Root rot nematode infection and pathogenicity-related gene Pc-CZ, its encoding protein and application thereof
By screening and inhibiting the expression of Pc-CZ gene of root rot nematode, using dsRNA fragments and recombinant vectors, the problems of infection and pathogenicity of coffee short body nematodes were solved, and effective prevention and control of plants were achieved.
Patent Information
- Application Number
- CN202210827945.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-07-13
- Publication Date
- 2025-08-29
- Estimated Expiration
- 2042-07-13
AI Technical Summary
The prior art lacks effective methods to prevent and treat the infection and pathogenesis of coffee short-body nematodes, especially lack of research on root rot nematodes, resulting in serious damage to agricultural production.
By mining and screening the Pc-CZ gene of root rot nematode, designing and synthesizing dsRNA fragments, inhibiting the expression of Pc-CZ gene, using the Pc-CZ gene and its encoding proteins to express in plants, recombinant vectors and viral vectors are constructed, interfering with the infection and pathogenic process of nematodes.
It effectively inhibits the invasion and pathogenicity of coffee short-body nematodes, reduces the harm of nematodes to plants, and provides anti-nematode plants with means of prevention and control.
Smart Images

Figure CN116254269B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biological genetic engineering technology, and in particular to a gene related to root rot nematode infection and pathogenicity Pc-CZ , its encoded protein and its application. Background Art
[0002] Root rot nematodes ( Pratylenchus spp.) are also called short-bodied nematodes, which are important migratory endoparasitic nematodes. Together with root-knot nematodes and cyst nematodes, they are the three most serious plant parasitic nematodes that harm crops. More than 100 valid species of root-rot nematodes have been reported worldwide, among which the coffee short-bodied nematode ( P. coffeae ) is one of the most devastating root rot nematodes affecting agriculture. The coffee nematode primarily pierces the root cortex of its host using its stylet, then enters the root to parasitize and feed, causing symptoms such as necrosis and rot in the plant's roots. The wounds caused by this nematode infection also create conditions for the invasion of other pathogens in the soil, resulting in complex infections, greatly aggravating crop damage and causing significant economic losses to agricultural production. The coffee nematode occurs worldwide and has a very wide host range. In my country, it severely damages a variety of food and cash crops, such as corn, wheat, soybeans, sesame, tomatoes, yams, tobacco, and strawberries. The significant damage caused by the coffee nematode to agriculture has attracted increasing attention, but effective methods and targets for its control remain lacking.
[0003] The esophageal gland secretions of plant-parasitic nematodes are widely recognized to be closely linked to nematode infection and pathogenicity. These secretions contain numerous infection-related proteins, secreted through the mouthpiece, that play a crucial role in nematode infection and pathogenicity. In recent years, the identification and function of genes involved in plant-parasitic nematode infection and pathogenicity have been a hot topic in nematology research. However, most studies have focused on sedentary root-knot and cyst nematodes, while research on migratory parasites such as root-rot nematodes is scarce.
[0004] Therefore, it is of great application prospect to discover and screen new infection-pathogenesis-related genes of root rot nematodes such as P. coffeei, study their functional roles in the infection and pathogenicity of P. coffeei, and use them as control targets for the cultivation of nematode-resistant plants.
[0005] The information disclosed in this background technology section is only used to deepen the understanding of the background technology of the present disclosure and should not be regarded as an admission or any form of suggestion that the information constitutes the prior art known to those skilled in the art. Summary of the Invention
[0006] The inventors have found through research that the root rot nematode shown in SEQ ID NO.1 Pc-CZGenes are associated with the infection and pathogenicity of root rot nematodes, and inhibition Pc-CZ The expression of the gene (such as silencing or down-regulating its expression) can inhibit the infection and / or pathogenicity of root rot nematodes to plants.
[0007] In view of at least one of the above technical problems, the present disclosure provides a method for treating root rot nematodes. Pc-CZ Genes, including genes with an ORF length of 1335 nucleotides (as shown in SEQ ID NO. 1).
[0008] According to another aspect of the present disclosure, there is provided a Pc-CZ The gene encodes the Pc-CZ protein of the root rot nematode, including a protein with a length of 444 amino acids (as shown in SEQ ID NO.2).
[0009] According to another aspect of the present disclosure, there is provided a method based on the root rot nematode Pc-CZ The in situ hybridization probe designed and synthesized based on the gene nucleotide sequence has a nucleotide sequence shown in SEQ ID NO.3.
