A method for conferring resistance to 2,4-D butyrate on plants

Abstract

The present invention provides a method for conferring or enhancing plant resistance or tolerance to the herbicide 2,4-D. Specifically, the present invention provides a method for conferring or enhancing plant resistance or tolerance to the herbicide 2,4-D by inhibiting the expression or activity of the ABCD gene or the protein encoded by it. The present invention is the first to discover that inhibiting the expression of the ABCD2 gene or the protein encoded by it can enhance plant resistance or tolerance to the herbicide 2,4-D.

Description

Technical Field

[0001] The present invention belongs to the fields of biotechnology and crop genetic breeding, and particularly relates to a method for imparting or enhancing plant resistance or tolerance to the herbicide 2,4-D butyrate. Background Art

[0002] In agricultural production, weeds compete with crops for light and fertilizer, and spread pests and diseases. This severely impacts crop yield and quality, leading to direct economic losses. Traditional manual weed removal is labor-intensive and inefficient. With the advent of herbicides, chemical weed control has become an essential step in modern agricultural production.

[0003] Herbicides are synthetic chemicals used to kill and control the growth of weeds. Based on their mechanism of action, they can be categorized as growth regulators, photosynthesis inhibitors, amino acid biosynthesis inhibitors, fat biosynthesis inhibitors, and cell division inhibitors.

[0004] 2,4-D butyrate, also known as 2,4-D butyrate or 2,4-DB, is a phenoxycarboxylic acid hormone-type selective herbicide primarily used to control dicotyledonous weeds, including annual broadleaf weeds and sedge weeds, in rice fields. 2,4-D butyrate itself is not toxic to plants. However, it is transported to peroxisomes via the ABCD transporter, where it undergoes β-oxidation within the plant to produce the highly active herbicidal 2,4-D. Variations in β-oxidase activity in different plants result in varying conversion capacities. For example, rice plants have low β-oxidase activity and cannot metabolize 2,4-D to 2,4-D, thus remaining unharmed. However, some weeds have high β-oxidase activity, allowing them to metabolize 2,4-D to 2,4-D, killing them.

[0005] 2,4-D, also known as 2,4-D butyl ester or 2,4-D, is a growth-regulating herbicide widely used to control dicot weeds in wheat and corn fields. Growth regulators promote growth at low concentrations but inhibit it at high concentrations. Furthermore, dicots and monocots differ in their sensitivity to growth regulators, with dicots showing a higher sensitivity. Therefore, spraying the growth-regulating herbicide 2,4-D in monocot fields can effectively control broadleaf weeds without affecting the plants.

[0006] We used gene editing technology to knock out key enzymes, genes, and gene families in the fatty acid β-oxidation pathway in Arabidopsis thaliana, inhibiting the fatty acid β-oxidation pathway and identifying sites of resistance to 2,4-D. In Arabidopsis, the genes encoding ABCD transporters are ABCD1 and ABCD2. We knocked out specific sites in these two ABCD transporter genes, either individually or simultaneously, to generate Arabidopsis thaliana resistant to the herbicide 2,4-D. Summary of the Invention

[0007] The object of the present invention is to provide a method for imparting / enhancing resistance / tolerance to the herbicide 2,4-D butyrate in plants.

[0008] In one aspect, the present invention provides a method for conferring / enhancing resistance / tolerance to the herbicide 2,4-D butyrate in a plant, the method comprising any one or more steps of the following group:

[0009] (a) reducing or inhibiting the expression of the ABCD2 gene in the plant;

[0010] (b) reducing or inhibiting the expression level and / or activity of the protein encoded by the ABCD2 gene in the plant.

[0011] In another preferred embodiment, the method further comprises any one or more steps of the following group:

[0012] (c) reducing or inhibiting the expression of the ABCD1 gene in the plant;

[0013] (d) reducing or inhibiting the expression level and / or activity of the protein encoded by the ABCD1 gene in the plant.

[0014] In another preferred embodiment, the plants include crops, forestry plants, vegetables, fruits, flowers, and forage grasses (including lawn grasses).

[0015] In another preferred embodiment, the plant includes monocotyledonous plants and dicotyledonous plants; preferably, the plant is a dicotyledonous plant.

[0016] In another preferred embodiment, the plant is derived from one or more plants selected from the following groups: Cruciferae, Poaceae, Leguminosae, Solanaceae, Cucurbitaceae, Chenopodiaceae, Polygonaceae, Pedulaceae, Asteraceae, Malvaceae, Rosaceae, Pedulaceae, Convolvulaceae, Dioscorea, Apiaceae, Liliaceae, and Zingiberaceae.

[0017] In another preferred embodiment, the plant is derived from one or more plants selected from the group consisting of Arabidopsis, rice, tobacco, tomato, potato, corn, cotton, soybean, alfalfa, sorghum, barley, wheat, millet, sweet potato, quinoa, lettuce, rapeseed, cabbage, spinach, beet, peanut, watermelon, cabbage, strawberry, or a combination thereof.

[0018] In another preferred embodiment, the plant is selected from Arabidopsis, rice, tobacco, tomato, potato, corn, cotton, soybean, and peanut.

[0019] In another preferred embodiment, the amino acid sequence of ABCD2 has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity compared to SEQ ID No. 1.

[0020] In another preferred embodiment, the amino acid sequence of ABCD1 has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity compared to SEQ ID No. 2.

[0021] In another preferred example, the ABCD2 gene includes cotton gene LOC107946680 (Genbank), or potato gene LOC102581284 (Genbank), or tobacco gene LOC107798686 (Genbank), or tomato gene 101256258 (Genbank), or peanut LOC107458888 (Genbank).

[0022] In another preferred embodiment, the ABCD1 gene comprises cotton gene LOC107913671 (Genbank), or cotton gene LOC107945455 (Genbank), or cotton gene LOC107925489 (Genbank), or cotton gene LOC107946680 (Genbank), or potato gene LOC102587630 (Genbank), or potato gene LOC102581284 (Genbank), or potato gene LOC102601060 (Genbank), or potato gene 102577604 (Genbank), or tobacco gene LOC107770907 (Genbank), or tobacco gene 107801433 (Genbank), or Tobacco gene LOC107801232 (Genbank), or tobacco gene LOC107798686 (Genbank), or Nicotiana tabacum gene LOC104217649 (Genbank), or Nicotiana tabacum gene LOC104230823 (Genbank), or tomato gene 101260717 (Genbank), or tomato gene 101256258 (Genbank), or tomato gene 101247740 (Genbank), or tomato gene 101261549 (Genbank), or peanut gene LOC107631658 (Genbank), or peanut gene LOC112715182 (Genbank), or peanut gene LOC112783718 (Genbank).

[0023] In one embodiment, the reduction or inhibition of the expression and / or activity of the ABCD2 gene or its protein is achieved by a homozygous mutation of the ABCD2 gene, that is, both alleles of the ABCD2 gene are mutated; preferably, the mutation results in complete loss of ABCD2 function or partial loss of function; preferably, the mutation results in complete loss of ABCD2 function; preferably, the mutation is an insertion of one base after the 319th base of the nucleotide sequence of the ABCD2 gene relative to SEQ ID NO.3 (edited strain β7-305); preferably, the mutation is an insertion of one base after the 2700th base of the nucleotide sequence of the ABCD2 gene relative to SEQ ID NO.3 (edited strain β8-337); preferably, the mutation is an insertion of one base after the 2699th base of the nucleotide sequence of the ABCD2 gene relative to SEQ ID NO.3 (edited strain β8-347); preferably, the mutation is an insertion of one base after the 2699th base of the nucleotide sequence of the ABCD2 gene relative to SEQ ID NO.3 NO.3 lacks 10 bases at positions 2690-2699 (edited strain β8-360); preferably, the mutation is that the nucleotide sequence of the ABCD2 gene lacks 29 bases at positions 2674-2702 relative to SEQ ID NO.3 (edited strain β8-3-1).

[0024] In one embodiment, the reduction or inhibition of the expression and / or activity of the ABCD1 gene or its protein is achieved by a homozygous mutation of the ABCD1 gene, that is, both alleles of the ABCD1 gene are mutated; preferably, the mutation causes complete loss of ABCD1 function or partial loss of function; preferably, the mutation causes complete loss of ABCD1 function; preferably, the mutation is a deletion of 33 bases from positions 1023 to 1055 of the nucleotide sequence of the ABCD1 gene relative to SEQ ID NO.4 (edited strain β5-115); preferably, the mutation is an insertion of 30 bases after base 1022 of the nucleotide sequence of the ABCD1 gene relative to SEQ ID NO.4, and then a deletion of 19 bases from positions 1023 to 1041, followed by an insertion of 1 base after position 1046 and a SNP mutation at bases 1049 and 1053 (edited strain β5-108).

[0025] In one embodiment, the reduction or inhibition of the expression and / or activity of the ABCD1 gene or its protein is achieved by a heterozygous mutation of the ABCD1 gene, that is, one allele of the ABCD1 is wild type and the other allele of the ABCD1 is mutated; preferably, the mutation causes complete loss of function or partial loss of function of ABCD1; preferably, the mutation is a deletion of 28 bases from positions 1001 to 1028 of the nucleotide sequence of the ABCD1 gene relative to SEQ ID NO.4 (edited strain β5-2-4); preferably, the mutation is an insertion of 3 bases and a deletion of 9 bases after the 7357th base of the nucleotide sequence of the ABCD1 gene relative to the 7357th base of SEQ ID NO.4 (edited strain β6-204); preferably, the mutation is an insertion of one base after the 7358th base of the nucleotide sequence of the ABCD1 gene relative to the 7358th base of SEQ ID NO.4 (edited strain β6-186); preferably, the mutation is an insertion of one base after the 7358th base of the nucleotide sequence of the ABCD1 gene relative to the 7357th base of SEQ ID NO.4 (edited strain β6-186); preferably, the mutation is an insertion of one base after the 7358th base of the nucleotide sequence of the ABCD1 gene relative to the 7357th base of SEQ ID NO.4 NO.4 lacks 6 bases at positions 7355-7360 (edited strain β6-197).

[0026] In one embodiment, the reduction or inhibition of the expression and / or activity of the ABCD2 and ABCD1 genes or their proteins is achieved by heterozygous mutations in the ABCD2 and ABCD1 genes. That is, both the ABCD2 and ABCD1 genes are heterozygous mutations; or the ABCD2 gene is a heterozygous mutation, while the ABCD1 gene is a homozygous mutation; or the ABCD2 gene is a homozygous mutation, while the ABCD1 gene is a heterozygous mutation. Preferably, the mutation causes complete or partial loss of function of ABCD2 and ABCD1; preferably, the mutation is that the nucleotide sequence of the ABCD2 gene deletes 16 bases at positions 2687-2702 relative to SEQ ID NO.3, and the nucleotide sequence of the ABCD1 gene inserts 1 base after the 1022nd base relative to SEQ ID NO.4 (edited strain 2021-1-8); preferably, the mutation is that the nucleotide sequence of the ABCD2 gene deletes the 2699th base relative to SEQ ID NO.3, and the nucleotide sequence of the ABCD1 gene deletes 8 bases at positions 1023-1030 relative to SEQ ID NO.4 (edited strain 2021-6-2); preferably, the mutation is that the nucleotide sequence of the ABCD2 gene deletes the 2699th base relative to SEQ ID NO.4, and the nucleotide sequence of the ABCD1 gene deletes the 8 bases at positions 1023-1030 relative to SEQ ID NO.4 (edited strain 2021-6-2). NO.4 deletes 31 bases at positions 1023-1053 (edited strain 2021-6-1); preferably, the mutation is that the nucleotide sequence of the ABCD2 gene deletes 27 bases at positions 2699-2725 relative to SEQ ID NO.4, and the nucleotide sequence of the ABCD1 gene inserts 1 base at position 1022 relative to SEQID NO.4 (edited strain 2021-4-1); preferably, the mutation is that the nucleotide sequence of the ABCD2 gene deletes 29 bases at positions 2674-2702 relative to SEQ ID NO.4, and the nucleotide sequence of the ABCD1 gene deletes 5 bases at positions 1023-1027 relative to SEQ ID NO.4 (edited strain 2021-4-5).

[0027] In another preferred embodiment, the reduction or inhibition means that compared with the expression level E0 of the ABCD2 gene or its encoded protein in the wild-type plant, the expression level E1 of the ABCD2 gene or its encoded protein in the plant is 0-80% of the wild-type, preferably 0-60%, more preferably 0-40%, and even more preferably 0-30%.

[0028] In another preferred embodiment, the reduction or inhibition means that compared with the expression level E0 of the ABCD1 gene or its encoded protein in the wild-type plant, the expression level E1 of the ABCD1 gene or its encoded protein in the plant is 0-80% of the wild-type, preferably 0-60%, more preferably 0-40%, and even more preferably 0-30%.

[0029] In another preferred embodiment, the reduction or inhibition of the expression and / or activity of the ABCD2 gene or its protein is achieved by a method selected from the group consisting of gene mutation, gene knockout, gene interruption, RNA interference, gene editing technology, and introduction of gene or protein inhibitors.

