-like particles FAdV4-8a-8b-11cVLPs of avian adenovirus disease was analyzed using transmission electron microscopy.

[0080] Electron microscopic results of the tetravalent chimeric virus-like particles FAdV4-8a-8b-11cVLPs of avian adenovirus disease are shown in Figure 2. Figure 4 As shown. Figure 4 It can be seen that the morphological structure of the tetravalent chimeric virus-like particles FAdV4-8a-8b-11cVLPs of avian adenovirus disease prepared by the present invention is similar to that of the real virus, presenting an elliptical structure of about 100 nm, with a hollow protein polymer structure of capsule and fibrous protrusions on the surface, which indicates that the tetravalent chimeric virus-like particles FAdV4-8a-8b-11cVLPs of avian adenovirus disease are successfully prepared. The invasion mode of the tetravalent chimeric virus-like particles FAdV4-8a-8b-11cVLPs of avian adenovirus disease is similar to that of the virus, and is easily taken up and processed by antigen presenting cells.

[0081] Example 5 Application of the Avian Adenovirus Disease Tetravalent Chimeric Virus-Like Particles FAdV4-8a-8b-11c VLPs

[0082] (1) Animal immunization

[0083] SPF chickens were randomly divided into PBS group and experimental group, with 15 chickens in each group. The PBS group was immunized with 200 μL PBS, and the experimental group was immunized with 200 μL containing 80 μg of avian adenovirus disease tetravalent chimeric virus-like particles FAdV4-8a-8b-11cVLPs (avian adenovirus disease tetravalent chimeric virus-like particles FAdV4-8a-8b-11cVLPs were mixed with Freund's complete adjuvant in a ratio of 1:1 (v / v) and fully emulsified). The chickens were immunized subcutaneously on the back of the neck, with the first immunization at 7 days of age and the booster immunization at 28 days of age. During this period, serum was collected every week and stored at -40°C for future use.

[0084] (2) Monitoring of ELISA antibody titer

[0085] The avian adenovirus disease tetravalent chimeric virus-like particles FAdV4-8a-8b-11cVLPs were mixed with the coating solution, added to the ELISA plate at 1 μg / well (100 μL), and placed at 4°C for coating overnight; 100 μL of 1% skimmed milk powder was added, and the plate was placed in a 37°C incubator for blocking for 90 minutes; 100 μL of a 1:2000 diluted serum sample was added, and the plate was placed in a 37°C incubator for incubation for 90 minutes; 100 μL of a 1:4000 diluted HRP-labeled anti-chicken IgG antibody was added, and the plate was placed in a 37°C incubator for incubation for 60 minutes; the supernatant was discarded at each step, patted dry, and 200 μL of 0.5% PBST was added for washing 3 times, each time for 5 minutes; 100 μL of TMB substrate solution was added, and after color development at 37°C for 15 minutes, 50 μL of 2M sulfuric acid was added to terminate the reaction, and the OD450 value was read in an enzyme reader.

[0086] The results are as follows Figure 5 As shown, the tetravalent chimeric virus-like particles FAdV4-8a-8b-11cVLPs of avian adenovirus disease can stimulate the body to produce higher titers of antibodies after immunization. The antibody titer increases with time after immunization and reaches a peak 3 weeks after booster immunization, indicating that the tetravalent chimeric virus-like particles FAdV4-8a-8b-11cVLPs of avian adenovirus disease have good immunogenicity and can be used in the prevention and control of multiple serotypes of avian adenovirus.

