Genes related to radish root color and radish identification method

Abstract

The present invention proposes a gene related to the color of radish fleshy roots and a radish identification method, which belongs to the field of gene engineering technology, including the RsDFR gene of anthocyanin-free type radish White, whose nucleotide sequence is shown in SEQ ID NO.1; the RsDFR gene of a green-skinned purple-flesh type radish XLM, whose nucleotide sequence is shown in SEQ ID NO.2; the RsDFR gene of a red-skinned white-flesh type radish MSH, whose nucleotide sequence is shown in SEQ ID NO.3; and the RsDFR gene of a red-skinned red-flesh type radish Txh, whose nucleotide sequence is shown in SEQ ID NO.4. The present invention finds that the RsDFR gene is a key candidate gene that causes the different color differences of radish fleshy roots, and applies it to radish identification, with high reliability and accuracy.

Description

Technical Field

[0001] The invention relates to the technical field of gene engineering, and in particular to a gene related to the color of radish fleshy roots and a radish identification method. Background Art

[0002] Fleshy root color (root color for short) is an important trait in the formation of nutritional quality and commercial quality of root vegetables. Exploring and analyzing the molecular regulatory mechanism of root color formation and improving vegetable quality through molecular breeding technology are major needs for quality upgrading and sustainable development of my country's vegetable industry. Radish (Raphanus sativus L.) belongs to the genus Raphanus in the family Cruciferae. Its product organ is the root, and root color is its main commercial trait. Radish roots have extremely rich color diversity, including white skin and white flesh, red skin and white flesh, purple skin and white flesh, black skin and white flesh, red skin and red flesh, purple skin and purple flesh, green skin and green flesh, and green skin and purple flesh. Figure 1 Anthocyanin content is the core determinant of radish root color.

[0003] Anthocyanin is a flavonoid compound composed of water-soluble pigments and glycosides, and is one of the important pigments that determine the color of plants. Anthocyanin is of great significance to plant growth and development and human health. Anthocyanin can help plants attract insects to complete pollination, seed dispersal and other processes; it can help plants resist biological damage such as pests and diseases, and improve the resistance of plants to adverse environments such as ultraviolet rays, drought, and low temperature. Anthocyanin substances have strong antioxidant activity, which helps to delay aging, prevent Alzheimer's disease and enhance the body's immunity; it can prevent cardiovascular diseases, anti-tumor, lower blood sugar, anti-inflammatory, immunomodulatory, and antibacterial effects. Anthocyanin pigments are widely used in food, cosmetics, pharmaceuticals and other industries, and have become a current research hotspot. my country is the world's largest supplier of natural pigment extraction. Radish is an important raw material for extracting anthocyanin pigments and plays a very important role in the anthocyanin pigment extraction industry.

[0004] However, China is relatively backward in radish color improvement and breeding, and new varieties of fresh-eating purple-skinned and purple-fleshed fruit radishes and red-skinned and red-fleshed fruit radishes are monopolized by foreign varieties. In addition, the skin color of radish fleshy roots is different from the flesh color, and it is not easy to judge the color of the fleshy roots from the color of the aboveground leaves. It is also difficult to judge the color of the flesh inside the radish fleshy roots by the color of the fleshy roots, which has affected the selection process of radish color breeding to a certain extent.

[0005] In the previous work of the inventors, liquid chromatography-tandem mass spectrometry was used to detect targeted flavonoid metabolites in radish samples with different skin and flesh colors, and the flavonoid and anthocyanin metabolite components and contents of radishes with different colors were determined. At the same time, transcriptome sequencing analysis was performed on these samples. By integrating metabolome and transcriptome data, combined with functional analysis, metabolic pathway enrichment, correlation analysis and other methods, it was found that 5 important structural genes (RsTT4, RsDFR, RsCCOAMT, RsF3H, and RsBG8L) and three transcription factors (RsTT8-1, RsTT8-2, and RsPAR1) were involved in the biosynthesis of flavonoids in the epidermis of radish fleshy roots, and 4 important structural genes (RsDFR, RsTT4, RsLDOX and RsCCOAMT) and 9 transcription factors (RsTT8-1, RsTT8-2, RsMYB24L, RsbHLH57, RsPAR2L, RsbHLH113L, RsOGR3L, RsMYB24, and RsMYB34L) were involved in the biosynthesis of flavonoids in the root flesh. (Zhang et al., 2021). Summary of the invention

[0006] The purpose of the present invention is to propose genes related to the color of radish fleshy roots and a radish identification method, find that the RsDFR gene is a key candidate gene that causes different color differences in radish fleshy roots, and apply it to radish identification with high reliability and accuracy.

