A method for breeding pollenless and seedless black cottonwood and sgRNAs used in the method

By using CRISPR/Cas9 gene editing technology, the YHS gene of male American black poplar trees was knocked out and the MIXTA gene was edited, solving the problems of flying catkins and pollen pollution in American black poplar trees. This resulted in the cultivation of a new variety of American black poplar trees that do not produce flying catkins or pollen, thus maintaining the quality of the wood.

CN116218898BActive Publication Date: 2026-07-24NANJING FORESTRY UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NANJING FORESTRY UNIV
Filing Date
2023-02-24
Publication Date
2026-07-24

AI Technical Summary

Technical Problem

Current technologies for poplar fluff and pollen pollution in Central America pose serious risks to the environment and human health, and existing methods are insufficient to effectively address issues such as poplar sex conversion and fluff development.

Method used

Using CRISPR/Cas9 gene editing technology, the YHS gene specific to male poplar trees was knocked out, and the MIXTA gene was edited to achieve sex conversion of poplar trees, preventing them from producing pollen and inhibiting the development of poplar catkins. The poplar trees were genetically transformed using a specific sgRNA sequence.

Benefits of technology

A new variety of American black poplar that does not produce fluff or pollen has been successfully bred, solving the problems of environmental pollution and health impacts while maintaining the excellent quality of the timber.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116218898B_ABST
    Figure CN116218898B_ABST
Patent Text Reader

Abstract

The application discloses a method for cultivating non-flying-silk and pollen-free Populus deltoides and sgRNA used in the method, and belongs to the technical field of biotechnology and plant genetic engineering. The application analyzes specific sequences on Y chromosome monomer of male Populus deltoides, designs conservative sgRNAs targeting the Y specific sequences (YHS), and realizes effective editing of the Y specific sequences in the male Populus deltoides by using CRISPR technology, so as to promote gender conversion of the Populus deltoides, edit genes for regulating development of Populus deltoides silk, and create new germplasm of non-flying-silk and pollen-free Populus deltoides. The application provides an effective tool for creating new varieties of non-flying-silk and pollen-free Populus deltoides by using gene editing technology, and overcomes flying-silk and pollen pollution of Populus deltoides, and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of biotechnology and plant genetic engineering. Specifically, it relates to a method for cultivating non-pollen-producing American black poplar and the sgRNAs used therein. Background Technology

[0002] my country boasts the world's largest area of ​​planted poplar forests. According to the 9th National Forest Resources Inventory, as of 2018, my country's planted poplar forest area reached 7.57 million hectares, playing a vital role in addressing the contradiction between timber supply and demand and safeguarding national timber and ecological security. Southern poplars, represented by the American black poplar (Populus deltoides), are particularly popular due to their rapid growth, large timber volume, resistance to various adverse environmental factors, and especially their excellent timber quality. Since their initial introduction to my country in 1972, this species has been rapidly planted in the vast plains between 29° and 37° north latitude, receiving significant attention, especially in the Jianghuai and Yangtze River mid-lower reaches plains, thus promoting the development of poplar introduction and cultivation and fast-growing, high-yield forest bases in my country.

[0003] Poplar trees are typically dioecious plants, with female trees producing large amounts of fluff after flowering, causing serious environmental pollution. These fluffs also consume significant amounts of nutrients, impacting timber production. As an important afforestation species in my country, recent years have seen a focus on breeding male poplar varieties to combat fluff pollution, particularly American black poplar males, which have been widely selected and promoted due to their rapid growth and superior timber quality. However, male poplars also produce large amounts of pollen during their flowering period, and large-scale planting can also pollute the environment and negatively impact human health. Therefore, when using poplars for afforestation or greening, it is crucial to consider both the strong ecological and economic benefits of poplars and the control of seasonal fluff and pollen pollution. Utilizing advanced scientific and technological methods to breed new American black poplar varieties that produce no fluff or pollen is of great significance.