[0087] The present invention discloses a tetravalent chimeric virus-like particle for avian adenovirus disease and a preparation method and application thereof. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve the above. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The products of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the products described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0088]

[0089]

[0090] <212> DNA

[0091] <213> Artificial

[0092] <400> 3

[0093] atggctacttctacacctcacgccttctccttcggtcagatcggtagccgtaagcgccctgccggtggtgacggtgaacgtg

[0094] acgcttccaaggttcctaaaatgcaaacacctgctccatctgctactgctaacggtaacgatgaactggacctcgtttaccctt

[0095] tttggctgcagaacggttctactggcggaggaggtggtggtggctcaggtggtaaccctagcctcaatcctcccttcctgg

[0096] accctaacggacctctgacagttcagaacaacctcttgaaggttaacactaccgctcctatcgctgtgactaacaaggccct

[0097] caccctgagcttcgacgctgagtccctcgaactgaccaaccagcaacagctggccgtgaagatcgaccctgagggtcct

[0098] ctgaaggccacaaccgaaggaatccagctgagcgtcgatccaactaccctggaggtggacgacgttgactgggagctg

[0099] acagtgaacctggaccctaacggtccactcgacagctccgctactggtatcaccgtccgcgtggacgacactctgctcatc

[0100] gacgacgacggcagcggccagggcaaggaactgggagtgcacctgaaccctgacggccccatcaccgctgaccaga

[0101] acggtctggacctggaaatcgacaaccagaccctgaagatcacccctggctccgccggaggtgtgctgagcgtgcagct

[0102] caagccacagggcggtctgaactcccagtccgacggtatccaggtggtcacacagaactccatcgaagttgacaacggc

[0103] gctctcgacgtcaaggtggtcgctaacggtcctctgagcacaacacctaacggtctgaccctgaactacgacacaggtga

[0104] cttcaccgtcaacgccggtaccctgagcatcctgcgtaacccttcactcgtggctaacgcttacctcacttccggcgctcgta

[0105] cactccagcagttcactgctaagggcgaaaactcctcccagttctccttcccctgcgcctactacctgcagcagtggctgtc

[0106] cgacggtctgatcttcagctccctctacctcaagctggaccgtacccgcttcactggcatgagcagcgaccctagctacca

[0107] gaacgcccgctacttcaccttctgggttggcggcggcgctgccatgaacctttcccagctgtctacccctactatcactcctt

[0108] caaccacagaatggactgcttttgccccagctctgaactacagcggcgccccagccttcgtgtacgacgctaaccccgtgt

[0109] tcacaatttacttccagccaaacacaggccgtgtcgacacatacctcccagtgctcaccggcgactggaaaaccagcagc

[0110] acatacaaccctggcacaattaccctggtcgtcaggaacgccacaatccaactccaatcacagtctacattcacaacaagc

[0111] gtctgttacaacttccgctgtcagaactccggcatcttcaacaacaacgctactagcggtactctgacactgggtcctatcttc

[0112] tactcatgtccagccctgtcaacagctgacgtgagctaa

[0113] <210>4

[0114] <211>1569

[0115] <212>DNA

[0116] <213>Artificial

[0117] <400>4

[0118] atggctacttcaacccctcacgctttctccttcggtcagatcggctcccgtaagcgcccagccggaggtgacggtgagcgt

[0119] gacgctagcaaggttcctaaaatgcaaactcctgctccctctgccacagctaacggtaacgacgaattggacctggtttacc

[0120] ctttttggttgcagaacggctcaacaggaggtggaggtggaggtggtagcggtggtaacccttccctgaaccctcctttctt

[0121] ggaccctaacggtcccttgactgttcagaataacctgctgaaggttaacaccactgctccaatcgccgtcactaacaaggct

[0122] ctgactctggcttacgaatccgatagcctggaactgactaaccagcagcagctggctgtgaagatcgaccctgagggtcc

[0123] actcaaggctacaactgaaggaatccaattgagcgttgatccaacaacattggaagttgatgacgtggactgggagctgac

[0124] cgtgaagctcgaccctgacggccccctggacagcagcgccaccggtatcacagtgcgcgtggacgagaccctgctgat

[0125] cgaggacgacggctccggccagggaaaggaactcggcgtgaacctgaaccctacaggtcccatcaccgccgacgacc

[0126] agggtctggacctggaaatcgacaaccaaaccctgaaggtgaacagcgttaccggcggtggcgtgctcgctgtgcagct

[0127] gaagagccagggcggcctgacagctcagaccgacggcatccaggtgaacacccagaacagcatcaccgtgactaacg