[0030] In another preferred embodiment, the reduction or inhibition of the expression and / or activity of the ABCD1 gene or its protein is achieved by a method selected from the group consisting of gene mutation, gene knockout, gene interruption, RNA interference, gene editing technology, and introduction of gene or protein inhibitors.

[0031] In another preferred embodiment, the gene mutation is obtained by one or more of the following methods: natural variation, physical mutagenesis (such as ultraviolet mutagenesis, X-ray or Y-ray mutagenesis), chemical mutagenesis (such as nitrite, hydroxylamine, EMS, nitrosoguanidine, etc.), biological mutagenesis (such as virus- or bacteria-mediated mutagenesis), gene editing or biosynthesis.

[0032] In another preferred embodiment, the mutation region includes exon and / or intron regions.

[0033] In one embodiment, the above method comprises the following steps:

[0034] (1) Providing Agrobacterium carrying an expression vector, wherein the expression vector contains a sequence targeting the ABCD2 gene and / or the ABCD1 gene;

[0035] (2) contacting the plant cells, plant tissues, or plant parts with the Agrobacterium from step (1);

[0036] (3) Screening plant cells, plant tissues, and plant parts in which the expression of the ABCD2 gene and / or the ABCD1 gene is inhibited.

[0037] In another preferred embodiment, the gene editing technology is selected from the following group: CRISPR technology, TALEN technology, ZFN technology, or a combination thereof.

[0038] Preferably, the gene editing enzyme of the gene editing technology is Cas protein, also known as CRISPR enzyme or Cas effector protein, and its types include but are not limited to: Cas9 protein, Cas12 protein, Cas13 protein, Cas14 protein, Csm1 protein, FDK1 protein, MAD protein.

[0039] In one embodiment, the gene editing enzyme is a Cas9 protein, and the method further comprises a Scaffold sequence that can specifically bind to the Cas9 protein. After the Scaffold sequence is operably connected to the guide sequence, it constitutes a guide sequence (gRNA). Preferably, the gRNA is operably connected to a second regulatory element.

[0040] Such regulatory elements include promoters, terminator sequences, leader sequences, polyadenylation sequences, signal peptide coding regions, marker genes, enhancers, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences).

[0041] In one embodiment, the editing vector further comprises resistance genes for easy screening, wherein the resistance genes include hyg, bar, kana, rif, spec, and amp, and the resistance genes are well known to those skilled in the art.

[0042] In another preferred example, the maximum tolerance concentration of the plant in which the expression and / or activity of the ABCD2 gene or the protein encoded by the ABCD2 gene is inhibited to the herbicide 2,4-D butyrate is increased by at least 1.1 times, preferably at least 2 times, preferably at least 3 times, preferably at least 4 times, preferably at least 5 times, preferably at least 6 times, and preferably at least 10 times, compared with the wild-type plant.

[0043] In another preferred example, the maximum tolerance concentration of the plant in which the expression and / or activity of the ABCD1 gene or the protein encoded by the ABCD1 gene is inhibited to the herbicide 2,4-D butyrate is increased by at least 1.1 times, preferably at least 2 times, preferably at least 3 times, preferably at least 4 times, preferably at least 5 times, preferably at least 6 times, and preferably at least 10 times, compared with the wild-type plant.

[0044] On the other hand, the present invention provides a composition, complex or vector system for conferring / enhancing resistance / tolerance of a plant to the herbicide 2,4-D butyrate, wherein the composition, complex or vector system is used to reduce or inhibit the expression level of the ABCD2 gene in the plant, or reduce or inhibit the expression level and / or activity of the protein encoded by the ABCD2 gene in the plant.

[0045] In another preferred embodiment, the composition, complex or vector system is also used to reduce or inhibit the expression level of the ABCD1 gene in the plant, or reduce or inhibit the expression level and / or activity of the protein encoded by the ABCD1 gene in the plant.

[0046] In another preferred embodiment, the composition comprises:

[0047] (a) an inhibitor of the ABCD2 gene or the protein encoded by the ABCD2 gene;

[0048] (b) an agriculturally acceptable carrier.

[0049] In another preferred embodiment, the composition comprises:

[0050] (a) an inhibitor of the ABCD1 gene or the protein encoded by the ABCD1 gene;

[0051] (b) an agriculturally acceptable carrier.

[0052] In another preferred embodiment, the composition further comprises other substances that can reduce or inhibit the expression level of the ABCD2 gene in the plant, or reduce or inhibit the expression level and / or activity of the protein encoded by the ABCD2 gene in the plant.

[0053] In another preferred embodiment, the composition further comprises other substances capable of reducing or inhibiting the expression level of the ABCD1 gene in the plant, or reducing or inhibiting the expression level and / or activity of the protein encoded by the ABCD1 gene in the plant.

[0054] In another preferred embodiment, the plants include crops, forestry plants, vegetables, fruits, flowers, and forage grasses (including lawn grasses).

[0055] In another preferred embodiment, the plant includes monocotyledonous plants and dicotyledonous plants; preferably, the plant is a dicotyledonous plant.

[0056] In another preferred embodiment, the plant is derived from one or more plants selected from the following groups: Cruciferae, Poaceae, Leguminosae, Solanaceae, Cucurbitaceae, Chenopodiaceae, Polygonaceae, Pedulaceae, Asteraceae, Malvaceae, Rosaceae, Pedulaceae, Convolvulaceae, Dioscorea, Apiaceae, Liliaceae, and Zingiberaceae.

[0057] In another preferred embodiment, the plant is derived from one or more plants selected from the group consisting of Arabidopsis, rice, tobacco, tomato, potato, corn, cotton, soybean, alfalfa, sorghum, barley, wheat, millet, sweet potato, quinoa, lettuce, rapeseed, cabbage, spinach, beet, peanut, watermelon, cabbage, strawberry, or a combination thereof.

[0058] In another preferred embodiment, the plant is selected from Arabidopsis, rice, tobacco, tomato, potato, corn, cotton, soybean, and peanut.

[0059] In another preferred embodiment, the amino acid sequence of ABCD2 has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity compared to SEQ ID No. 1.

[0060] In another preferred embodiment, the amino acid sequence of ABCD1 has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity compared to SEQ ID No. 2.

[0061] In another preferred example, the ABCD2 gene includes cotton gene LOC107946680 (Genbank), or potato gene LOC102581284 (Genbank), or tobacco gene LOC107798686 (Genbank), or tomato gene 101256258 (Genbank), or peanut LOC107458888 (Genbank).

[0062] In another preferred embodiment, the ABCD1 gene comprises cotton gene LOC107913671 (Genbank), or cotton gene LOC107945455 (Genbank), or cotton gene LOC107925489 (Genbank), or cotton gene LOC107946680 (Genbank), or potato gene LOC102587630 (Genbank), or potato gene LOC102581284 (Genbank), or potato gene LOC102601060 (Genbank), or potato gene 102577604 (Genbank), or tobacco gene LOC107770907 (Genbank), or tobacco gene 107801433 (Genbank), or Tobacco gene LOC107801232 (Genbank), or tobacco gene LOC107798686 (Genbank), or Nicotiana tabacum gene LOC104217649 (Genbank), or Nicotiana tabacum gene LOC104230823 (Genbank), or tomato gene 101260717 (Genbank), or tomato gene 101256258 (Genbank), or tomato gene 101247740 (Genbank), or tomato gene 101261549 (Genbank), or peanut gene LOC107631658 (Genbank), or peanut gene LOC112715182 (Genbank), or peanut gene LOC112783718 (Genbank).

[0063] In another preferred embodiment, the composition, complex or carrier system is used in the preparation of a reagent or kit for conferring / enhancing resistance / tolerance of plants to the herbicide 2,4-D butyrate.

[0064] In another preferred embodiment, the composition, complex or carrier system is used to impart / enhance resistance / tolerance to the herbicide 2,4-D butyrate in plants.

[0065] In another preferred example, the tolerance of the plant in which the expression and / or activity of the ABCD2 gene or the protein encoded by the ABCD2 gene is inhibited to the maximum concentration of the herbicide 2,4-D butyrate is increased by at least 1.1 times, preferably at least 2 times, preferably at least 3 times, preferably at least 4 times, preferably at least 5 times, preferably at least 6 times, and preferably at least 10 times, compared with the wild-type plant.

[0066] In another preferred example, the tolerance of the plant in which the expression and / or activity of the ABCD1 gene or the protein encoded by the ABCD1 gene is inhibited to the maximum concentration of the herbicide 2,4-D butyrate is increased by at least 1.1 times, preferably at least 2 times, preferably at least 3 times, preferably at least 4 times, preferably at least 5 times, preferably at least 6 times, and preferably at least 10 times, compared with the wild-type plant.

[0067] In one embodiment, the vector includes an expression vector, a shuttle vector, and an integration vector.

[0068] Vectors can be of the type of plasmid, virus, cosmid, phage, etc., which are well known to those skilled in the art.

[0069] In another preferred embodiment, the vector system includes any one or a combination of the following: pBR322 (ATCC37017), pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden), GEM1 (Promega Biotec, Madison, WI, USA) pQE70, pQE60, pQE-9 (Qiagen), pD10, psiX174 pBluescript IIKS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene), ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia), pKK232-8, pCM7, pSV2CAT, pOG44, pXT1, pSG (Stratagene), pSVK3, pBPV, pMSG, and pSVL (Pharmacia).

[0070] On the other hand, the present invention provides a method for preparing a plant cell, or plant tissue, or plant part, or plant that is resistant / tolerant to the herbicide 2,4-D butyrate, the method comprising the steps of reducing or inhibiting the expression level of the ABCD2 gene in the plant cell, or plant tissue, or plant part, or plant, or reducing or inhibiting the expression level and / or activity of the protein encoded by the ABCD2 gene in the plant cell, or plant tissue, or plant part, or plant.

[0071] In another preferred embodiment, the method further comprises reducing or inhibiting the expression level of the ABCD1 gene in the plant cell, or plant tissue, or plant part, or plant, or reducing or inhibiting the expression level and / or activity of the protein encoded by the ABCD1 gene in the plant cell, or plant tissue, or plant part, or plant.

[0072] In another preferred embodiment, the reduction or inhibition of the expression and / or activity of the ABCD2 gene or its protein is achieved by a method selected from the group consisting of gene mutation, gene knockout, gene interruption, RNA interference, gene editing technology, and introduction of gene or protein inhibitors.

[0073] In another preferred embodiment, the reduction or inhibition of the expression and / or activity of the ABCD1 gene or its protein is achieved by a method selected from the group consisting of gene mutation, gene knockout, gene interruption, RNA interference, gene editing technology, and introduction of gene or protein inhibitors.

[0074] In another preferred embodiment, the plants include crops, forestry plants, vegetables, fruits, flowers, and forage grasses (including lawn grasses).

[0075] In another preferred embodiment, the plant includes monocotyledonous plants and dicotyledonous plants; preferably, the plant is a dicotyledonous plant.

[0076] In another preferred embodiment, the plant is derived from one or more plants selected from the following groups: Cruciferae, Poaceae, Leguminosae, Solanaceae, Cucurbitaceae, Chenopodiaceae, Polygonaceae, Pedulaceae, Asteraceae, Malvaceae, Rosaceae, Pedulaceae, Convolvulaceae, Dioscorea, Apiaceae, Liliaceae, and Zingiberaceae.

[0077] In another preferred embodiment, the plant is derived from one or more plants selected from the group consisting of Arabidopsis, rice, tobacco, tomato, potato, corn, cotton, soybean, alfalfa, sorghum, barley, wheat, millet, sweet potato, quinoa, lettuce, rapeseed, cabbage, spinach, beet, peanut, watermelon, cabbage, strawberry, or a combination thereof.

[0078] In another preferred embodiment, the plant is selected from Arabidopsis, rice, tobacco, tomato, potato, corn, cotton, soybean, and peanut.

[0079] In another preferred embodiment, the amino acid sequence of ABCD2 has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity compared to SEQ ID No. 1.

[0080] In another preferred embodiment, the amino acid sequence of ABCD1 has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity compared to SEQ ID No. 2.

[0081] In another preferred example, the ABCD2 gene includes cotton gene LOC107946680 (Genbank), or potato gene LOC102581284 (Genbank), or tobacco gene LOC107798686 (Genbank), or tomato gene 101256258 (Genbank), or peanut LOC107458888 (Genbank).

[0082] In another preferred embodiment, the ABCD1 gene comprises cotton gene LOC107913671 (Genbank), or cotton gene LOC107945455 (Genbank), or cotton gene LOC107925489 (Genbank), or cotton gene LOC107946680 (Genbank), or potato gene LOC102587630 (Genbank), or potato gene LOC102581284 (Genbank), or potato gene LOC102601060 (Genbank), or potato gene 102577604 (Genbank), or tobacco gene LOC107770907 (Genbank), or tobacco gene 107801433 (Genbank), or Tobacco gene LOC107801232 (Genbank), or tobacco gene LOC107798686 (Genbank), or Nicotiana tabacum gene LOC104217649 (Genbank), or Nicotiana tabacum gene LOC104230823 (Genbank), or tomato gene 101260717 (Genbank), or tomato gene 101256258 (Genbank), or tomato gene 101247740 (Genbank), or tomato gene 101261549 (Genbank), or peanut gene LOC107631658 (Genbank), or peanut gene LOC112715182 (Genbank), or peanut gene LOC112783718 (Genbank).