[0004] Studies have shown that the dioecious nature of American black poplar involves a specific sequence (YHS) located on the Y chromatid of male plants, containing two sex-determining genes: a male-promoting gene (MSL) and a female-suppressing gene (FERR-R). These two genes independently act on the development of male or female flowers. The male-specific male-promoting gene MSL in American black poplar does not encode a protein but acts as a miRNA sponge, adsorbing miRNAs and upregulating the expression of downstream target genes by reducing the concentration of adsorbed free miRNAs. The MSL gene exists in a hemizygous form in male poplar plants, located only on the Y chromatid; the X chromatid does not contain this gene. The male-promoting gene causes male flowers to develop in male poplar plants. Similarly, the male-specific female-suppressing gene FERR-R in American black poplar does not encode a protein but inhibits the expression of the female-promoting gene FERR in male poplar plants by producing siRNAs that methylate the promoter sequence of the female-promoting gene FERR and cleave its transcript.

[0005] Poplar fluff is a type of fibrous material produced by female poplar trees and attached to the surface of seeds. The fibers are approximately 9.5–15.9 mm long and 8–11 μm in diameter. The fluff adheres to the seed surface primarily to facilitate seed dispersal after seed maturity. Scanning electron microscopy revealed that poplar fluff develops from placental epidermal hairs and is mainly regulated by the MIXTA gene. Editing the poplar MIXTA gene using CRISPR / Cas9 technology showed that female poplar trees no longer produce fluff after pollination, successfully breeding a new poplar variety that does not produce fluff.

[0006] With the development of the American black poplar industry, the pollution and social harm caused by poplar catkins and pollen are becoming increasingly serious. If, through CRISPR / Cas9 gene editing combined with American black poplar genetic transformation technology, the male-specific YHS-related gene could be specifically knocked out in American black poplar, causing it to lose its function and thus achieving sex reversal and preventing pollen production, while simultaneously editing the MIXTA gene that regulates catkin development, it would be of great significance for obtaining new American black poplar varieties that do not produce catkins or pollen. However, relevant research reports are scarce in existing technologies. Summary of the Invention

[0007] To address the aforementioned technical problems, this invention provides a method for cultivating non-pollen-producing and pollen-free American black poplar. By knocking out the YHS gene specific to male American black poplar trees, the poplar undergoes sex reversal and ceases pollen production. Simultaneously, the MIXTA gene, which regulates poplar fluff development, is edited, resulting in poplars that neither produce pollen nor fluff. Another technical problem this invention aims to solve is providing a set of conserved sgRNA sequences for knocking out the YHS gene in male American black poplar trees to select new non-pollen-producing and pollen-free varieties.

[0008] The technical solution adopted in this invention is as follows:

[0009] A method for cultivating non-pollen-producing American black poplar involves knocking out the YHS gene in male poplars to eliminate its function, thus achieving sex reversal and preventing pollen production. Simultaneously, the MIXTA gene, which regulates the development of poplar catkins, is edited to obtain non-pollen-producing American black poplars.

[0010] The method described above for achieving poplar sex conversion to prevent pollination uses CRISPR / Cas9 technology to knock out male YHS trees.

[0011] The method for achieving poplar sex conversion to prevent pollination uses sgRNA sequences sgRNA-1, sgRNA-2, and sgRNA-3 in CRISPR / Cas9 technology. The nucleotide sequence of sgRNA-1 is shown in SEQ ID NO.1, the nucleotide sequence of sgRNA-2 is shown in SEQ ID NO.2, and the nucleotide sequence of sgRNA-3 is shown in SEQ ID NO.3.

[0012] The method described for achieving poplar sex conversion to prevent pollination involves introducing a CRISPR / Cas9 vector containing a conserved sgRNA sequence that knocks out the male YHS gene into American black poplar cells, tissues, or organs through genetic transformation for cultivation. This process edits the YHS gene in the male American black poplar, causing it to lose its function.

[0013] A method for knocking out the YHS of male poplar trees involves introducing a CRISPR / Cas9 vector containing a conserved sgRNA sequence for knocking out the YHS of male poplar trees into American poplar cells, tissues, or organs through genetic transformation for cultivation, thereby editing the YHS of male poplar trees to achieve the knockout of the YHS of male poplar trees.

[0014] The method for knocking out male poplar YHS plants, wherein the sgRNA sequences are sgRNA-1, sgRNA-2 and sgRNA-3, the nucleotide sequence of sgRNA-1 is shown in SEQ ID NO.1, the nucleotide sequence of sgRNA-2 is shown in SEQ ID NO.2 and the nucleotide sequence of sgRNA-3 is shown in SEQ ID NO.3.