[0128] gcgccctcgacgttaaggtggctgctaacggtcctctggaatccactgacactggactgaccctcaactacgaccctggtg

[0129] acttcacagtgaacgccggcaccctgagcatcatcagagaccctgctctcgttgccaacgcttacctgacctccggagcta

[0130] gcactctgcagcagttcaccgccaagtccgagaacagctcccaattctctttcccttgtgcttactacctgcagcagtggctc

[0131] agcgacggcttgatcttctccagcctgtacctgaagctggaccgcgcccaatttaccaacatgcctacaggcgccaactac

[0132] cagaacgcccgttacttcactttctgggtgggcgccggtactagcttcaacctgagcactctcactgaacctaccatcactcc

[0133] taacacaacccagtggaacgccttcgcccctgccctggactacagcggtgctccacctttcatctacgacgcctccagcgt

[0134] ggtgaccatctactttgagcctactagcggccgtctggaatcctacctgcctgttctgaccgacaactggtcccagacctac

[0135] aaccccggtactgtgaccctgtgcgttaagacagttcgtgtgcagctgcgttcccagggcaccttctccactctggtgtgtta

[0136] caacttcagatgtcagaacactggcatcttcaactccaacgctaccgctggtacaatgacactgggtcctatcttcttctcctg

[0137] tcctgctctatccaccgctaacgctccttaa

[0138] <210>5

[0139] <211>1614

[0140] <212>DNA

[0141] <213>Artificial

[0142] <400>5

[0143] atggctaagagcaccccttttgccttctcgatgggacttcacagctcaagaaagcgtccggccgactcagagaatactcaa

[0144] aacgccagcaaggtcgctaagacccaaacaagtgctacgagggctggcgtagacggtaacgacgacctgaatctggtg

[0145] taccctttctggcttcagaactcaacgagtggtggaggcggaggaggttccggtggtaacccttcattgaacccgcctttca

[0146]

Claims

1. A tetravalent chimeric virus-like particle for avian adenovirus disease, characterized in that: The matrix protein M of the Newcastle disease virus NA-1 strain is used as the skeleton, the Fiber-2 protein of group I serotype 4 fowl adenovirus, the Fiber protein of group I serotype 8a fowl adenovirus, the Fiber protein of group I serotype 8b fowl adenovirus, and the Fiber protein of group I serotype 11 fowl adenovirus are respectively embedded in the surface of the Newcastle disease virus-like particle vector NDVVLPs to obtain the fowl adenovirus disease tetravalent chimeric virus-like particles, which are named FAdV4-8a-8b-11cVLPs; the optimized M gene sequence information is shown in SEQ ID NO.1; the Fiber-2 protein of group I serotype 4 fowl adenovirus is embedded in the surface of the Newcastle disease virus-like particle vector NDVVLPs by using the extracellular domain replacement strategy, and the optimized F4 gene sequence information is shown in SEQ ID NO.2; the Fiber protein of group I serotype 8a fowl adenovirus, the Fiber protein of group I serotype 8b fowl adenovirus, and the Fiber protein of group I serotype 11 fowl adenovirus are all embedded in the surface of the Newcastle disease virus-like particle vector NDVVLPs using a GPI anchoring strategy, the optimized F8a gene sequence information is shown in SEQ ID NO.3, the optimized F8b gene sequence information is shown in SEQ ID NO.4, and the optimized F11 gene sequence information is shown in SEQ ID NO.

5.

2. The method for preparing tetravalent chimeric virus-like particles of avian adenovirus disease according to claim 1, characterized in that: The following steps are involved: Step 1: Optimization and synthesis of target gene; Step 2: Construction of recombinant shuttle plasmid; Step 3: Construction of recombinant bacmid; Step 4: Rescue of recombinant baculovirus; Step 5. Preparation and purification of avian adenovirus disease tetravalent chimeric virus-like particles.