[0010] In some embodiments of the present disclosure, based on the root rot nematode Pc-CZ A dsRNA fragment was designed and synthesized based on the nucleotide sequence of the gene, and its nucleotide sequence is shown in SEQ ID NO.4.
[0011] Based on the Pc-CZ The gene sequence is designed to design dsRNA or its fragments so that the coffee nematode ingests the dsRNA fragments, which affects the infection and pathogenicity of the coffee nematode, thereby playing a role in preventing and controlling the coffee nematode.
[0012] In some embodiments of the present disclosure, the Pc-CZ The gene or the Pc-CZ protein is effectively used in the prevention and control of root rot nematodes (such as coffee nematode).
[0013] The hybridization probe and dsRNA of the above-mentioned coding gene contain Pc-CZ Recombinant expression vectors, overexpression vectors, interference vectors, recombinant viruses, transgenic cell lines, transgenic plants or tissues, recombinant bacteria, recombinant gene expression cassettes and their applications of genes and homologous genes thereof all fall within the scope of the present invention.
[0014] In some embodiments of the present disclosure, Pc-CZ The recombinant expression vectors of genes include binary Agrobacterium vectors, virus vectors, bacterial expression vectors and yeast expression vectors. Pc-CZDuring the construction of gene vectors, inducible, constitutive, enhanced, tissue-specific, etc. can be used alone or in combination; the vectors can include resistance screening markers for antibiotics or chemical agents, etc.; the constructed vectors can transform monocotyledons, fungi, bacteria, etc., specifically Escherichia coli, yeast, Arabidopsis, tobacco, wheat, tomato, corn, etc.
[0015] inhibition Pc-CZ The expression of genes falls within the scope of the present invention, which also relates to methods for inhibiting Pc-CZ The use of a substance expressing a gene in the preparation of a product. The function of the product is to inhibit the infection and / or pathogenicity of root rot nematodes on plants; Pc-CZ The substance that inhibits gene expression can be Pc-CZ dsRNA for gene expression, interference vectors, and viral vectors, etc.; the plant can be a monocotyledonous plant or a dicotyledonous plant, specifically corn, soybean, tomato, etc.
[0016] The Pc-CZ protein of the present invention is used in inhibiting the parasitism and damage of root rot nematodes to plants, and / or inhibiting the infectivity of root rot nematodes to plants, and / or inhibiting the pathogenicity of root rot nematodes.
[0017] The present invention also relates to the use of a substance for inhibiting the activity of Pc-CZ protein in preparing a product; the function of the product is to inhibit the infection of plants by Pratylenchus nematodes and / or inhibit the pathogenicity of Pratylenchus nematodes on plants; the plants can be monocotyledons or dicotyledons, specifically tomatoes, tobacco, etc.
[0018] The present invention also relates to the expression and application of Pc-CZ protein in plants, and the host plants can specifically be tomatoes, tobacco, corn, etc.
[0019] The esophageal gland is one of the most important glands of plant nematodes. It is generally recognized that the secretion of the esophageal gland is closely related to the infection and pathogenicity of nematodes. The secretion of the esophageal gland contains a large number of effector proteins, which play an important role in the infection and pathogenicity of nematodes. Pc-CZ The gene is primarily expressed in the esophageal gland of the coffee nematode, with expression levels significantly higher in females than in the other three life stages, and relatively lowest in males. Subcellular localization experiments revealed that the Pc-CZ protein is localized to the cytoplasm and nuclei of tobacco leaf cells. Hybridization to tobacco leaves injected with an Agrobacterium suspension containing PEG104GFP-Pc-CZ and PEG104GFP-Pc-NS-CZ fusion proteins revealed a target band of approximately 75 kDa, representing the GFP-fused Pc-CZ protein. The present invention encompasses host species including, but not limited to, corn, but also other susceptible plants.
[0020] In some embodiments of the present disclosure, gene RNAi is used to Pc-CZ dsRNA was introduced into the coffee nematode and the Pc-CZ The effects of gene silencing on the infection and pathogenicity of the nematode were shown in the experimental results. Pc-CZ After the gene was silenced by dsRNA treatment, the infectivity of coffee nematodes was significantly reduced compared with the control GFP dsRNA ( P <0.05), the pathogenicity of nematodes was also significantly reduced compared with the control GFP dsRNA (t test, confidence interval 95%). Pc-CZ The gene plays an important role in the infection and pathogenicity of coffee nematode and can be used as a target gene for plant nematode resistance engineering.