[0083] In another preferred example, the tolerance of the plant in which the expression and / or activity of the ABCD2 gene or the protein encoded by the ABCD2 gene is inhibited to the maximum concentration of the herbicide 2,4-D butyrate is increased by at least 1.1 times, preferably at least 2 times, preferably at least 3 times, preferably at least 4 times, preferably at least 5 times, preferably at least 6 times, and preferably at least 10 times, compared with the wild-type plant.

[0084] In another preferred example, the tolerance of the plant in which the expression and / or activity of the ABCD1 gene or the protein encoded by the ABCD1 gene is inhibited to the maximum concentration of the herbicide 2,4-D butyrate is increased by at least 1.1 times, preferably at least 2 times, preferably at least 3 times, preferably at least 4 times, preferably at least 5 times, preferably at least 6 times, and preferably at least 10 times, compared with the wild-type plant.

[0085] On the other hand, the present invention provides a plant cell, plant tissue, plant part, or plant that is resistant / tolerant to the herbicide 2,4-D butyrate, wherein the plant cell, plant tissue, plant part, or plant is obtained by reducing or inhibiting the expression level and / or activity of the ABCD2 gene or the protein encoded by the ABCD2 gene in the plant.

[0086] In another preferred embodiment, the plant cell, plant tissue, plant part, or plant is obtained by reducing or inhibiting the expression level and / or activity of the ABCD1 gene or the protein encoded by the ABCD1 gene in the plant.

[0087] In another preferred embodiment, the reduction or inhibition of the expression and / or activity of the ABCD2 gene or its protein is achieved by a method selected from the group consisting of gene mutation, gene knockout, gene interruption, RNA interference, gene editing technology, and introduction of gene or protein inhibitors.

[0088] In another preferred embodiment, the reduction or inhibition of the expression and / or activity of the ABCD1 gene or its protein is achieved by a method selected from the group consisting of gene mutation, gene knockout, gene interruption, RNA interference, gene editing technology, and introduction of gene or protein inhibitors.

[0089] In another preferred embodiment, the plants include crops, forestry plants, vegetables, fruits, flowers, and forage grasses (including lawn grasses).

[0090] In another preferred embodiment, the plant includes monocotyledonous plants and dicotyledonous plants; preferably, the plant is a dicotyledonous plant.

[0091] In another preferred embodiment, the plant is derived from one or more plants selected from the following groups: Cruciferae, Poaceae, Leguminosae, Solanaceae, Cucurbitaceae, Chenopodiaceae, Polygonaceae, Pedulaceae, Asteraceae, Malvaceae, Rosaceae, Pedulaceae, Convolvulaceae, Dioscorea, Apiaceae, Liliaceae, and Zingiberaceae.

[0092] In another preferred embodiment, the plant is derived from one or more plants selected from the group consisting of Arabidopsis, rice, tobacco, tomato, potato, corn, cotton, soybean, alfalfa, sorghum, barley, wheat, millet, sweet potato, quinoa, lettuce, rapeseed, cabbage, spinach, beet, peanut, watermelon, cabbage, strawberry, or a combination thereof.

[0093] In another preferred embodiment, the plant is selected from Arabidopsis, rice, tobacco, tomato, potato, corn, cotton, soybean, and peanut.

[0094] In another preferred embodiment, the amino acid sequence of ABCD2 has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity compared to SEQ ID No. 1.

[0095] In another preferred embodiment, the amino acid sequence of ABCD1 has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity compared to SEQ ID No. 2.

[0096] In another preferred example, the ABCD2 gene includes cotton gene LOC107946680 (Genbank), or potato gene LOC102581284 (Genbank), or tobacco gene LOC107798686 (Genbank), or tomato gene 101256258 (Genbank), or peanut LOC107458888 (Genbank).

[0097] In another preferred embodiment, the ABCD1 gene comprises cotton gene LOC107913671 (Genbank), or cotton gene LOC107945455 (Genbank), or cotton gene LOC107925489 (Genbank), or cotton gene LOC107946680 (Genbank), or potato gene LOC102587630 (Genbank), or potato gene LOC102581284 (Genbank), or potato gene LOC102601060 (Genbank), or potato gene 102577604 (Genbank), or tobacco gene LOC107770907 (Genbank), or tobacco gene 107801433 (Genbank), or Tobacco gene LOC107801232 (Genbank), or tobacco gene LOC107798686 (Genbank), or Nicotiana tabacum gene LOC104217649 (Genbank), or Nicotiana tabacum gene LOC104230823 (Genbank), or tomato gene 101260717 (Genbank), or tomato gene 101256258 (Genbank), or tomato gene 101247740 (Genbank), or tomato gene 101261549 (Genbank), or peanut gene LOC107631658 (Genbank), or peanut gene LOC112715182 (Genbank), or peanut gene LOC112783718 (Genbank).

[0098] In another preferred embodiment, the method is used to confer / enhance resistance / tolerance to the herbicide 2,4-D butyrate on plants.

[0099] In another preferred example, the tolerance of the plant in which the expression and / or activity of the ABCD2 gene or the protein encoded by the ABCD2 gene is inhibited to the maximum concentration of the herbicide 2,4-D butyrate is increased by at least 1.1 times, preferably at least 2 times, preferably at least 3 times, preferably at least 4 times, preferably at least 5 times, preferably at least 6 times, and preferably at least 10 times, compared with the wild-type plant.

[0100] In another preferred example, the tolerance of the plant in which the expression and / or activity of the ABCD1 gene or the protein encoded by the ABCD1 gene is inhibited to the maximum concentration of the herbicide 2,4-D butyrate is increased by at least 1.1 times, preferably at least 2 times, preferably at least 3 times, preferably at least 4 times, preferably at least 5 times, preferably at least 6 times, and preferably at least 10 times, compared with the wild-type plant.

[0101] In another aspect, the present invention provides a plant that is resistant / tolerant to the herbicide 2,4-D butyrate, wherein the plant is obtained by breeding plant cells, plant tissues, or plant parts in which the expression level and / or activity of the protein encoded by the ABCD21 gene or the ABCD2 gene in the plant is reduced or inhibited.

[0102] In another preferred embodiment, the plant is obtained by propagating plant cells, plant tissues, or plant parts in which the expression level and / or activity of the ABCD1 gene or the protein encoded by the ABCD1 gene in the plant is reduced or inhibited.

[0103] In another preferred embodiment, the plants include crops, forestry plants, vegetables, fruits, flowers, and forage grasses (including lawn grasses).

[0104] In another preferred embodiment, the plant includes monocotyledonous plants and dicotyledonous plants; preferably, the plant is a dicotyledonous plant.

[0105] In another preferred embodiment, the plant is derived from one or more plants selected from the following groups: Cruciferae, Poaceae, Leguminosae, Solanaceae, Cucurbitaceae, Chenopodiaceae, Polygonaceae, Pedulaceae, Asteraceae, Malvaceae, Rosaceae, Pedulaceae, Convolvulaceae, Dioscorea, Apiaceae, Liliaceae, and Zingiberaceae.

[0106] In another preferred embodiment, the plant is derived from one or more plants selected from the group consisting of Arabidopsis, rice, tobacco, tomato, potato, corn, cotton, soybean, alfalfa, sorghum, barley, wheat, millet, sweet potato, quinoa, lettuce, rapeseed, cabbage, spinach, beet, peanut, watermelon, cabbage, strawberry, or a combination thereof.

[0107] In another preferred embodiment, the plant is selected from Arabidopsis, rice, tobacco, tomato, potato, corn, cotton, soybean, and peanut.

[0108] In another preferred embodiment, the amino acid sequence of ABCD2 has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity compared to SEQ ID No. 1.

[0109] In another preferred embodiment, the amino acid sequence of ABCD1 has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity compared to SEQ ID No. 2.

[0110] In another preferred example, the ABCD2 gene includes cotton gene LOC107946680 (Genbank), or potato gene LOC102581284 (Genbank), or tobacco gene LOC107798686 (Genbank), or tomato gene 101256258 (Genbank), or peanut LOC107458888 (Genbank).

[0111] In another preferred embodiment, the ABCD1 gene comprises cotton gene LOC107913671 (Genbank), or cotton gene LOC107945455 (Genbank), or cotton gene LOC107925489 (Genbank), or cotton gene LOC107946680 (Genbank), or potato gene LOC102587630 (Genbank), or potato gene LOC102581284 (Genbank), or potato gene LOC102601060 (Genbank), or potato gene 102577604 (Genbank), or tobacco gene LOC107770907 (Genbank), or tobacco gene 107801433 (Genbank), or Tobacco gene LOC107801232 (Genbank), or tobacco gene LOC107798686 (Genbank), or Nicotiana tabacum gene LOC104217649 (Genbank), or Nicotiana tabacum gene LOC104230823 (Genbank), or tomato gene 101260717 (Genbank), or tomato gene 101256258 (Genbank), or tomato gene 101247740 (Genbank), or tomato gene 101261549 (Genbank), or peanut gene LOC107631658 (Genbank), or peanut gene LOC112715182 (Genbank), or peanut gene LOC112783718 (Genbank).

[0112] In another preferred example, the tolerance of the plant in which the expression and / or activity of the ABCD2 gene or the protein encoded by the ABCD2 gene is inhibited to the maximum concentration of the herbicide 2,4-D butyrate is increased by at least 1.1 times, preferably at least 2 times, preferably at least 3 times, preferably at least 4 times, preferably at least 5 times, preferably at least 6 times, and preferably at least 10 times, compared with the wild-type plant.

[0113] In another preferred example, the tolerance of the plant in which the expression and / or activity of the ABCD1 gene or the protein encoded by the ABCD1 gene is inhibited to the maximum concentration of the herbicide 2,4-D butyrate is increased by at least 1.1 times, preferably at least 2 times, preferably at least 3 times, preferably at least 4 times, preferably at least 5 times, preferably at least 6 times, and preferably at least 10 times, compared with the wild-type plant.

[0114] In another preferred embodiment, the plant is obtained by the following steps: regenerating the genetically engineered plant tissues, plant cells, and plant parts prepared by the method into a plant body, thereby obtaining a genetically engineered plant.

[0115] In another aspect, the present invention provides a method for preparing a hybrid plant, comprising the step of hybridizing a plant obtained by propagating a plant cell, plant tissue, or plant part that is resistant / tolerant to the herbicide 2,4-D butyrate with other plants to prepare a hybrid plant.

[0116] In another preferred embodiment, the plants include crops, forestry plants, vegetables, fruits, flowers, and forage grasses (including lawn grasses).

[0117] In another preferred embodiment, the plant includes monocotyledonous plants and dicotyledonous plants; preferably, the plant is a dicotyledonous plant.

[0118] In another preferred embodiment, the plant is derived from one or more plants selected from the following groups: Cruciferae, Poaceae, Leguminosae, Solanaceae, Cucurbitaceae, Chenopodiaceae, Polygonaceae, Pedulaceae, Asteraceae, Malvaceae, Rosaceae, Pedulaceae, Convolvulaceae, Dioscorea, Apiaceae, Liliaceae, and Zingiberaceae.

[0119] In another preferred embodiment, the plant is derived from one or more plants selected from the group consisting of Arabidopsis, rice, tobacco, tomato, potato, corn, cotton, soybean, alfalfa, sorghum, barley, wheat, millet, sweet potato, quinoa, lettuce, rapeseed, cabbage, spinach, beet, peanut, watermelon, cabbage, strawberry, or a combination thereof.

[0120] In another preferred embodiment, the plant is selected from Arabidopsis, rice, tobacco, tomato, potato, corn, cotton, soybean, and peanut.

[0121] In another aspect, the present invention provides a method of controlling unwanted vegetation at a plant cultivation site, the method comprising:

[0122] (1) Providing a plant in which the expression and / or activity of the ABCD2 gene or the protein encoded by the ABCD2 gene is suppressed at the cultivation site; preferably, providing a plant in which the expression and / or activity of the ABCD1 gene or the protein encoded by the ABCD1 gene is suppressed at the cultivation site.

[0123] (2) Cultivating the plants and applying an effective amount of the herbicide 2,4-D butyrate to the cultivation site.

[0124] In one embodiment, the unwanted plants are weeds.

[0125] In another preferred embodiment, the plants include crops, forestry plants, vegetables, fruits, flowers, and forage grasses (including lawn grasses).

[0126] In another preferred embodiment, the plant includes monocotyledonous plants and dicotyledonous plants; preferably, the plant is a dicotyledonous plant.

[0127] In another preferred embodiment, the plant is derived from one or more plants selected from the following groups: Cruciferae, Poaceae, Leguminosae, Solanaceae, Cucurbitaceae, Chenopodiaceae, Polygonaceae, Pedulaceae, Asteraceae, Malvaceae, Rosaceae, Pedulaceae, Convolvulaceae, Dioscorea, Apiaceae, Liliaceae, and Zingiberaceae.