[0015] Application of sgRNAs in the cultivation of non-pollen-producing American black poplar; the sgRNAs include sgRNA-1, sgRNA-2 and sgRNA-3, the nucleotide sequence of sgRNA-1 is shown in SEQ ID NO.1, the nucleotide sequence of sgRNA-2 is shown in SEQ ID NO.2, and the nucleotide sequence of sgRNA-3 is shown in SEQ ID NO.3.

[0016] The application described uses primer combinations with nucleotide sequences such as SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10 to construct a CRISPR / Cas9 vector; the CRISPR / Cas9 vector is introduced into American black poplar cells, tissues or organs for cultivation through genetic transformation, and the YHS of American black poplar male plants is edited to cause loss of gene function.

[0017] Application of sgRNAs in knocking out male poplar YHS; the sgRNAs include sgRNA-1, sgRNA-2 and sgRNA-3, the nucleotide sequence of sgRNA-1 is shown in SEQ ID NO.1, the nucleotide sequence of sgRNA-2 is shown in SEQ ID NO.2 and the nucleotide sequence of sgRNA-3 is shown in SEQ ID NO.3.

[0018] This invention analyzes specific sequences on the Y-chromosomal of male poplar trees, designs conserved sgRNAs targeting the YHS, and utilizes CRISPR technology to simultaneously and effectively edit two sex-determining genes (the male-promoting gene MSL and the female-suppressing gene FERR-R) in poplar, inducing sex change and preventing pollen production. Simultaneously, it edits the MIXTA gene, which regulates poplar catkin development, creating a new poplar germplasm that is free of catkins and pollen. This invention provides an effective tool for creating a breakthrough new variety of American black poplar that is free of catkins and pollen using gene editing technology, overcoming the problems of catkin and pollen pollution, and has broad application prospects.

[0019] The application includes the following steps:

[0020] 1) Prepare a CRISPR / Cas9 vector containing conserved sgRNA sequences of male American poplar YHS.

[0021] 2) Using the genetic transformation system of American black poplar, the YHS gene of male American black poplar trees was edited to cause loss of gene function;

[0022] 3) Breed and screen transgenic materials with inactivated YHS genes in male plants to obtain pollen-free American black poplar plants. At the same time, screen transgenic materials with inactivated MIXTA genes to obtain new American black poplar germplasm that does not produce fluff and has no pollen.

[0023] Compared with existing technologies, this invention discloses for the first time a method for breeding new varieties of American black poplar that are free of catkins and pollen. By editing the YHS (yellow chromatid) of male American black poplar trees, the sex of the male poplar trees is reversed, preventing pollen production. Simultaneously, the MIXTA gene, which regulates catkin development, is edited, ensuring timber quality while achieving a catkin-free and pollen-free American black poplar variety. This invention is the first to identify a set of conserved sgRNA sequences in American black poplar used to knock out two sex-determining genes (the male-promoting gene MSL and the female-suppressing gene FERR-R) in the YHS of male American black poplar trees, enabling the breeding of new catkin-free and pollen-free varieties. In American black poplar, the YHS is located on the Y chromatid of the male tree, promoting the development of male flowers. Using a CRISPR / Cas9 gene editing vector containing these sgRNA sequences, effective editing of the YHS can be achieved in American black poplar through genetic transformation. The transgenic American black poplar trees with edited YHS are sex-reversed and no longer produce pollen, which is of great significance for the creation of new catkin-free and pollen-free varieties of American black poplar. Attached Figure Description

[0024] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the accompanying drawings used in the description of the specific embodiments will be briefly introduced below.

[0025] Figure 1 This is a flowchart for breeding new varieties of American black poplar that do not produce fluff or pollen. X and Y chromatid structure analysis showed that the SLR-Y fragment revealed that a specific fragment (YHS) on the Y chromatid contains two sex-determining genes: the male-promoting gene MSL and the female-suppressing gene FERR-R.

[0026] Figure 2 This is a distribution map of sgRNAs in the YHS of male American black poplar trees.

[0027] Figure 3 This is a diagram and expression frame of a CRISPR / Cas9 vector containing conserved sgRNA sequences of male YHS.