[0007] The technical solution of the present invention is achieved in this way:

[0008] The present invention provides RsDFR genes related to the color of radish fleshy roots, including the RsDFR gene of anthocyanin-free type radish White, whose nucleotide sequence is shown as SEQ ID NO.1; the RsDFR gene of a green-skinned purple-flesh type radish XLM, whose nucleotide sequence is shown as SEQ ID NO.2; the RsDFR gene of a red-skinned white-flesh type radish MSH, whose nucleotide sequence is shown as SEQ ID NO.3; and the RsDFR gene of a red-skinned red-flesh type radish Txh, whose nucleotide sequence is shown as SEQ ID NO.4.

[0009] The present invention further protects the expression protein of the RsDFR gene related to the color of radish fleshy roots as mentioned above, including the expression protein of the RsDFR gene of the anthocyanin-free type radish White, whose amino acid sequence is shown in SEQ ID NO.5; the expression protein of the RsDFR gene of the green-skinned and purple-flesh type radish XLM, whose amino acid sequence is shown in SEQ ID NO.6; the expression protein of the RsDFR gene of the red-skinned and white-flesh type radish MSH, whose amino acid sequence is shown in SEQ ID NO.7; and the expression protein of the RsDFR gene of the red-skinned and red-flesh type radish Txh, whose amino acid sequence is shown in SEQ ID NO.8.

[0010] The present invention further protects the promoter of the RsDFR gene related to the color of radish fleshy roots as mentioned above, including the promoter of the RsDFR gene of the anthocyanin-free type radish White, whose nucleotide sequence is shown in SEQ ID NO.9; the promoter of the RsDFR gene of the green-skinned purple-flesh type radish XLM, whose nucleotide sequence is shown in SEQ ID NO.10; the promoter of the RsDFR gene of the red-skinned white-flesh type radish MSH, whose nucleotide sequence is shown in SEQ ID NO.11; and the promoter of the RsDFR gene of the red-skinned red-flesh type radish Txh, whose nucleotide sequence is shown in SEQ ID NO.12.

[0011] The present invention further protects primers for the promoter of the RsDFR gene related to the color of radish fleshy roots as mentioned above, characterized in that they include RsDFRCDS-F1, RsDFRCDS-R1, RsDFRCDSF, RsDFRCDS-F2, and RsDFRCDS-R2, and their nucleotide sequences are shown in SEQ ID NOs. 13, 14, 15, 16, and 17 respectively.

[0012] The present invention further protects primers for the RsDFR gene related to the color of radish fleshy roots, including TxhDFRproF1, XLMDFRproF1, MSHDFRproF, RsDFRProF2, RsDFRProR2, RsDFRPro-F3, and RsDFRPro-R3, whose nucleotide sequences are shown in SEQ ID NOs. 18, 19, 20, 21, 22, 23, and 24, respectively.

[0013] The present invention further protects a method for identifying radish, wherein the primers are used to identify RsDFR alleles of different types of radish, and the promoter type thereof is correlated with the anthocyanin content.

[0014] As a further improvement of the present invention, it comprises:

[0015] (1) The radish DNA was cloned using the primer pair TxhDFRproF1+RsDFRPro-R3, and a band was cloned, identifying the red-skinned and red-fleshed radish Txh. No bands were cloned from the other materials;

[0016] (2) The radish DNA was cloned using the primer pair XLMDFRproF1+RsDFRProR2, and a band was cloned, identifying the green-skinned and purple-fleshed radish XLM. No bands were cloned from the other materials;

[0017] (3) The primer pair MSHDFRproF+RsDFRProR2 was used to clone radish DNA, and a band was cloned, identifying the red-skinned and white-fleshed radish MSH. No bands were cloned from the other materials;

[0018] (4) The radish DNA was cloned using the primer pair RsDFRProF2 / F3+RsDFRProR2 / R3. A band was cloned and the anthocyanin-free radish White was identified. No band was cloned from the other materials.

[0019] As a further improvement of the present invention, the anthocyanin-free radish White includes white-skin and white-flesh radish, black-skin and white-flesh radish and green-skin and green-flesh radish.

[0020] The present invention has the following beneficial effects: the present invention combines high-quality radish genome data, compares the sequences of genes whose gene expression levels of radishes of different colors are positively correlated with the total content of anthocyanins, and designs specific primers to clone and sequence these genes. It is found that the gene sizes of RsTT4 and RsCCOAMT are the same among materials of different colors, and there is no structural insertion and deletion variation. However, RsDFR shows abundant structural variation in materials of different colors, that is, different allele types, such as Figure 2 As shown: the RsDFR gene structure of Xinlimei, red radish and purple radish is similar, but the sequence of their promoter region is different. It is predicted that they contain different cis-acting elements, and there are also some SNP variant sites in different positions on their exons; the RsDFR gene structure in green radish, black radish and white radish is exactly the same, and its promoter region is different from that of red radish. The above results suggest that the RsDFR gene is the key candidate gene that causes the different color differences of radish fleshy roots. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0022] Figure 1 This is a comparison chart of different types of radishes;