[0128] In another preferred embodiment, the plant is derived from one or more plants selected from the group consisting of Arabidopsis, rice, tobacco, tomato, potato, corn, cotton, soybean, alfalfa, sorghum, barley, wheat, millet, sweet potato, quinoa, lettuce, rapeseed, cabbage, spinach, beet, peanut, watermelon, cabbage, strawberry, or a combination thereof.

[0129] In another preferred embodiment, the plant is selected from Arabidopsis, rice, tobacco, tomato, potato, corn, cotton, soybean, and peanut.

[0130] In another preferred embodiment, the amino acid sequence of ABCD2 has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity compared to SEQ ID No. 1.

[0131] In another preferred embodiment, the amino acid sequence of ABCD1 has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity compared to SEQ ID No. 2.

[0132] In another preferred example, the ABCD2 gene includes cotton gene LOC107946680 (Genbank), or potato gene LOC102581284 (Genbank), or tobacco gene LOC107798686 (Genbank), or tomato gene 101256258 (Genbank), or peanut LOC107458888 (Genbank).

[0133] In another preferred embodiment, the ABCD1 gene comprises cotton gene LOC107913671 (Genbank), or cotton gene LOC107945455 (Genbank), or cotton gene LOC107925489 (Genbank), or cotton gene LOC107946680 (Genbank), or potato gene LOC102587630 (Genbank), or potato gene LOC102581284 (Genbank), or potato gene LOC102601060 (Genbank), or potato gene 102577604 (Genbank), or tobacco gene LOC107770907 (Genbank), or tobacco gene 107801433 (Genbank), or Tobacco gene LOC107801232 (Genbank), or tobacco gene LOC107798686 (Genbank), or Nicotiana tabacum gene LOC104217649 (Genbank), or Nicotiana tabacum gene LOC104230823 (Genbank), or tomato gene 101260717 (Genbank), or tomato gene 101256258 (Genbank), or tomato gene 101247740 (Genbank), or tomato gene 101261549 (Genbank), or peanut gene LOC107631658 (Genbank), or peanut gene LOC112715182 (Genbank), or peanut gene LOC112783718 (Genbank).

[0134] In another aspect, the present invention also provides a method for controlling weed growth near plants, comprising:

[0135] a) providing the above-mentioned plants resistant to the herbicide 2,4-D butyrate;

[0136] b) applying an effective amount of a herbicide to the plants and weeds in the vicinity of the plants, thereby controlling the weeds in the vicinity of the plants.

[0137] In one embodiment, the herbicide 2,4-D butyrate (also known as 2,4-D butyric acid, 2,4-DB) has the following chemical formula:

[0138]

[0139] In another preferred embodiment, the plants include crops, forestry plants, vegetables, fruits, flowers, and forage grasses (including lawn grasses).

[0140] In another preferred embodiment, the plant includes monocotyledonous plants and dicotyledonous plants; preferably, the plant is a dicotyledonous plant.

[0141] In another preferred embodiment, the plant is derived from one or more plants selected from the following groups: Cruciferae, Poaceae, Leguminosae, Solanaceae, Cucurbitaceae, Chenopodiaceae, Polygonaceae, Pedulaceae, Asteraceae, Malvaceae, Rosaceae, Pedulaceae, Convolvulaceae, Dioscorea, Apiaceae, Liliaceae, and Zingiberaceae.

[0142] In another preferred embodiment, the plant is derived from one or more plants selected from the group consisting of Arabidopsis, rice, tobacco, tomato, potato, corn, cotton, soybean, alfalfa, sorghum, barley, wheat, millet, sweet potato, quinoa, lettuce, rapeseed, cabbage, spinach, beet, peanut, watermelon, cabbage, strawberry, or a combination thereof.

[0143] In another preferred embodiment, the plant is selected from Arabidopsis, rice, tobacco, tomato, potato, corn, cotton, soybean, and peanut.

[0144] In another preferred example, the tolerance of the plant in which the expression and / or activity of the ABCD2 gene or the protein encoded by the ABCD2 gene is inhibited to the maximum concentration of the herbicide 2,4-D butyrate is increased by at least 1.1 times, preferably at least 2 times, preferably at least 3 times, preferably at least 4 times, preferably at least 5 times, preferably at least 6 times, and preferably at least 10 times, compared with the wild-type plant.

[0145] In another preferred example, the tolerance of the plant in which the expression and / or activity of the ABCD1 gene or the protein encoded by the ABCD1 gene is inhibited to the maximum concentration of the herbicide 2,4-D butyrate is increased by at least 1.1 times, preferably at least 2 times, preferably at least 3 times, preferably at least 4 times, preferably at least 5 times, preferably at least 6 times, and preferably at least 10 times, compared with the wild-type plant.

[0146] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one.

[0147] General Definition:

[0148] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0149] The terms "polynucleotide," "nucleotide sequence," "nucleic acid sequence," "nucleic acid molecule," and "nucleic acid" are used interchangeably and include DNA, RNA, or hybrids thereof, which may be double-stranded or single-stranded.

[0150] The term "homology" or "identity" is used to refer to the matching of sequences between two polypeptides or between two nucleic acids. Therefore, the compositions and methods of the present invention also include homologs of the nucleotide sequences and polypeptide sequences of the present invention. "Homology" can be calculated by known methods including, but not limited to, Computational Molecular Biology (Lesk, A.M., ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, D.W., ed.) Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I (Griffin, A.M. and Griffin, H.G., eds.) Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton, NJ (1993). Stockton Press, New York (1991).

[0151] Specific amino acid positions (numbers) within the proteins of the present invention are determined by aligning the amino acid sequence of the target protein with SEQ ID No. 1 or SEQ ID No. 2 using standard sequence alignment tools, such as the Smith-Waterman algorithm or the CLUSTALW2 algorithm, wherein the sequences are considered aligned when the alignment score is the highest. The alignment score can be calculated according to the method described in Wilbur, WJ and Lipman, DJ (1983) Rapid similarity searches of nucleic acid and protein data banks. Proc. Natl. Acad. Sci. USA, 80: 726-730. The default parameters for the ClustalW2 (1.82) algorithm are preferably used: protein gap open penalty = 10.0; protein gap extension penalty = 0.2; protein matrix = Gonnet; protein / DNA end gap = -1; protein / DNAGAPDIST = 4. Preferably, the AlignX program (part of the vectorNTI group) is used to determine the position of specific amino acids in the protein of the present invention by aligning the amino acid sequence of the protein with SEQ ID No. 1 or SEQ ID No. 2 using default parameters suitable for multiple alignment (gap opening penalty: 10 log gap extension penalty 0.05).

[0152] The term "encode" refers to the inherent property of a particular nucleotide sequence in a polynucleotide, such as a gene, cDNA, or mRNA, to serve as a template for the synthesis of other polymers and macromolecules in a biological process having a defined nucleotide sequence (i.e., rRNA, tRNA, and mRNA) or a defined amino acid sequence and the resulting biological properties. Thus, a gene encodes a protein if transcription and translation of the mRNA corresponding to that gene produces the protein in a cell or other biological system.

[0153] The term "amino acid" refers to a carboxylic acid containing an amino group. Various proteins in living organisms are composed of 20 basic amino acids.

[0154] The terms "protein," "polypeptide," and "peptide" are used interchangeably herein to refer to a polymer of amino acid residues, including polymers in which one or more amino acid residues is a chemical analog of a naturally occurring amino acid residue. The proteins and polypeptides of the present invention can be produced recombinantly or by chemical synthesis.

[0155] In the present invention, amino acid residues can be represented by single letters or three letters, for example: alanine (Ala, A), valine (Val, V), glycine (Gly, G), leucine (Leu, L), glutamine (Gln, Q), phenylalanine (Phe, F), tryptophan (Trp, W), tyrosine (Tyr, Y), aspartic acid (Asp, D), asparagine (Asn, N), glutamic acid (Glu, E), lysine (Lys, K), methionine (Met, M), serine (Ser, S), threonine (Thr, T), cysteine ​​(Cys, C), proline (Pro, P), isoleucine (Ile, I), histidine (His, H), arginine (Arg, R).

[0156] The term "regulatory element," also known as a "regulatory element," as used herein, is intended to include promoters, terminator sequences, leader sequences, polyadenylation sequences, signal peptide coding regions, marker genes, enhancers, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences), which are described in detail in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, CA (1990). In some cases, regulatory elements include those that direct constitutive expression of a nucleotide sequence in many types of host cells and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). Tissue-specific promoters can primarily direct expression in the desired tissue of interest, such as muscle, neurons, bone, skin, blood, specific organs (e.g., liver, pancreas), or special cell types (e.g., lymphocytes). In some cases, regulatory elements can also direct expression in a temporally dependent manner (e.g., in a cell cycle-dependent or developmental stage-dependent manner), which may or may not be tissue- or cell-type-specific. In some cases, the term "regulatory element" encompasses enhancer elements such as WPRE; CMV enhancer; R-U5' fragment in the LTR of HTLV-I ((Mol. Cell. Biol., Vol. 8(1), pp. 466-472, 1988); SV40 enhancer; and intron sequences between exons 2 and 3 of rabbit β-globin (Proc. Natl. Acad. Sci. USA., Vol. 78(3), pp. 1527-31, 1981).

[0157] The term "promoter" has a meaning well known to those skilled in the art and refers to a non-coding nucleotide sequence located upstream of a gene that can initiate expression of a downstream gene. A constitutive promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in a cell under most or all physiological conditions of the cell. An inducible promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell essentially only when an inducer corresponding to the promoter is present in the cell. A tissue-specific promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell essentially only when the cell is a cell of the tissue type corresponding to the promoter.

[0158] The term "nuclear localization signal" or "nuclear localization sequence" (NLS) is an amino acid sequence that "tags" proteins for import into the cell nucleus via nuclear transport. That is, proteins with an NLS are transported to the cell nucleus. Typically, an NLS comprises a positively charged Lys or Arg residue exposed on the protein surface. Exemplary NLSs include, but are not limited to, NLSs from the SV40 large T antigen, EGL-13, c-Myc, and TUS proteins.

[0159] The term "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the one or more regulatory elements in a manner that allows for expression of the nucleotide sequence (e.g., in an in vitro transcription / translation system or in a host cell when the vector is introduced into the host cell).

[0160] The term "vector" refers to a vector that contains elements that allow the vector to be integrated into the host cell genome or to replicate autonomously within the cell independently of the genome. The vector may contain any elements that ensure self-replication. It usually carries genes that are not part of the central metabolism of the cell and is usually in the form of double-stranded DNA. The choice of vector usually depends on the compatibility of the vector with the host cell into which the vector is to be introduced. If a vector is used, the choice of vector depends on methods well known to those skilled in the art for transforming host cells. For example, a plasmid vector can be used.

[0161] Vectors suitable for use in the present invention include commercially available plasmids such as, but not limited to, pBR322 (ATCC 37017), pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden), GEM1 (Promega Biotec, Madison, WI, USA), pQE70, pQE60, pQE-9 (Qiagen), pD10, psiX174, pBluescript IIKS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene), ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia), pKK232-8, pCM7, pSV2CAT, pOG44, pXT1, pSG (Stratagene), pSVK3, pBPV, pMSG, and pSVL (Pharmacia).

[0162] The nucleic acid sequence, nucleic acid construct or expression vector of the present invention can be introduced into the host cell by a variety of techniques, including transformation, transfection, transduction, viral infection, gene gun or Ti-plasmid-mediated gene delivery, as well as calcium phosphate transfection, DEAE-dextran-mediated transfection, lipofection or electroporation.

[0163] The term "ABCD protein" refers to an ATP binding cassette transporter. In Arabidopsis thaliana, genes encoding ABCD proteins include ABCD1 and ABCD2.

[0164] The ABCD1 gene, also known as peroxisomal ABC transporter 1, acetate non-utilizing 2, ACN2, Arabidopsis thaliana ATP-binding cassette D1, AtABCD1, ATP-binding cassette D1, COMATOSE, CTS, PED3, peroxisomal ABC transporter 1, PEROXISOMEDEFECTIVE3, PXA1, T5J17.20, and T5J17_20, encodes a peroxisomal protein of the ATP-binding cassette transporter class (PMP subfamily) that shares significant homology with the human X-linked adrenoleukodystrophy protein (ALDP). This gene product promotes germination and inhibits embryonic dormancy. ABI3, ABA1, FUS3, and LEC1 act epistatically on this gene. Mutations in this gene lead to accumulation of fatty acyl-CoA, indicating a defect in its uptake into peroxisomes. The ABCD1 genes include cotton gene LOC107913671 (Genbank), cotton gene LOC107945455 (Genbank), cotton gene LOC107925489 (Genbank), cotton gene LOC107946680 (Genbank), potato gene LOC102587630 (Genbank), potato gene LOC102581284 (Genbank), potato gene LOC102601060 (Genbank), potato gene 102577604 (Genbank), tobacco gene LOC107770907 (Genbank), tobacco gene LOC107801433 (Genbank). 7801232 (Genbank), tobacco gene LOC107798686 (Genbank), Nicotiana tabacum gene LOC104217649 (Genbank), Nicotiana tabacum gene LOC104230823 (Genbank), tomato gene 101260717 (Genbank), tomato gene 101256258 (Genbank), tomato gene 101247740 (Genbank), tomato gene 101261549 (Genbank), peanut gene LOC107631658 (Genbank), peanut gene LOC112715182 (Genbank), peanut gene LOC112783718 (Genbank) and other homologous genes.In Arabidopsis thaliana, the wild-type ABCD1 gene sequence is shown in SEQ ID NO.: 4, and the amino acid sequence encoded by it is shown in SEQ ID NO.: 2.