[0028] Figure 4Agarose gel electrophoresis images of CRISPR / Cas9 vector construction. (A) sgRNA-1 was ligated to the intermediate vector DT1T2 using overlap PCR, with a PCR product size of 603 bp. (B) sgRNA-2 and sgRNA-3 were ligated to the intermediate vector DT2T3, with a PCR product size of 613 bp. (C) Two intermediate vectors containing three sgRNAs were ligated to the backbone vector PKSE401 using the Golden Gate reaction. The reaction products were transformed into E. coli, and after KAN resistance selection and spec reverse selection, positive clones were shaken for bacterial culture PCR detection, with a PCR product size of 659 bp. (D) Agarose gel electrophoresis was used to detect the plasmid size of the positive clones, and the results showed that the plasmid size was correct. Detailed Implementation

[0029] The present invention will be further described below with reference to specific embodiments. Molecular biology experimental methods not specifically described in the following embodiments can be performed according to the methods listed in J. Sambrook's *Molecular Cloning: A Laboratory Manual* (3rd Edition) or conventional methods in the art, or according to the kit and product instructions.

[0030] Example 1

[0031] (1) Methods for breeding new varieties of American black poplar that do not produce fluff or pollen

[0032] American black poplar is dioecious. A specific sequence (YHS) located on the Y chromosome of male plants contains two sex-determining genes: a male-promoting gene (MSL) and a female-suppressing gene (FERR-R). Effective editing of the YHS can weaken or suppress the male-promoting function of the MSL gene and the female-suppressing function of the FERR-R gene, preventing male flower development and thus achieving sex reversal in the poplar. Simultaneously, editing the MIXTA gene, which regulates the initiation of poplar catkin development, can effectively suppress catkin production, resulting in a new American black poplar variety that produces neither catkins nor pollen after reaching sexual maturity. Figure 1 ).

[0033] (2) Design of conserved sgRNAs from male Populus alba strains in the Americas for CRISPR / Cas9

[0034] Whole-genome analysis was performed on American black poplar (Populus nigra) to select potential PAM sites (NGG) in the YHS region. The sgRNA sequence was the 20 bp immediately upstream of the NGG. To achieve efficient editing of the MSL and FERR-R genes, sgRNA-1 was designed for the MSL gene sequence, and sgRNA-2 and sgRNA-3 for the FERR-R gene sequence. Based on the results of CRISPR-P 2.0 analysis (http: / / crispr.hzau.edu.cn / CRISPR2 / ), and following the principle that the sgRNA sequence should have a GC content of 45%-55% and should not form hairpin structures, the three conserved sgRNAs were finally identified as sgRNA-1, sgRNA-2, and sgRNA-3. The three candidate sgRNA sequences were then BLAST-aligned across the entire genome of American black poplar to ensure sequence specificity. The nucleotide sequence of sgRNA-1 is shown in SEQ ID NO.1, the nucleotide sequence of sgRNA-2 is shown in SEQ ID NO.2, and the nucleotide sequence of sgRNA-3 is shown in SEQ ID NO.3.

[0035] (3) YHS-specific sgRNAs of male American black poplar trees were ligated into a CRISPR / Cas9 vector.

[0036] The backbone vector for CRISPR / Cas9 editing of male YHS was PKSE401. Primer sequences containing three sgRNAs for CRISPR / Cas9 vector construction were synthesized, and their nucleotide sequences are shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.10.

[0037] Based on the primer information, the sgRNA expression cassettes were constructed using overlap PCR. The specific reaction system and procedure are as follows:

[0038] The DT1T2 PCR ligation ① reaction system for 50 μL sgRNA-1 consisted of: 5 μL 10×KOD plus Buffer, 3 μL MgSO4 (25 mM), and 4 μL dNTPs. S (2mM Toyobo), 1μL OD plus (Toyobo), 1μL pCBC-DT1T2 (10ng / μL), 2μL DT1-BsF (10μm), 1μL DT1-F0 (1μm), 2μL DT0-BsR2 (10μm), 31μL ddH2O.

[0039] The reaction program was as follows: 94℃ for 2 min; 94℃ for 15 sec, 60℃ for 30 sec, 68℃ for 1 min, 30 cycles; 68℃ for 5 min.