[0023] Figure 2 This is a diagram showing the synthesis pattern of anthocyanins in radishes of different colors;

[0024] Figure 3 It is the cis-acting element of DFR gene promoter of different types of radish;

[0025] Figure 4 A diagram of the genetic structure of different types of radish. DETAILED DESCRIPTION

[0026] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0027] Example 1 DNA extraction

[0028] Extraction of plant DNA using the modified CTAB method

[0029] (1) Take 100-200 mg of fresh leaves and put them into a pre-cooled clean 2 mL centrifuge tube. Add 1-2 steel balls and grind them into powder using a rapid proofing machine.

[0030] (2) Add 800 mL of lysis buffer preheated at 65°C and place in a constant temperature water bath at 65°C for 30 min, slowly inverting the tube upside down several times every 5-10 min.

[0031] (3) Place the centrifuge tube at room temperature to cool for 10 min, then add 0.6 mL of a mixed solution of chloroform:isoamyl alcohol (24:1), slowly invert the tube several times until the solution becomes milky, and centrifuge at 4°C, 13,000 rpm for 10 min.

[0032] (4) Gently aspirate the supernatant and transfer it to a new 2 mL centrifuge tube. Add an equal volume of chloroform:isoamyl alcohol (24:1) mixed solution, slowly invert upside down several times to mix, and centrifuge at 4°C, 13,000 rpm for 10 min.

[0033] (5) Repeat step (4).

[0034] (6) Gently aspirate 0.6 μL of supernatant and transfer it to a new 1.5 mL centrifuge tube. Add 0.6 mL of pre-cooled (-20°C) isopropanol, slowly invert upside down several times to mix, and let stand at -20°C for 30 min.

[0035] (7) Centrifuge at 7000 rpm for 10 min at 4°C, discard the supernatant, and place the centrifuge tube in a fume hood to air dry.

[0036] (8) Add 0.5 ml of pre-cooled 70% ethanol to rinse the precipitate, centrifuge at 7000 rpm for 10 min at 4°C, and discard the supernatant;

[0037] (9) Repeat step (8)

[0038] (10) After rinsing, dry the centrifuge tube until there is no alcohol smell in the tube. Add 100 μL of deionized water to each tube to dissolve the DNA and store at -20°C for later use.

[0039] The PCR cloning reaction solution is shown in Table 1:

[0040] Table 1

[0041]

[0042]

[0043] The PCR reaction program is shown in Table 2:

[0044] Table 2

[0045]

[0046] Example 2 Specific primer design

[0047] Primers were designed based on the published radish genome, and the primer positions were adjusted through continuous exploration. The results are shown in Table 3:

[0048] Table 3

[0049] sequence name sequence Remark TxhDFRproF1 CTCCTCCACGCATATGATGG SEQ ID NO.18 XlmDFRproF1 GGAGAGGAAGCAGCGTAGGC SEQ ID NO.19 MdF GAAGCAGCGTAAGCGAGGAC SEQ ID NO.20 RsDFRProF2 TAGAAGACGAGGCTATGCCC SEQ ID NO.21 RsDFRProR2 AGTCTCTTTGTTAGCTGCGAC SEQ ID NO.22 RsDFRPro-F3 GATGATCCCAGATCGTTTGCG SEQ ID NO.23 RsDFRPro-R3 TCACGAGCCATGAACCGATG SEQ ID NO.24

[0050] Example 3 Identification of Radish

[0051] The primers in Table 3 were used to identify the RsDFR alleles in different types of radish, and their promoter types were correlated with anthocyanin content.

[0052] The details are as follows:

[0053] (1) The radish DNA was cloned using the primer pair TxhDFRproF1+RsDFRPro-R3, and the red skin and red meat type could be identified (a 600 bp band was cloned), while no bands were cloned from the other materials. After sequencing, the sequence was shown in SEQ ID NO.4.

[0054] (2) The radish DNA was cloned using the primer pair XlmDFRproF1+RsDFRProR2, and the green-skinned purple-fleshed type was identified (a 2600 bp band was cloned), while no bands were cloned from the other materials. After sequencing, the sequence was shown in SEQ ID NO.2.

[0055] (3) The radish DNA was cloned using the primer pair MshDFRproF+RsDFRProR2, and the red skin and white flesh type could be identified (a 1300 bp band was cloned), while no bands were cloned from the other materials. After sequencing, the sequence was shown in SEQ ID NO.3.