[0165] The ABCD2 gene, also known as ABC transporter family protein, ATP-binding cassette D2, AtPMP1, F20D21.17, or F20D21_17, encodes a half-molecule transporter protein involved in fatty acid conversion. ABCD2 genes include cotton gene LOC107946680 (Genbank), potato gene LOC102581284 (Genbank), tobacco gene LOC107798686 (Genbank), tomato gene 101256258 (Genbank), peanut LOC107458888 (Genbank), and other homologous genes. In Arabidopsis thaliana, the wild-type ABCD2 gene sequence is shown in SEQ ID NO.:3, and the encoded amino acid sequence is shown in SEQ ID NO.:1.

[0166] Sources of ABCD genes include ABCD genes or variants thereof from monocotyledonous or dicotyledonous plants, such as Arabidopsis thaliana, rice, cotton, potato, tobacco, tomato, alfalfa, soybean, and peanut. In a preferred embodiment, the nucleotide sequence of the ABCD gene of the present invention is shown in SEQ ID NO.: 3 or 4.

[0167] The ABCD gene of the present invention also includes nucleic acids having 50% or more (preferably 60% or more, 70% or more, 80% or more, more preferably 90% or more, more preferably 95% or more, most preferably 98% or more, such as 99%, or 100%) homology with the preferred gene sequence of the present invention (SEQ ID NO.: 3 or 4), which can also confer / enhance plant resistance / tolerance to the herbicide 2,4-D butyrate.

[0168] In the present invention, the nucleotide sequence of SEQ ID NO.: 3 or 4 may be substituted, deleted, or added with one or more nucleotides to generate a derivative sequence of SEQ ID NO.: 3 or 4. Due to codon degeneracy, even if the sequence has low homology to SEQ ID NO.: 3 or 4, it can still substantially encode the amino acid sequence set forth in SEQ ID NO.: 1 or 2. Furthermore, "a derivative sequence of the nucleotide sequence of SEQ ID NO.: 3 or 4 with at least one nucleotide substitution, deletion, or addition" also includes nucleotide sequences that hybridize with the nucleotide sequence set forth in SEQ ID NO.: 3 or 4 under moderately stringent conditions, and more preferably under highly stringent conditions. These variations include (but are not limited to): deletions, insertions, and / or substitutions of several nucleotides (usually 1-90, preferably 1-60, more preferably 1-20, and most preferably 1-10), and additions of several nucleotides (usually less than 60, preferably less than 30, more preferably less than 10, and most preferably less than 5) at the 5' and / or 3' ends.

[0169] It should be understood that although the genes provided in the examples of the present invention are derived from Arabidopsis thaliana, ABCD gene sequences derived from other similar plants that have a certain homology (e.g., 70% or more, such as 75%, 80%, 85%, 90%, 95% or even 98%, 99%, or 100% sequence identity) with the sequences of the present invention (preferably, the sequences are shown in SEQ ID NO.: 3 or 4) are also included within the scope of the present invention, as long as those skilled in the art can easily isolate and obtain the sequence from other plants based on the information provided in this application after reading this application. Methods and tools for comparing sequence identity are also well known in the art, such as BLAST.

[0170] The present invention also includes ABCD protein fragments and analogs having ABCD protein activity. As used herein, the terms "fragment" and "analog" refer to polypeptides that substantially retain the same biological function or activity as the natural ABCD protein of the present invention.

[0171] The polypeptide fragments, derivatives or analogs of the present invention can be: (i) polypeptides having one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) substituted, and such substituted amino acid residues may or may not be encoded by the genetic code; or (ii) polypeptides having a substituent group in one or more amino acid residues; or (iii) polypeptides formed by fusion of a mature polypeptide with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (iv) polypeptides formed by fusion of an additional amino acid sequence to the polypeptide sequence (such as a leader sequence or secretory sequence or a sequence used to purify the polypeptide or a proprotein sequence, or a fusion protein). According to the definition herein, these fragments, derivatives and analogs fall within the scope well known to those skilled in the art.

[0172] In the present invention, the polypeptide variant is a derivative sequence obtained by substituting, deleting, or adding at least one amino acid to the amino acid sequence of SEQ ID NO.: 1 or 2, or by adding one or more amino acids (usually within 20, preferably within 10, and more preferably within 5) to the C-terminus and / or N-terminus. For example, in the protein, substitution with amino acids having similar or similar properties generally does not alter the function of the protein, and addition of one or more amino acids to the C-terminus and / or N-terminus generally does not alter the function of the protein.

[0173] The present invention also includes analogs of the claimed proteins. The differences between these analogs and the natural SEQ ID NO.: 1 or 2 may be differences in the amino acid sequence, or differences in the form of modifications that do not affect the sequence, or both. Analogs of these proteins include natural or induced genetic variants. Induced variants can be obtained by various techniques, such as random mutagenesis by radiation or exposure to mutagens, or by site-directed mutagenesis or other known biological techniques. Analogs also include analogs with residues different from natural L-amino acids (such as D-amino acids), as well as analogs with non-natural or synthetic amino acids (such as β, γ-amino acids). It should be understood that the proteins of the present invention are not limited to the representative proteins exemplified above.

[0174] The term "2,4-D butyrate", also known as 2,4-D butyric acid, 2,4-DB, is a phenoxycarboxylic acid hormone-type selective herbicide, mainly used to control dicotyledonous weeds such as annual broadleaf weeds and sedge weeds in rice fields. 2,4-D butyrate itself is not toxic to plants, but it relies on ABCD transporters to be transported to peroxisomes and undergoes β-oxidation in the plant body to produce 2,4-D with strong herbicidal activity. Due to differences in β-oxidase activity in different plants, the conversion capacity is different. For example, rice has low β-oxidase activity and cannot metabolize 2,4-D butyrate into 2,4-D, so it will not be harmed; while some weeds have high β-oxidase activity and can metabolize 2,4-D butyrate into 2,4-D, so they are killed. The chemical formula of 2,4-D butyrate is:

[0175]

[0176] The "tolerance" or "resistance" mentioned in the present invention refers to the ability of a plant to withstand herbicides under growth conditions, and can generally be characterized by parameters such as the amount or concentration of the herbicide used. Furthermore, in the present invention, "enhancing the resistance / tolerance of plants to the herbicide 2,4-D butyrate" refers to plants whose tolerance or resistance to the herbicide 2,4-D butyrate is improved compared to plants containing wild parents, and their tolerance concentration is at least 1.1 to 10 times higher than the tolerance concentration of the parent plant. The optimal degree of improved "tolerance" or "resistance" mentioned in the present invention is that at the same amount or concentration of the herbicide used, it can reduce, inhibit or kill unwanted plants without affecting the growth or viability of the plants containing the present invention. In the present invention, "imparting resistance / tolerance to the herbicide 2,4-D butyrate on plants" refers to plants whose wild parent plants have a certain or low tolerance to the herbicide 2,4-D butyrate (at the same herbicide concentration), and by inhibiting the expression and / or activity of the ABCD gene or the protein encoded by the ABCD gene in the plant, thereby imparting a certain degree of herbicide resistance or tolerance to plants that do not have resistance, or improving the tolerance of plants with a certain or low tolerance to the herbicide.

[0177] The term "plant tissue" or "plant part" includes plant cells, protoplasts, plant tissue cultures, plant callus, plant pieces, as well as plant embryos, pollen, ovules, seeds, leaves, stems, flowers, branches, seedlings, fruits, kernels, ears, roots, root tips, anthers, and the like.

[0178] The term "plant cell" is to be understood as any cell from or found in a plant, which is capable of forming, for example, undifferentiated tissue such as callus, differentiated tissue such as embryos, plant components, plants or seeds.

[0179] The term "plant" is to be understood as meaning any differentiated multicellular organism capable of photosynthesis, including crop plants, in particular monocotyledonous or dicotyledonous plants, at any stage of maturity or development, vegetable crops, including artichokes, Brussels sprouts, rocket, leeks, asparagus, lettuce (e.g., head lettuce, leaf lettuce, romaine lettuce), bok choy, yellow taro, melons (e.g., cantaloupe, watermelon, Crenshaw melon, honeydew melon, cantaloupe), oilseed crops (e.g., Brussels sprouts, cabbage, cauliflower, broccoli, kale, kale, Chinese cabbage, bok choy), cardoon, carrot, napa, okra, onion, celery, parsley, chickpeas, parsnips, endive, peppers, potatoes, cucurbits (e.g., zucchini, cucumber, courgette, squash, pumpkin), radish, cabbage, Onions, rutabagas, eggplant (also known as eggplant), salsify, lettuce, shallots, endive, garlic, spinach, green onions, squash, greens, beets (sugar beets and fodder beets), sweet potatoes, Swiss chard, horseradish, tomatoes, turnips, and spices; fruits and / or vines such as apples, apricots, cherries, nectarines, peaches, pears, plums, prunes, cherries, quince, almonds, chestnuts, hazelnuts, pecans, pistachios, walnuts, citrus, blueberries, boysenberries, y), cranberries, currants, loganberries, raspberries, strawberries, blackberries, grapes, avocados, bananas, kiwis, persimmons, pomegranates, pineapples, tropical fruits, pome fruits, melons, mangoes, papayas, and lychees; field crops such as clover, alfalfa, evening primrose, meadowsweet, corn / maize (feed corn, sweet corn, popcorn), hops, jojoba, peanuts, rice, safflower, small grain cereals (barley, oats, rye, wheat, etc.), sorghum, tobacco, kapok, and legumes (beans, lentils, peas, soybeans) , oil plants (rapeseed, mustard, poppy, olive, sunflower, coconut, castor oil plant, cocoa bean, peanut), Arabidopsis, fiber plants (cotton, flax, hemp, jute), Lauraceae (cinnamon, camphor), or a plant such as coffee, sugar cane, tea, and natural rubber plant; and / or bedding plants, such as flowering plants, cacti, succulents and / or ornamental plants, as well as trees such as forests (broadleaf trees and evergreen trees, such as conifers), fruit trees, ornamental trees, and nut-bearing trees, as well as shrubs and other seedlings.

[0180] The term "unwanted plants" is understood to mean plants that interfere with the normal growth of desired plants (e.g., crops) and have no practical or application value, and may include weeds, such as dicotyledonous and monocotyledonous weeds. Dicotyledonous weeds include, but are not limited to, weeds of the genera Sinapis, Lepidium, Galium, Stellaria, Matricaria, Anthemis, Galinsoga, Chenopodium, Urtica, Senecio, Amaranthus, Portulaca, Xanthium, Convolvulus, Ipomoea, Polygonum, Sesbania, Ambrosia, and These include sedge, lycoris, cycad, dandelion, iris, iris, sedge, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family, sedge family,Monocotyledonous weeds include, but are not limited to, weeds of the genera Echinochloa, Setaria, Panicum, Digitaria, Phleum, Poa, Festuca, Eleusine, Brachiaria, Lolium, Bromus, Avena, Cyperus, Sorghum, Agropyron, and Cyperus. The undesirable plants may include plants of the genera Cynodon, Monochoria, Fimbristyslis, Sagittaria, Eleocharis, Scirpus, Paspalum, Ischaemum, Sphenoclea, Dactyloctenium, Agrostis, Alopecurus, and Apera. The undesirable plants may also include plants other than the desired cultivated plants, such as parts of rice grown naturally in rice cultivation areas or small amounts of crops such as soybeans.

[0181] The term "gene editing" technology includes CRISPR technology, TALEN technology, and ZFN technology. CRISPR technology refers to clustered, regularly interspaced short palindromic repeats, which come from the immune system of microorganisms. Among them, gene editing tools include guideRNA, Cas proteins (such as Cas9, Cpf1, Cas12b, etc.). The gene editing tool referred to in TALEN technology is a restriction enzyme that can cut a specific DNA sequence, which includes a TAL effector DNA binding domain and a DNA cleavage domain. The gene editing tool referred to in ZFN technology is also a restriction enzyme that can cut a specific DNA sequence, which includes a zinc finger DNA binding domain and a DNA cleavage domain. It is well known to those skilled in the art that by constructing the nucleotides encoding the gene editing tool and other regulatory elements into a suitable vector and then transforming the cell, the editing of the genome in the cell can be achieved. The types of editing include gene knockout, insertion, and base editing.