[0040] DT2T3 ​​PCR ② Ligation of sgRNA-2 and sgRNA-3: The 50 μL reaction system consisted of: 5 μL 10×KOD plus Buffer, 3 μL MgSO4 (25 mM), and 4 μL dNTPs. S (2mM Toyobo), 1μL OD plus (Toyobo), 1μL pCBC-DT2T3 ​​(10ng / μL), 2μL DT2-BsF (10μm), 1μL DT2-F0 (1μm), 1μL DT3-F0 (1μm), 2μL DT3-BsR2 (10μm), 30μL ddH2O.

[0041] The reaction program was as follows: 94℃ for 2 min; 94℃ for 15 sec, 60℃ for 30 sec, 68℃ for 1 min, 30 cycles; 68℃ for 5 min.

[0042] After purifying the PCR products, the sgRNA expression cassettes constructed in the two PCR reactions were simultaneously ligated using the Golden Gate reaction to complete the construction of the three-target knockout vector. The Golden Gate enzyme digestion and ligation reaction system and procedure are as follows:

[0043] 15 μL Golden Gate enzyme digestion and ligation reaction system: 2 μL Purified PCR ① (100 ng / μL), 2 μL Purified PCR ② (100 ng / μL), 2 μL pHSE401 (100 ng / μL), 1.5 μL 10×T4 DNA Ligase Buffer (NEB), 1.5 μL 10×BSA, 1 μL BSAI (NEB), 1 μL 10×T4 DNA Ligase (HC, NEB), 4 μL ddH2O.

[0044] The reaction procedure was: 37℃ for 5 hours; 50℃ for 5 minutes; 80℃ for 10 minutes.

[0045] The constructed PKSE401-YHS vector ( Figure 3 ), transformed into E. coli for colony-linked PCR verification ( Figure 4 Then, sequencing was performed for verification. Plasmids with correct sequencing were further transformed into Agrobacterium, and the bacterial culture was verified by PCR. The bacteria were then preserved in 60% glycerol for subsequent genetic transformation experiments on American poplar.

[0046] (4) Genetic transformation of American black poplar

[0047] 1) Preparation of infection solution: A single colony of Agrobacterium with the successfully constructed CRISPR / Cas9 vector was inoculated into liquid LB medium containing 50 mg / L Kana and 20 mg / L Rif, and cultured at 28°C and 200 rpm for 48 h to prepare a small-scale culture. 1 mL of this small-scale culture was then inoculated into 50 mL of liquid LB medium containing 50 mg / L Kana and 20 mg / L Rif, and cultured until OD (Organic Oxygen Demand) reached the specified concentration. 600 =0.5, centrifuge at 5000 rpm for 15 min, discard the supernatant, collect the bacterial cells, dilute the bacterial block with 50 mL of resuspension containing 100 μMAS (4.43 g / L MS + 30 g / L sucrose) to prepare an infection solution for infection.

[0048] 2) Infection: The infection operation was carried out in a clean bench. Sterile seedlings of American black poplar with good growth were used as experimental materials. Take 2-4 unfolded leaves, remove the petiole and the main vein in the middle, cut off the edges of the leaves with a sterile scalpel, immerse the treated leaves in the infection solution for 20 minutes, then take out the leaves and use sterile paper to absorb the infection solution on the surface of the leaves.

[0049] 3) Dark culture: The infected leaves were placed in the leaf differentiation medium (with 100 μMAS) in Table 4-5 and cultured in the dark in a culture room at 25℃ for 2 days.

[0050] 4) Light culture: Place the dark-cultured leaves into sterile water containing 200 mg / L Cef and soak for 5 min. Blot the surface moisture of the leaves with sterile paper and repeat once. Then place the leaves in the leaf differentiation medium (containing 200 mg / L Cef and 150 mg / L Tim) in Table 4-5 and culture in a 25℃ incubator under light for 7 days.

[0051] 5) Screening culture: The leaves cultured under light were transferred to the leaf differentiation medium in Table 4-5 (with 200 mg / L Cef, 150 mg / L Tim and 50 mg / L Kana) for screening culture. The culture was carried out for about 40 days until callus tissue differentiated. The screening medium was changed every 10 days during the period.