[0021] One or more technical solutions provided in the embodiments of this application have at least any of the following technical effects or advantages:
[0022] 1. Isolation of a coffee nematode Pc-CZ The gene and its encoding protein Pc-CZ are related to the infection and pathogenicity of coffee nematode. The protein or its encoding gene can be used to prevent and control root rot nematode disease.
[0023] 2. The present invention is of great value for the study of the pathogenic mechanism of root rot nematodes and the breeding of nematode-resistant plants. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 In the embodiment of this application Pc-CZ Map of the tissue localization of the gene in the coffee nematode; A: The control group of coffee nematodes hybridized with the positive chain probe (no hybridization signal); BC: The results of the antisense chain probe hybridization show Pc-CZ The gene mRNA is mainly expressed in the esophageal gland of Pratylenchus coffeae. In each figure, eg: esophageal gland; m: middle esophageal bulb; s: stylet.
[0025] Figure 2 In the embodiment of this application Pc-CZ Quantitative analysis of gene expression in different stages of coffee nematode; detected by qRT-PCR method, using 2 -△△Ct The relative quantitative analysis of gene expression differences in the samples was performed using the 18S gene as the internal reference gene; RQ of male insects = 1; egg: egg; juvenile: larva; male: male insect; female: female insect.
[0026] Figure 3The subcellular localization and Western blot verification of the Pc-CZ recombinant protein in Nicotiana benthamiana in the examples of this application; wherein, A: subcellular localization results of Pc-CZ and Pc-NS-CPZ recombinant proteins in Nicotiana benthamiana; observation results under bright field; observation results under GFP green fluorescence; observation results under DAPI blue fluorescence with cell nucleus marker; Merge superposition effect; B: Western blot verification.
[0027] Figure 4 In the embodiment of this application Pc-CZ The results of gene silencing efficiency test; CK is the untreated nematode; G12-G48 are the nematodes treated with e GFP dsRNA treatment for 12, 24, 36 and 48 h; R12-R48 were the Pc-CZ dsRNA treatment for 12, 24, 36, and 48 h.
[0028] Figure 5 The statistical results of the number of nematodes in the present invention are shown in Figure 60, after 30 female nematodes with different treatments were inoculated with carrot callus tissue for 60 days; CK is untreated nematodes; G24 is e GFP nematodes treated with dsRNA for 24 h; R24 is Pc-CZ elegans treated with dsRNA for 24 h.
[0029] Figure 6 The statistical results of the number of nematodes invading the tomato root system 48 hours after 1000 nematodes with different treatments were inoculated in the examples of this application; CK is the untreated nematode; G24 is the e GFP nematodes treated with dsRNA for 24 h; R24 is Pc-CZ elegans treated with dsRNA for 24 h.
[0030] Figure 7 In the embodiment of this application Pc-CZ Results of pathogenicity test of P. coffeae to tomatoes 24 h after dsRNA treatment; A: tomato plant height; B: tomato aboveground fresh weight; C: tomato root fresh weight; D: number of nematodes in the tomato rhizosphere. DETAILED DESCRIPTION
[0031] Unless otherwise noted, the experimental materials and reagents used in the following examples were purchased from conventional biochemical reagent companies and performed according to the reagent / kit instructions. All reagents and consumables used in RNA-related experiments were DEPC-treated. All instruments and equipment involved were conventional laboratory equipment unless otherwise noted. Quantitative experiments in the following examples were performed in triplicate, and the results were averaged.
[0032] In order to better understand the technical solution of the present application, the above technical solution will be described in detail below with reference to the accompanying drawings and specific implementation methods.
[0033] Example 1: Pc-CZ Acquisition of genes and Pc-CZ proteins
[0034] 1. Approximately 10,000 coffee nematodes (purified, cultured, and preserved in the Plant Nematode Research Laboratory, College of Plant Protection, Henan Agricultural University; source: maize rhizosphere, Pingdingshan, Henan, August 2016, by Li Yu) were collected in a centrifuge tube. The tubes were treated with DEPC and washed three times with water. 1 ml of Trizol (Invitrogen) was added, and total RNA was extracted from the nematodes according to the Trizol instructions. After removing any residual DNA, cDNA was obtained by reverse transcription using a Reverse Transcription Kit (Biosharp).