[0182] As used herein, the term "gene editing enzyme" refers to nucleases suitable for editing tools such as CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats), TALEN (Transcription Activator-like (TAL) effector nuclease technology), and ZFN (Zinc finger nuclease technology). Preferably, the gene editing enzyme is a CRISPR enzyme, also known as a Cas protein, and its types include but are not limited to: Cas9 protein, Cas12 protein, Cas13 protein, Cas14 protein, Csm1 protein, and FDK1 protein. The Cas protein refers to a family of proteins, which may have different structures depending on their sources, such as SpCas9 derived from Streptococcus pyogenes, SaCas9 derived from Staphylococcus aureus; it may also be classified according to structural features (such as domains), such as the Cas12 family including Cas12a (also known as Cpf1), Cas12b, Cas12c, Cas12i, etc. The Cas protein may have double-stranded or single-stranded or no cutting activity. The Cas protein of the present invention may be a wild type or a mutant thereof, and the mutant type of the mutant includes amino acid replacement, substitution or deletion, and the mutant may or may not change the enzymatic activity of the Cas protein. As known to those skilled in the art, a variety of Cas proteins with nucleic acid cleavage activity reported in the prior art, the known protein or its modified variants can achieve the function of the present invention, and are herein incorporated by reference into the scope of protection.

[0183] As used herein, the terms "guide RNA," "mature crRNA," and "guide sequence" are used interchangeably and have meanings generally understood by those skilled in the art. In general, a guide RNA can comprise, consist essentially of, or consist of a direct repeat sequence and a guide sequence (also referred to as a spacer in the context of an endogenous CRISPR system).

[0184] In some cases, the guide sequence is any polynucleotide sequence that has sufficient complementarity to the target sequence to hybridize with the target sequence and guide the specific binding of the CRISPR / Cas complex to the target sequence. In one embodiment, when optimally aligned, the degree of complementarity between the guide sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. Determining optimal alignment is within the capabilities of those of ordinary skill in the art. For example, there are publicly available and commercially available alignment algorithms and programs, such as, but not limited to, ClustalW, Smith-Waterman algorithm in matlab, Bowtie, Geneious, Biopython, and SeqMan.

[0185] Beneficial effects of the invention:

[0186] (1) The present invention provides a method for imparting / enhancing resistance / tolerance to the herbicide 2,4-D butyrate in plants.

[0187] (2) The present invention has discovered a method for inhibiting the expression or activity of ABCD genes or proteins encoded thereby, thereby conferring or enhancing plant resistance or tolerance to the herbicide 2,4-D. The ABCD genes include the ABCD2 gene and the ABCD1 gene.

[0188] Sequence information

[0189] Serial number describe SEQ ID NO.: 1 ABCD2 amino acid sequence SEQ ID NO.: 2 ABCD1 amino acid sequence SEQ ID NO.: 3 ABCD2 nucleotide sequence SEQ ID NO.: 4 ABCD1 nucleotide sequence SEQ ID NO.: 5 AtABCD1-T1 SEQ ID NO.: 6 AtABCD1-T2 SEQ ID NO.: 7 AtABCD2-T1 SEQ ID NO.: 8 AtABCD2-T2 SEQ ID NO.: 9 AtABCD1-1F SEQ ID NO.: 10 AtABCD1-1R SEQ ID NO.: 11 AtABCD1-2F SEQ ID NO.: 12 AtABCD1-2R SEQ ID NO.: 13 AtABCD2-1F SEQ ID NO.: 14 AtABCD2-1R SEQ ID NO.: 15 AtABCD2-2F SEQ ID NO.: 16 AtABCD2-2R SEQ ID NO.: 17 AtABCD1-3F SEQ ID NO.: 18 AtABCD2-3R SEQ ID NO.: 19 Cas9-jc-F3 SEQ ID NO.: 20 Cas9-jc-R3 SEQ ID NO.: 21 Cas9-jc-F4 SEQ ID NO.: 22 Cas9-jc-R4 SEQ ID NO.: 23 AtABCD1-jc-1F SEQ ID NO.: 24 AtABCD1-jc-1R SEQ ID NO.: 25 AtABCD1-jc-2F SEQ ID NO.: 26 AtABCD1-jc-2R SEQ ID NO.: 27 AtABCD2-jc-1F SEQ ID NO.: 28 AtABCD2-jc-1R SEQ ID NO.: 29 AtABCD2-jc-2F SEQ ID NO.: 30 AtABCD2-jc-2R BRIEF DESCRIPTION OF THE DRAWINGS

[0190] Figure 1 The mutant forms of the ABCD1 gene transformed with the P0950 vector are shown, including the wild-type Col, the ABCD1 single mutant line β5-115, the ABCD1 single mutant line β5-108, and the ABCD1 single mutant line β5-2-4.

[0191] Figure 2 The diagram shows the mutant forms of the ABCD1 gene transformed with the P0951 vector, including the wild-type Col, the ABCD1 single mutant line β6-204, the ABCD1 single mutant line β6-186, and the ABCD1 single mutant line β6-197.

[0192] Figure 3 The mutant forms of the ABCD2 gene transformed with the P0952 vector are shown, including the wild-type Col and the ABCD2 single mutant line β7-305.

[0193] Figure 4The mutant forms of the ABCD2 gene transformed with the P0953 vector are shown, including the wild-type Col, the ABCD2 single mutant line β8-3-1, the ABCD2 single mutant line β8-337, the ABCD2 single mutant line β8-347, and the ABCD2 single mutant line β8-360.

[0194] Figure 5 The mutation types of the ABCD1 gene after transformation with the double mutant vector P2021 are shown, including the wild type Col, the ABCD1 mutation form of the double mutant strain 2021-1-8, the ABCD1 mutation form of the double mutant strain 2021-6-2, the ABCD1 mutation form of the double mutant strain 2021-6-1, the ABCD1 mutation form of the double mutant strain 2021-4-1, and the ABCD1 mutation form of the double mutant strain 2021-4-5.

[0195] Figure 6 The mutation types of the ABCD2 gene after transformation with the double mutant vector P2021 are shown, including the wild type Col, the ABCD2 mutation form of the double mutant strain 2021-1-8, the ABCD2 mutation form of the double mutant strain 2021-6-2, the ABCD2 mutation form of the double mutant strain 2021-6-1, the ABCD2 mutation form of the double mutant strain 2021-4-1, and the ABCD2 mutation form of the double mutant strain 2021-4-5.

[0196] Figure 7 Schematic diagram of the gene editing vector used in this embodiment.

[0197] Figure 8 The figure shows the growth of different edited Arabidopsis strains after 10 days of herbicide spraying. Figure 8 As can be seen from A, most of the wild-type WT Arabidopsis died 10 days after spraying the herbicide; the group of wild-type WT Arabidopsis that was not sprayed with the herbicide grew well; the Arabidopsis in the 2021-6-1 and 2021-6-2 groups could still grow 10 days after spraying the herbicide, but the plants were slightly smaller than the wild-type Arabidopsis that was not sprayed with the herbicide; the growth of the Arabidopsis in the β8-3-1 and β5-108 groups was inhibited 10 days after spraying the herbicide, and the plants were smaller. Figure 8 B and Figure 8 C It can be seen that the growth of wild-type WT Arabidopsis was inhibited 10 days after spraying the herbicide; the Arabidopsis in the three groups of 2021-1-8, 2021-6-2 and 2021-6-1 was slightly inhibited 10 days after spraying the herbicide; the growth of Arabidopsis in the four groups of β5-2-4, β8-3-1, β5-108 and β8-337 was inhibited 10 days after spraying the herbicide, and the plants were smaller.

[0198] Figure 9 A and Figure 9 B shows the growth of different edited Arabidopsis strains 20 days after spraying. Figure 9 A and Figure 9 B shows that 20 days after spraying the wild-type WT Arabidopsis, the growth of the plants was significantly inhibited and most of the plants died; 20 days after spraying the three groups of Arabidopsis 2021-1-8, 2021-4-1 and 2021-6-1, their growth was no different from that of the unsprayed wild-type Arabidopsis; 20 days after spraying the herbicide on the four groups of Arabidopsis β5-108, β5-2-4, β8-3-1 and β8-337, the plants were smaller and their growth was inhibited, but they were larger than the wild-type plants.

[0199] Figure 10 A and Figure 10 B shows the phenotypes of different mutants (wild type WT, ABCD1 single mutant line β5-108, ABCD1 single mutant line β5-2-4, ABCD2 single mutant line β8-337, ABCD2 single mutant line β8-3-1, double mutant line 2021-1-8, double mutant line 2021-6-1, and double mutant line 2021-6-2) cultured in sugar-free medium (-sucrose), MS medium (+sucrose), and 2,4-D butyrate medium (+2,4-DB). The results showed that mutants with double mutations in ABCD1 and ABCD2 were independent of exogenous carbon and sugar-free for germination; mutants with single mutations in ABCD1 or ABCD2 showed weak resistance to 2,4-D butyrate; mutants with double mutations in ABCD1 and ABCD2 showed strong resistance to 2,4-D butyrate.

[0200] Figure 11 A and Figure 11B shows the statistical data of root length of mutants of different mutation types (wild type WT, ABCD1 single mutant line β5-108, ABCD1 single mutant line β5-2-4, ABCD2 single mutant line β8-337, ABCD2 single mutant line β8-3-1, double mutant line 2021-1-8, double mutant line 2021-6-1, double mutant line 2021-6-2) cultured in MS medium (% 1sucrose), sugar-free medium (No sucrose), and 2,4-drop butyrate medium (0.5mM 2,4-DB). In the medium containing sucrose, the length of the seed roots of β5-108, β5-2-4, β8-337, β8-3-1, 2021-1-8, 2021-6-1, 2021-6-2 and the wild type were all between 1.8-2.6 cm. In the MS medium without sucrose, the length of the seed roots of 2021-1-8, 2021-6-1, 2021-6-2 and the wild type WT was between 1.5-2.1 cm. In the MS medium containing 2,4-D butyric acid, the embryonic axis of the wild-type WT seeds elongated about 0.1 cm, the embryonic axis of β5-108 and β5-2-4 seeds elongated between 0.3-0.4 cm, the embryonic axis of β8-337 and β8-3-1 seeds elongated about 0.2 cm, and the embryonic axis of 2021-1-8, 2021-6-1, and 2021-6-2 seeds elongated about 1.7-2 cm. DETAILED DESCRIPTION

[0201] The present invention will be further described below with reference to the following embodiments. The following description is merely a preferred embodiment of the present invention and does not limit the present invention in any other form. Any person skilled in the art may utilize the above disclosed technical content to make equivalent embodiments with equivalent variations. Any simple modification or equivalent variation of the following embodiments made in accordance with the technical essence of the present invention without departing from the content of the present invention shall fall within the scope of protection of the present invention.

[0202] The present invention is further explained in conjunction with the examples of the following experiments. All methods and operations described in these embodiments are provided by way of example and should not be construed as restrictive. The method for the operation of relevant DNA can be referred to Current Protocols in Molecular Biology, Volumes 1 and 2, Ausubel FM Greene Publishing Associates and Wiley Interscience, 1989, Molecular Cloning, T.Maniatis et al., 1982, or Sambrook J. and Russell D., 2001, Molecular Cloning: alaboratory manual, version 3.

[0203] Example 1: Preparation of Arabidopsis ABCD gene-edited strains

[0204] 1. Target design and vector construction

[0205] The genomic sequences and amino acid sequences of the ABCD1 and ABCD2 genes were obtained through the NCBI (https: / / www.ncbi.nlm.nih.gov) website, and target sites were designed for the coding regions of these two genes respectively.

[0206] In this embodiment, Cas9 and sgRNA targeting ABCD1 and ABCD2 were used to edit the ABCD1 gene (the wild-type gene sequence of ABCD1 is shown in SEQ ID NO.: 4, and the amino acid sequence encoded by it is shown in SEQ ID NO.: 2) and the ABCD2 gene (the wild-type gene sequence of ABCD2 is shown in SEQ ID NO.: 3, and the amino acid sequence encoded by it is shown in SEQ ID NO.: 1) in Arabidopsis thaliana. The specific operation method can be carried out according to conventional methods in the art; in this embodiment, the schematic diagram of the constructed gene editing vector is shown in FIG. Figure 7 As shown; among them, ATU6 proThe U6 promoter, gly-tRNA, AtUBQ1 terminator, and NLS are the nuclear localization signals. Vector construction can also refer to the reference (“High-efficiency CRISPR / Cas9 multiplex gene editing using the glycine tRNA-processing system-based strategy in maize”, Weiwei Qi et al., BMC Biotechnology, 2016).

[0207] Specifically, in this embodiment, gRNA was designed using Target Design (http: / / skl.scau.edu.cn / targetdesign / ). The ABCD1 gene contains 25 exons and 24 introns, encoding an ABC (ATP-binding cassette) transporter 1, which is required for the transport of fatty acids and 2,4-D butyrate to peroxisomes for β-oxidation. We designed gRNAs for exon 2 and exon 21 of ABCD1:

[0208] AtABCD1-T1: GACGCGAAGAATCAGGCCTC (SEQ ID NO.: 5) and

[0209] AtABCD1-T2:GGTAAGTCTCCACATACAG (SEQ ID NO.:6).