3. The method for preparing tetravalent chimeric virus-like particles of avian adenovirus disease according to claim 2, characterized in that: The specific steps of step one are as follows: The M gene sequence of genotype VII Newcastle disease virus, the Fiber-2 gene sequence of group I serotype 4 fowl adenovirus HB 1510 strain, the Fiber gene sequence of group I serotype 8a fowl adenovirus TR-59 strain, the Fiber gene sequence of group I serotype 8b fowl adenovirus 764 strains, and the Fiber gene sequence of group I serotype 11 fowl adenovirus 380 strains were optimized respectively. The optimized M gene sequence, F4 gene sequence, F8a gene sequence, F8b gene sequence, and F11 gene sequence are shown in SEQ ID NO.1 to SEQ ID NO.5, respectively.

4. The method for preparing tetravalent chimeric virus-like particles of avian adenovirus disease according to claim 3, characterized in that: The specific steps of step 2 are as follows: According to the optimized M gene sequence, F4 gene sequence, F8a gene sequence, F8b gene sequence, F11 gene sequence and pFastbac-1 vector information, pFastbac-GPI vector information, target gene specific primers and M13 universal identification primers were designed, gene amplification was performed by PCR, and the PCR products were identified as correct by agarose gel electrophoresis. Then, each synthesized plasmid was double-digested, and the target fragment was recovered using a DNA gel recovery kit. The recovered M gene and F4 gene were ligated to the pFastbac1 vector, and the recovered F8a gene, F8b gene, and F11 gene were respectively ligated to the pFastbac1-GPI vector, and transformed into DMT competent cells for PCR and double-digestion screening to obtain recombinant shuttle plasmids pFastbacl-M, pFastbac1-FcF4, pFastbac1-GPI-F8a, pFastbac1-GPI-F8b, and pFastbac1-GPI-F11.

5. The method for preparing tetravalent chimeric virus-like particles of avian adenovirus disease according to claim 4, characterized in that: The specific steps of step three are as follows: The constructed recombinant shuttle plasmids were transformed into Escherichia coli DH10 Bac competent cells for homologous recombination, plated on triple antibody solid selection plates for culture, single white colonies were picked, and PCR identification was performed using target gene-specific primers and M13 universal identification primers. The correctly identified positive bacterial liquid plasmids were plated again on triple antibody solid selection plates, and screening was repeated until the positive rate was 100%, and recombinant bacmids rBacmid-M, rBacmid-FcF4, rBacmid-GPI-F8a, rBacmid-GPI-F8b, and rBacmid-GPI-F11 were obtained.

6. The method for preparing tetravalent chimeric virus-like particles of avian adenovirus disease according to claim 5, characterized in that: The specific steps of step 4 are as follows: Liposome-mediated transfection was used to transfect the constructed recombinant bacmids into the insect baculovirus expression system respectively. The supernatant was collected after three blind suspension passages, and the viral genome was extracted. PCR identification was performed using target gene-specific primers and M13 universal identification primers to obtain recombinant baculoviruses rBV-M, rBV-FcF4, rBV-GPI-F8a, rBV-GPI-F8b, and rBV-GPI-F11.

7. The method for preparing tetravalent chimeric virus-like particles of avian adenovirus disease according to claim 6, characterized in that: The specific steps of step 5 are as follows: The constructed recombinant baculoviruses rBV-M, rBV-FcF4, rBV-GPI-F8a, rBV-GPI-F8b, and rBV-GPI-F11 were inoculated into the insect baculovirus expression system at an MOI of 1 for culture; 72h-96h after infection, the supernatant was collected and purified by sucrose density gradient ultracentrifugation to obtain avian adenovirus disease tetravalent chimeric virus-like particles FAdV4-8a-8b-11cVLPs.

8. Use of the tetravalent chimeric virus-like particle for avian adenovirus disease according to claim 1 in the preparation of a tetravalent chimeric virus-like particle vaccine for avian adenovirus disease, characterized in that: The tetravalent chimeric virus-like particle vaccine for avian adenovirus disease is used to prevent group I serotype 4 avian adenovirus, group I serotype 8a avian adenovirus, group I serotype 8b avian adenovirus and group I serotype 11 avian adenovirus.

Images