[0052] 6) Inducing shoot elongation: Cut off the differentiated callus tissue with a sterile scalpel and induce shoot elongation using the shoot elongation medium in Table 4-5 (with 200 mg / L Cef, 150 mg / L Tim and 50 mg / L Kana) until adventitious shoots are formed.

[0053] 7) Rooting induction: The adventitious buds were separated into individual buds using a sterile scalpel and transferred to the rooting medium in Table 4-5 (with 200 mg / L Cef, 150 mg / L Tim and 30 mg / L Kana) to induce rooting in resistant plants.

[0054] (5) Identification of transgenic plants and detection of editing sites

[0055] 1) PCR detection of positive plants: Primers were designed using the Cas9 and Kana genes, respectively, and BLAST analysis was performed on the whole genome of American poplar to ensure primer specificity. PCR amplification was performed using DNA from resistant plants selected through Kana screening as templates. The PCR amplification primer sequences for Cas9 are as follows: Cas9-F: 5'-TGAGAACATCGTCATTGAGATGG-3' (SEQ ID NO.11); Cas9-R: 5'-TCAGCTTGTCATTCT

[0056] CATCGTAC-3' (SEQ ID NO.12). Kana-F: 5'-CGATACCGTAAAGCACGAGGAAG-3' (SEQ ID NO.13); Kana-R: 5'-TCACTGAAGCGGGAAGGGACT-3' (SEQ ID NO.14). Electrophoresis results of PCR products showed that positive plants could amplify specific bands, while WT plants did not show any bands.

[0057] 2) High-throughput sequencing detection of target editing: Amplification primers were designed for three different sgRNAs. The designed primers were labeled with paired-end barcodes: F: CCTACACGACGCTCTTCCGATCT (SEQ ID NO.15), R: GTTCCTTGGCACCCGAGAATTCCA (SEQ ID NO.16). DNA from positive plants selected using Cas9 and Kana primers was used as a template for PCR amplification. A corresponding index label was added to each amplified sequence, and secondary amplification was performed to form complete sequencing adapters. The obtained PCR products were purified and homogenized at equal molar ratios to form a sequencing sample. All samples were processed in the same way to construct a DNA library. Finally, paired-end 150bp high-throughput sequencing was performed using an Illumina MiSeq system. The results showed that compared with wild-type American black poplar, the YHS of the transgenic plants underwent varying degrees of editing, including deletions, insertions, and base substitutions.

[0058] In summary, by analyzing specific sequences on the Y-chromosomal of male Populus nigra var. nigra, conserved sgRNAs targeting YHS were designed. Using CRISPR / Cas9 technology, it was possible to simultaneously and effectively edit two sex-determining genes (the male-promoting gene MSL and the female-suppressing gene FERR-R) in Populus nigra, inducing sex change and preventing pollen production. Simultaneously, the MIXTA gene, which regulates catkin development, was edited, creating a new poplar germplasm that is free of catkins and pollen. This is of great significance for breeding new varieties of Populus nigra var. nigra that are free of catkins and pollen through gene editing, overcoming the problems of catkin and pollen pollution associated with Populus nigra var. nigra.

[0059] The above detailed description of the present invention does not limit the invention; the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, various improvements and modifications can be made without departing from the spirit and scope of the present invention, and all such improvements and modifications should fall within the scope defined by the appended claims.

Claims

1. A method for editing the YHS of male poplar trees, characterized in that: CRISPR / Cas9 vectors containing conserved sgRNA sequences that edit the YHS of male poplar plants are introduced into poplar cells, tissues, or organs through genetic transformation for cultivation, thereby editing the YHS of male poplar plants. The sgRNA sequences are sgRNA-1, sgRNA-2, and sgRNA-3. The nucleotide sequence of sgRNA-1 is shown in SEQ ID NO.1, the nucleotide sequence of sgRNA-2 is shown in SEQ ID NO.2, and the nucleotide sequence of sgRNA-3 is shown in SEQ ID NO.

3.

2. The application of sgRNAs in editing YHS of male poplar plants, characterized by, The sgRNAs include sgRNA-1, sgRNA-2 and sgRNA-3, the nucleotide sequence of sgRNA-1 is shown in SEQ ID NO.1, the nucleotide sequence of sgRNA-2 is shown in SEQ ID NO.2 and the nucleotide sequence of sgRNA-3 is shown in SEQ ID NO.3.