[0210] ABCD2 has 9 exons and 8 introns, encoding ATP-binding cassette transporter 2. We designed gRNAs in the first and seventh exons of ABCD2 respectively:

[0211] AtABCD2-T1: ACGGCGGCGAGACGAAGCC (SEQ ID NO.:7)

[0212] AtABCD2-T2: GTGGAGGAGACGACACCTGG (SEQ ID NO.:8).

[0213] 1.1 The specific construction method of single-target vector is as follows:

[0214] 1) Use primer pairs

[0215] AtABCD1-1F: GATTGACGCGAAGAATCAGGCCTC (SEQ ID NO.:9), and

[0216] AtABCD1-1R:AAACACCATCCACAGTGTGATATTC (SEQ ID NO.:10);

[0217] AtABCD1-2F: GATTGGTAAGTCTCCACATACAG (SEQ ID NO.:11), and

[0218] AtABCD1-2R: AAACTGCCTAATCTCTGTTGCTCC (SEQ ID NO.:12);

[0219] AtABCD2-1F: GATTGACGGCGGCGAGACGAAGCC (SEQ ID NO.:13), and

[0220] AtABCD2-1R:AAACGGCTTCGTCTCGCCCGCGTC (SEQ ID NO.:14);

[0221] AtABCD2-2F: GATTGTGGAGGAGACGACACCTGG (SEQ ID NO.:15), and

[0222] AtABCD2-2R:AAACCCAGGTGTCGTCTCCTCCAC (SEQ ID NO.:16);

[0223] Perform annealing connection.

[0224] 2) The plasmid 1300-psgR-Cas9BP (P0276) was digested with BsaI, and a fragment of about 15 Kb was recovered from the gel after digestion.

[0225] 3) The recovered vectors and annealed products were subjected to T4 ligation to form the final vectors P0950, P0951, P0952, and P0953.

[0226] 1.2 The specific construction method of the dual-target vector is as follows:

[0227] 1) Using primer pairs

[0228] AtABCD1-3F:

[0229] TAGGTCTCTTGCAGACGCGAAGAATCAGGCCTCGTTTTAGAGCTAGAAATAGCA AGT (SEQ ID NO.:17), and

[0230] AtABCD2-3R:

[0231] TAGGTCCTAAACCCAGGTGTCGTCTCCTCCACTGCACCAGCCGGGAATCG (SEQ ID NO.: 18);

[0232] Plasmid P0055 was used as template for amplification, and the fragments of about 200 bp were recovered by tapping, namely AtABCD1-T1 & AtABCD2-T1;

[0233] 2) The recovered fragments were digested with BsaI and recovered using a kit;

[0234] 3) The backbone vector P1957 was digested with BsaI to recover a 15Kb fragment;

[0235] 4) AtABCD1-T1 & AtABCD2-T1 were linked to P1957 to construct the final vector P2021. P2021 targets the first target site of the ABCD1 gene and the second target site of ABCD2, thereby simultaneously knocking out both genes.

[0236] 1.3 Transform into Trans-T1, culture on Kan plates, pick 6 colonies for liquid culture for 2 hours, perform PCR bacterial liquid detection, select 2 correct monoclonal clones, and send the bacterial liquid for testing.

[0237] 1.4 Select the single clone with correct sequencing for expansion, bacterial preservation, and plasmid extraction.

[0238] 2. Genetic transformation

[0239] 2.1 Transformation of Agrobacterium

[0240] The vector in 1 was transformed into Agrobacterium tumefaciens strain GV3101 by heat shock method, and a single clone was picked, cultured in liquid and identified by PCR, and then stored in a -80°C refrigerator for future use.

[0241] 2.2 Bacteria activation

[0242] Take out the bacteria from the -80 refrigerator, streak them on YEP solid culture medium, and culture them in the dark at 28℃. Usually, colonies will grow in 1 to 2 days. Take the colonies and spread them on new YEP plates and culture them in the dark at 28℃. The bacteria on the plates will grow well in 12 to 24 hours.

[0243] 2.3 Preparation of Agrobacterium infection solution

[0244] Pick a single colony from the newly activated plate, add it to 5 ml of resistance culture medium, and incubate it on a shaker at 28°C for 24 hours. Aspirate the activated Agrobacterium solution at a rate of 1 / 1000 and add it to 300 ml of resistance culture medium. Incubate overnight with shaking until the OD value reaches 0.8-1.5. Incubate at 4000 rpm for 15 minutes at room temperature, then harvest the cells. Resuspend the cells in an equal volume of 5% sucrose solution. Add auxiliary reagents such as Silwet L-77 to a final concentration of 0.03%.

[0245] 2.4 Infection

[0246] Tilt the Arabidopsis plant so that the inflorescence is immersed in the culture dish containing the bacterial solution for 1 minute. Cover the transformed plant with a black plastic bag and remove it the next day.

[0247] 3. Mutant screening

[0248] After the transformed Arabidopsis matures, the fruit pods (T0 generation seeds) are harvested. These seeds are placed in sterilized EP tubes and then spread onto a culture medium containing hygromycin. Because transgenic Arabidopsis seeds grow normally on plates, while germination and root growth of non-transgenic seeds are inhibited by hygromycin, transgenic and non-transgenic seeds can be clearly distinguished on the plates.

[0249] Some seeds will be inhibited by hygromycin. Only transgenic positive seedlings can grow on all plates. The seedlings that can grow normally and grow roots are transferred to soil for cultivation. These seedlings are sampled and DNA is extracted. For plants transformed with P0950, P0951, P0952, P0953, and P2021 vectors, primer pairs are used.

[0250] Cas9-jc-F3:CAGAAAGAGCGAGGAAAACCA (SEQ ID NO.:19), and

[0251] Cas9-jc-R3: CCTCAAACAGTGTCAGGGTCA (SEQ ID NO.: 20);

[0252] Cas9-jc-F4: atatcgtgcctcagagctttc (SEQ ID NO.: 21), and

[0253] Cas9-jc-R4: aactcgctttccagcttaggg (SEQ ID NO.:22);

[0254] Once again determine the positive seedlings, and use primer pairs to identify these positive seedlings.

[0255] AtABCD1-jc-1F: TTCGTTTGGGCTCAGATTTC (SEQ ID NO.:23), and

[0256] AtABCD1-jc-1R:CCCGACTATTGGCCGTAA(SEQ ID NO.:24);

[0257] AtABCD1-jc-2F: GGAAAAGCCTGCTCGTCA (SEQ ID NO.:25), and

[0258] AtABCD1-jc-2R: TGCCTACAATACGAACCAAGTC (SEQ ID NO.: 26);

[0259] AtABCD2-jc-1F: AAGTTGCTATGGCTATGTGGG (SEQ ID NO.:27), and

[0260] AtABCD2-jc-1R: TACAGAGGGAGGAGCGTGAG (SEQ ID NO.: 28);

[0261] AtABCD2-jc-2F: TATATGACAAGGATCACCTACTGG (SEQ ID NO.:29), and

[0262] AtABCD2-jc-2R:ACTGGACCACTCGTGTATCG(SEQ ID NO.:30);

[0263] Amplify the corresponding fragments of the ABCD1 and ABCD2 genes, respectively. Sequence the amplified products using the Sanger method to confirm the editing pattern. If the sequencing results show double peaks, ligate the PCR product into a T vector and select five clones for sequencing to confirm the editing pattern.

[0264] Arabidopsis transformed with the P0950 vector yielded:

[0265] The editing result of the edited strain β5-115 was a 33bp deletion at 1023-1055nt of the ABCD1 gene, with 11 amino acids reduced at the deletion site.

[0266] The editing result of the edited strain β5-108 is that after the 1022nd nt of the ABCD1 gene, 30bp are inserted, and the 19bp of the original ABCD1 gene from 1023 to 1041nt are deleted. Then, 1bp is inserted after the 1046th nt of the original gene, and SNP mutations are generated at 1049th and 1053rd nt of the original ABCD1 gene. The SNP mutation at position 1049 changes the amino acid encoded by it from Gly to Asp. The SNP mutation at position 1053 does not cause an amino acid change, but causes a change in the subsequent amino acids and forms a stop codon TGA in the new CDS region 1026-1028nt (1025-1027nt of the original ABCD1 gene), which will lead to the premature termination of protein translation.

[0267] The editing strain β5-2-4 resulted in a 28-bp deletion in the 1001-1028 nt region of the ABCD1 gene, which resulted in a change in the subsequent amino acids and the formation of a stop codon, TGA, in the new CDS region 1054-1056 nt (1082-1084 nt of the original ABCD1 gene). This will lead to premature termination of protein translation.

[0268] The specific editing methods of editing strains β5-115, β5-108, and β5-2-4 can be found in Figure 1 , where Col is the wild type.

[0269] Arabidopsis thaliana transformed with vector P0951 yielded:

[0270] The editing result of the β6-204 strain was an insertion of 3 bp and a deletion of 9 bp after nt 7357 of the ABCD1 gene, resulting in an insertion of one amino acid and a deletion of two amino acids.

[0271] In the edited strain β6-186, a T was inserted after nt 7358 of the ABCD1 gene. This resulted in changes in the subsequent amino acids and the formation of a stop codon, TGA, in the new CDS region at nt 7489-7491 (nt 7488-7490 of the original ABCD1 gene), leading to premature termination of protein translation.

[0272] The editing result of the β6-197 strain was a 6-bp deletion at 7355-7360 nt in the ABCD1 gene, resulting in a 2-amino acid deletion;

[0273] The specific editing methods of editing strains β6-204, β6-186, and β6-197 can be found in Figure 2 , where Col is the wild type.

[0274] Arabidopsis transformed with vector P0952 yielded:

[0275] In the edited strain β7-305, a 1bp insertion occurred after nt 319 of the ABCD2 gene, altering the subsequent amino acids and forming a stop codon, TAG, at nt 365-367 of the new CDS region (nt 364-366 of the original ABCD2 gene). This resulted in premature termination of protein translation.

[0276] The specific editing method of editing strain β7-305 can be found in Figure 3 , where Col is the wild type.

[0277] Arabidopsis thaliana transformed with vector P0953 yielded:

[0278] The editing result of the β8-337 strain was the insertion of 1 bp after nt 2700 of the ABCD2 gene, which changed the subsequent amino acid sequence and formed a stop codon TAA in the new CDS region 2792-2712 nt (2791-2711 nt of the original ABCD2 gene), which would lead to the premature termination of protein translation.

[0279] In the edited strain β8-347, a 1-bp insertion occurred after nt 2699 of the ABCD2 gene, altering the subsequent amino acid sequence and forming a TAA stop codon at nt 2792-2712 of the new CDS region (nt 2791-2711 of the original ABCD2 gene), leading to premature termination of protein translation.

[0280] The editing result of the β8-360 strain was a 10-bp deletion at 2690-2699 nt in the ABCD2 gene, which changed the subsequent amino acid sequence and formed a stop codon TGA at 2847-2849 nt in the new CDS region (2857-2859 nt in the original ABCD2 gene), which would lead to the premature termination of protein translation.

[0281] The editing result of the β8-3-1 strain was a deletion of 29 bp from 2674 to 2702 nt of the ABCD2 gene, which resulted in a change in the subsequent amino acid sequence and the formation of a stop codon TAA in the new CDS region from 2680 to 2682 nt (2709 to 2711 nt of the original ABCD2 gene);

[0282] The specific editing methods of editing strains β8-337, β8-347, β8-360, and β8-3-1 can be found in Figure 4 , where Col is the wild type.

[0283] Arabidopsis transformed with the dual-target vector P2021 yielded:

[0284] The double-mutant editing line, 2021-1-8, resulted in a 1-bp insertion after nt 1022 of the ABCD1 gene and a 16-base deletion at nt 2687-2702 of the ABCD2 gene, achieving simultaneous knockout of both genes.

[0285] The double-mutant editing strain 2021-6-2 resulted in an 8-base deletion at position 1023-1030 in the ABCD1 gene and a deletion at position 2699 in the ABCD2 gene, achieving simultaneous knockout of both genes.

[0286] The double-mutant editing strain 2021-6-1 had a 31-base deletion at position 1023-1053 of the ABCD1 gene and a deletion of base 2699 of the ABCD2 gene. This was the same as the ABCD2 gene editing result of 2021-6-2, achieving simultaneous knockout of both genes.

[0287] The double-mutant editing strain 2021-4-1 resulted in an insertion of one base at 1022 in the ABCD1 gene and a deletion of 27 bases at 2699-2725 nt in the ABCD2 gene, achieving simultaneous knockout of both genes.

[0288] The double-mutant editing strain 2021-4-5 resulted in a 5-base deletion at 1023-1027 nt in the ABCD1 gene and a 29-base deletion at 2674-2702 nt in the ABCD2 gene, achieving simultaneous knockout of both genes.

[0289] For the specific editing methods of the ABCD1 gene in the edited strains 2021-1-8, 2021-6-2, 2021-6-1, 2021-4-1, and 2021-4-5, see Figure 5 , the specific editing method of ABCD2 gene can be found in Figure 6 , where Col is the wild type.