[0056] (4) The radish DNA was cloned using the primer pair RsDFRProF2 / F3+RsDFRProR2 / R3, and anthocyanin-free radishes (white skin and white flesh type, black skin and white flesh type, and green skin and green flesh type) were identified (~1300 bp band was cloned), and no band was cloned from the other materials. After sequencing, the sequence is shown in SEQ ID NO.1.

[0057] The cis-acting elements of DFR gene promoters of different types of radish were predicted, and it was found that the cis-acting elements contained in their promoter regions were different, such as Figure 3 As shown, this indicates that there are differences in their functions, which in turn affect the accumulation of anthocyanins in the fleshy roots of different types of radish.

[0058] Different combinations of primers shown in Table 4 below can be used to clone the RsDFR genes of different types of radish. Their gene sequences are similar in size, but there are different SNP or Indel mutation sites, such as Figure 4 shown.

[0059] sequence name sequence Remark RsDFRCDS-F1 TACTCACGAGACGGCAGC SEQ ID NO.13 RsDFRCDS-R1 CAGTCCACAAGACTTTCATACG SEQ ID NO.14 RsDFRCDSF GGCAACCCCGAGCCAACACAC SEQ ID NO.15 RsDFRCDS-F2 ATGGTCGCAGCTAACAAAGAGACT SEQ ID NO.16 RsDFRCDS-R2 CTAAGCACAGATCTGCTGTGCC SEQ ID NO.17

[0060] in conclusion:

[0061] The present invention combines high-quality radish genome data, compares the genes whose gene expression levels are positively correlated with the total anthocyanin content in different color radishes, and designs specific primers to clone and sequence these genes. It is found that the gene sizes of RsTT4 and RsCCOAMT are the same among materials with different colors, and there is no structural insertion and deletion variation. However, RsDFR shows rich structural variation in materials with different colors, that is, different allele types, such as Figure 2 As shown: the RsDFR gene structure of Xinlimei, red radish and purple radish is similar, but the sequence of their promoter region is different. It is predicted that they contain different cis-acting elements, and there are also some SNP variant sites in different positions on their exons; the RsDFR gene structure in green radish, black radish and white radish is exactly the same, and its promoter region is different from that of red radish. The above results suggest that the RsDFR gene is the key candidate gene that causes the different color differences of radish fleshy roots.

[0062] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. Primers for the RsDFR gene associated with radish fleshy root color, characterized in that: include: The primer pair for the RsDFR gene of the red-skinned, red-fleshed radish Txh comprises: TxhDFRproF1, the nucleotide sequence of which is shown in SEQ ID NO.18, RsDFRPro-R3, the nucleotide sequence of which is shown in SEQ ID NO.24; Or, a primer pair for the RsDFR gene of the red skin and white flesh type radish MSH, comprising: MSHDFRproF, the nucleotide sequence of which is shown in SEQ ID NO.19, RsDFRPro R2, the nucleotide sequence of which is shown in SEQ ID NO.22; Or, a primer pair for the RsDFR gene of anthocyanin-free radish White, comprising: RsDFRPro F2, the nucleotide sequence of which is shown in SEQ ID NO.21, or RsDFRPro F3, the nucleotide sequence of which is shown in SEQ ID NO.23, and RsDFRPro R2, the nucleotide sequence of which is shown in SEQ ID NO.22, or RsDFRPro R3, the nucleotide sequence of which is shown in SEQ ID NO.24; Or, a primer pair for the RsDFR gene of the green-skinned purple-fleshed radish XLM, comprising: XLMDFRproF1, the nucleotide sequence of which is shown in SEQ ID NO.19, RsDFRPro R2, the nucleotide sequence of which is shown in SEQ ID NO.

22.

2. A method for identifying radish, characterized in that: The primers described in claim 1 are used to identify different types of radish RsDFR alleles, including: (1) The radish DNA was cloned using the primer pair TxhDFRproF1+RsDFRPro-R3, and a band was cloned, identifying the red-skinned and red-fleshed radish Txh. No bands were cloned from the other materials; (2) The radish DNA was cloned using the primer pair XLMDFRproF1+RsDFRPro R2, and a band was cloned, identifying the green-skinned and purple-fleshed radish XLM. No bands were cloned from the other materials; (3) The primer pair MSHDFRproF+RsDFRPro R2 was used to clone radish DNA, and a band was cloned, identifying the red-skinned and white-fleshed radish MSH. No bands were cloned from the other materials; (4) The radish DNA was cloned using the primer pair RsDFRPro F2 / F3+RsDFRPro R2 / R3. A band was cloned and the anthocyanin-free radish White was identified. No band was cloned from the other materials.

3. The identification method according to claim 2, characterized in that: The anthocyanin-free radish White includes white skin and white flesh radish, black skin and white flesh radish and green skin and green flesh radish.

Images