[0290] Table 1. Strain editing types

[0291]

[0292]

[0293] Example 2: Resistance experiment to the herbicide 2,4-D butyrate

[0294] 1. Herbicide spraying experiment:

[0295] First, plant Arabidopsis in a 10*10 cm square. When the Arabidopsis grows two true leaves and four green leaves are visible, spray each square with 3 ml of 1 mg / mL 2,4-D butyric acid. After spraying, observe the growth status of the different edited strains of Arabidopsis.

[0296] Figure 8 A shows the growth of different edited Arabidopsis strains 10 days after spraying. Most of the wild-type WT Arabidopsis died 10 days after spraying with the herbicide. The group of wild-type WT Arabidopsis that was not sprayed with the herbicide grew well. The Arabidopsis in the 2021-6-1 and 2021-6-2 groups can still grow 10 days after spraying with the herbicide, but the plants are slightly smaller than the wild-type Arabidopsis in the group that was not sprayed with the herbicide. After 10 days of spraying with the herbicide, the growth of the Arabidopsis in the β8-3-1 and β5-108 groups was inhibited and the plants were smaller.

[0297] Figure 8 B and Figure 8 C shows the growth of the different edited Arabidopsis strains 10 days after spraying. Wild-type WT Arabidopsis showed growth inhibition 10 days after spraying with the herbicide. Arabidopsis strains from the 2021-1-8, 2021-6-2, and 2021-6-1 groups showed mild growth inhibition 10 days after spraying with the herbicide. Arabidopsis strains from the β5-2-4, β8-3-1, β5-108, and β8-337 groups showed growth inhibition and smaller plants 10 days after spraying with the herbicide.

[0298] Figure 9 A and Figure 9 B shows the growth of different edited Arabidopsis strains 20 days after spraying:

[0299] Figure 9 A is the comparison of the growth of different edited Arabidopsis strains. Figure 10 B is a comparison of the growth of multiple different edited lines of Arabidopsis thaliana.

[0300] from Figure 9 A shows that 20 days after spraying the wild-type WT Arabidopsis, the plants were smaller and their growth was inhibited; 20 days after spraying the 2021-1-8 Arabidopsis, its growth was no different from that of the unsprayed wild-type Arabidopsis; 20 days after spraying the herbicide on the β8-3-1 and β5-108 groups of Arabidopsis, the plants were smaller and their growth was inhibited, but they were larger than the plants in the wild-type spraying group.

[0301] from Figure 9B shows that 20 days after spraying the wild-type WT Arabidopsis, the growth of the plants was significantly inhibited and most of the plants died, indicating that the wild-type Arabidopsis does not have herbicide resistance; 20 days after spraying the three groups of Arabidopsis 2021-1-8, 2021-4-1 and 2021-6-1, the growth was no different from that of the unsprayed wild-type Arabidopsis, indicating that the ABCD1 and ABCD2 double mutant strains of Arabidopsis have 2,4-D butyrate resistance; 20 days after spraying the four groups of Arabidopsis β5-108, β5-2-4, β8-3-1 and β8-337 with herbicides, the plants were smaller and their growth was inhibited, but larger than the wild-type plants, indicating that the ABCD1 single mutant strain or the ABCD2 single mutant strain of Arabidopsis contains partial 2,4-D butyrate resistance.

[0302] Overall, most wild-type Arabidopsis plants died three days after spraying, and those that did not die suffered severe drug damage and could not grow normally; Arabidopsis plants with the ABCD1 single mutant or ABCD2 single mutant did not die, but grew slowly due to drug damage; Arabidopsis plants with the ABCD1 and ABCD2 double mutant did not die, but grew slowly within seven days after spraying, then slowly recovered after seven days and basically returned to normal growth after 20 days.

[0303] 2. Petri dish culture experiment

[0304] Many Arabidopsis mutants involved in β-oxidation, such as ped, pxa, and cts, exhibit growth defects and require exogenous carbon for normal germination. The ABCD genes are involved in β-oxidation. To verify whether mutations in the ABCD1 and ABCD2 genes result in growth defects, in this example, germination was observed in a medium without exogenous carbon.

[0305] 2,4-D butyric acid is a systemic herbicide that can be absorbed through the roots, stems and leaves of plants and conducted up and down in the plant body. 2,4-D butyric acid inhibits the elongation of the hypocotyl and root length during seed germination. The resistance of the mutant can be determined by counting the degree of inhibition and the number of Arabidopsis root length inhibition in Arabidopsis culture medium.

[0306] The Arabidopsis seeds of different edited types (wild type WT, β5-115, β5-108, β5-2-4, β6-204, β6-186, β6-197, β7-305, β8-337, β8-347, β8-360, β8-3-1, 2021-1-8, 2021-6-1, 2021-6-2, 2021-4-1, 2021-4-5) were sterilized and dried. They were then cultured in MS medium, MS medium containing 1% sucrose, and MS medium containing 0.5 mM 2,4-D butyric acid and 1% sucrose for 3 days, and then moved to a 22°C culture room for 7 days to observe the germination.

[0307] Figure 10 A and Figure 10 B shows the embryonic axis elongation of Arabidopsis seeds in each group under different culture medium conditions:

[0308] In the MS medium containing 1% sucrose (i.e., +sucrose), the seed embryo axes of β5-108, β5-2-4, β8-337, β8-3-1, 2021-1-8, 2021-6-1, 2021-6-2 and wild type WT were all elongated, and there was no difference in the elongation length among the groups, indicating that each group had normal germination and normal embryo axis elongation in the culture medium containing exogenous carbon.

[0309] In sucrose-free MS medium (i.e., -sucrose), the embryonic axes of seeds from 2021-1-8, 2021-6-1, 2021-6-2, and the wild-type WT all elongated, with no difference in elongation length among the groups. This suggests that the mutant lines with double mutations in both the ABCD1 and ABCD2 genes are independent of exogenous carbon and sugar during germination.

[0310] In MS medium containing 2,4-D butyrate and sucrose (i.e., +2,4-DB), the elongation of the seed embryonic axis of the wild type WT was shorter and the roots were also shorter; the elongation of the seed embryonic axis of β5-108 and β5-2-4 was shorter, but the elongation length was longer than that of the wild type; the elongation of the seed embryonic axis of β8-337 and β8-3-1 was shorter; the elongation of the seed embryonic axis of 2021-1-8, 2021-6-1, and 2021-6-2 was longer, significantly longer than that of the wild type. The results showed that wild-type Arabidopsis seeds do not have 2,4-D butyrate resistance, which affects the germination process; Arabidopsis seeds of ABCD1 single mutant lines (β5-108, β5-2-4) and ABCD2 single mutant lines (β8-337, β8-3-1) have weak 2,4-D butyrate resistance, and the germination process is inhibited to a certain extent; ABCD1 and ABCD2 double mutant lines (β2021-1-8, 2021-6-1, 2021-6-2) have strong 2,4-D butyrate resistance, and the germination process is basically not inhibited.

[0311] Figure 11 A and Figure 11 B is the statistics of root length of Arabidopsis seeds in each group under different culture medium conditions:

[0312] according to Figure 11 A It can be seen that in the MS medium containing 10 mg / ml sucrose (1% sucrose), the seed root lengths of β5-108, β5-2-4, β8-337, β8-3-1, 2021-1-8, 2021-6-1, 2021-6-2 and wild type WT are all between 1.8-2.6 cm, indicating that the elongation of the embryonic axis in each group is normal and consistent.

[0313] according to Figure 11 As can be seen from A, in the MS medium without sucrose (No sucrose), the seminal root lengths of 2021-1-8, 2021-6-1, 2021-6-2 and the wild type WT were between 1.5 and 2.1 cm, indicating that the elongation of the hypocotyls of the ABCD1 and ABCD2 double mutant lines was normal in the medium without sucrose.

[0314] In MS medium (0.5 mM 2,4-DB) containing 2,4-D butyric acid and sucrose, the embryonic axis of the wild-type WT seeds elongated about 0.1 cm, the embryonic axis of β5-108 and β5-2-4 seeds elongated between 0.3-0.4 cm, the embryonic axis of β8-337 and β8-3-1 seeds elongated about 0.2 cm, and the embryonic axis of 2021-1-8, 2021-6-1, and 2021-6-2 seeds elongated about 1.7-2 cm. The results showed that wild-type Arabidopsis seeds do not have 2,4-D butyrate resistance, which affects the germination process; Arabidopsis seeds of ABCD1 single mutant lines (β5-108, β5-2-4) and ABCD2 single mutant lines (β8-337, β8-3-1) have weak 2,4-D butyrate resistance, and the germination process is inhibited to a certain extent; ABCD1 and ABCD2 double mutant lines (β2021-1-8, 2021-6-1, 2021-6-2) have strong 2,4-D butyrate resistance, and the germination process is basically not inhibited.

[0315] In addition, editing of the ABCD1 and ABCD2 genes in rice, tobacco, tomato, potato, corn, soybean, and wheat has yielded plants with single ABCD1 and ABCD2 mutations, as well as double ABCD1 and ABCD2 knockouts and reduced gene expression. Resistance experiments in these mutant plants to the herbicide 2,4-D have also shown that single ABCD1 and ABCD2 mutant lines exhibit a certain degree of 2,4-D resistance, while double ABCD1 and ABCD2 mutant lines exhibit a stronger resistance.

[0316] All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and that such equivalents also fall within the scope of the claims appended hereto.

Claims

1. A method for imparting resistance or tolerance to the herbicide 2,4-D butyrate (2,4-DB) in plants or enhancing the resistance or tolerance of plants to the herbicide 2,4-D butyrate, characterized in that: The method comprises any one or more steps of the following groups (a)-(b): (a) reducing the expression level of the ABCD2 (ATP-binding cassette D2) gene in the plant; (b) reducing or inhibiting the expression level or activity of the protein encoded by the ABCD2 gene in the plant; Said (a) and (b) are achieved by homozygous mutation of ABCD2 gene, said mutation leading to complete loss of ABCD2 function; The method further comprises any one or more steps of the following groups (c) to (d): (c) reducing the expression level of the ABCD1 (ATP-binding cassette D1) gene in the plant; (d) reducing or inhibiting the expression level or activity of the protein encoded by the ABCD1 gene in the plant; Said (c) and (d) are achieved by homozygous mutation of ABCD1 gene, said mutation leading to complete loss of ABCD1 function; The plant is selected from Arabidopsis thaliana, tobacco, tomato, potato, and soybean.

2. The method according to claim 1, characterized in that Said step (a), (b), (c) or (d) is achieved by one or more methods selected from the group consisting of gene mutation, gene knockout, RNA interference, and introduction of gene or protein inhibitors.

3. The method according to claim 1, characterized in that The steps (a), (b), (c) or (d) are achieved by gene editing technology.

4. A composition, complex or carrier system for conferring / enhancing resistance / tolerance of a plant to the herbicide 2,4-D butyrate, characterized in that: The composition, complex or vector system is used to reduce the expression level of the ABCD2 gene in the plant, or reduce or inhibit the expression level or activity of the protein encoded by the ABCD2 gene in the plant, thereby causing the complete loss of the ABCD2 function; the composition, complex or vector system is also used to reduce the expression level of the ABCD1 gene in the plant, or reduce or inhibit the expression level or activity of the protein encoded by the ABCD1 gene in the plant, thereby causing the complete loss of the ABCD1 function; The plant is selected from Arabidopsis thaliana, tobacco, tomato, potato, and soybean.

5. Use of the composition, complex or carrier system according to claim 4 for imparting / enhancing resistance / tolerance to the herbicide 2,4-D butyrate in plants, or for preparing a reagent or kit for imparting / enhancing resistance / tolerance to the herbicide 2,4-D butyrate in plants; The plant is selected from Arabidopsis thaliana, tobacco, tomato, potato, and soybean.

6. A method for preparing a plant cell, plant tissue, or plant that is resistant / tolerant to the herbicide 2,4-D butyrate, characterized in that: The method comprises the steps of reducing the expression level of the ABCD2 gene in the plant cell, plant tissue, or plant, or reducing or inhibiting the expression level or activity of the protein encoded by the ABCD2 gene in the plant cell, plant tissue, or plant; The method further comprises reducing the expression level of the ABCD1 gene in the plant cell, plant tissue, or plant, or reducing or inhibiting the expression level or activity of the protein encoded by the ABCD1 gene in the plant cell, plant tissue, or plant; The functions of ABCD2 and ABCD1 are completely lost; The plant is selected from Arabidopsis thaliana, tobacco, tomato, potato, and soybean.

7. A method for preparing a hybrid plant, comprising the step of hybridizing the plant obtained by the method of claim 6 with another plant to prepare a hybrid plant.

8. A method for controlling unwanted vegetation at a plant cultivation site, characterized in that The method comprises: (1) Providing the plant obtained by the method of claim 6 at the cultivation site; (2) Cultivating the plants and applying an effective amount of the herbicide 2,4-D butyrate to the cultivation site.

Images