[0035] 2. Using cDNA as a template, PCR amplification was performed using primers Qc-cz-F and Qc-cz-R. The specific sequences are as follows:
[0036] Upstream primer: Qc-cz-F: 5′-TCCAAAATGACTCAATCTCTGC-3′;
[0037] Downstream primer: Qc-cz-R: 5′-CCTCGCAATTTAAGTAATCGAC-3′.
[0038] The amplification system was 2× Taq PCR Mix, 12.5 μL; first-strand cDNA template, 1 μL; forward primer, 1 μL; reverse primer, 1 μL; and ddH2O was added to 25 μL.
[0039] PCR amplification program: initial denaturation at 94°C for 2 min, 35 cycles (denaturation at 94°C for 30 s, annealing at 58.5°C for 30 s, and extension at 72°C for 90 s); final extension at 72°C for 10 min.
[0040] The PCR amplification products were detected by agarose gel electrophoresis and then purified and recovered.
[0041] 3. Ligate the pMD20-T vector (Takara) with the PCR product purified in step 2 and transform into competent E. coli DH5a cells. Plate, pick, and shake the cells, then send the positive bacterial solution to the company for sequencing.
[0042] The sequencing results showed that the amplified product had an open reading frame as shown in SEQ ID NO: 1, encoding the protein as shown in SEQ ID NO: 2. The gene was identified and its encoded protein was named Pc-CZ protein.
[0043] Example 2: Tissue localization analysis of genes
[0044] 1. The target sequence was amplified by PCR using the gene cloning vector as a template. The primers are as follows:
[0045] YZ-cz-T7S1: 5′-GGATCCTAATACGACTCACTATAGGG GCGGTCAATGAGAAATGC-3′;
[0046] YZ-cz-A1: 5′-ATCCCGAAACGGAAACA-3′;
[0047] YZ-cz-S1: 5′-GCGGTCAATGAGAAATGC-3′;
[0048] YZ-cz-T7A1: 5′-GGATCCTAATACGACTCACTATAGGGATCCCGAAACGGAAACA-3′.
[0049] In vitro transcribed DNA templates for the positive and negative strands of the RNA probe were obtained by PCR amplification using primers YZ-cz-T7S1 / YZ-cz-A1 and YZ-cz-S1 / YZ-cz-T7A1, respectively. The specific steps were referred to the instructions for KOD FX DNA polymerase (TOYOBO) to prepare the reaction system and perform PCR reactions.
[0050] PCR reaction conditions were as follows: initial denaturation at 94°C for 2 min, 35 cycles of denaturation at 98°C for 10 s, annealing at 58.5°C for 30 s, and extension at 68°C for 90 s; and a final extension at 72°C for 10 min. PCR products were purified using a DNA gel recovery kit (Bioflux).
[0051] 2. Synthesize DIG-labeled positive-strand and reverse-strand probes according to the instructions of DIG RNA Labeling Mix (Roche).
[0052] Using the sense and antisense strands recovered in step 1 as templates, incubate at 37°C for 2 h under the action of T7 RNA polymerase to obtain sense and antisense strand probes.
[0053] The system was as follows: 1 μL of the positive / antisense strand DNA template (step 1); 1 μL of 10× DIG RNA labeling mix; 1 μL of 10× transcription buffer; 0.25 μL of Protector RNase Inhibitor; 1 μL of T7 RNA polymerase; and RNase-free water to a total of 10 μL. After gentle mixing, the mixture was incubated in a PCR instrument at 37°C for 2 h. DNA was then removed by adding 2 μL of RNase-free DNase I and incubating at 37°C for 15 min. Finally, the reaction was terminated by adding 2 μL of 0.2 M EDTA (pH 8.0). In situ hybridization was performed according to the manufacturer's instructions.
[0054] The results are as follows As shown, the reverse strand probe has hybridization signals, and the hybridization signals are mainly located in the esophageal gland of the coffee nematode, indicating that The gene is expressed in esophageal gland cells.
[0055] Example 3: Analysis of gene expression in four stages of Pratylenchus coffee nematode
[0056] Refer to Wang et al. (Wang K, Li Y, Huang X, Wang DW, Xu CL, Xie H. Thecathepsin S cysteine proteinase of the burrowing nematode The method described in this study was used to isolate mixed stages of P. coffee nematodes from carrot callus. RNA from male, female, larvae, and eggs was extracted and reverse transcribed into cDNA as a template. Primer 5.0 software was used to design the cDNA. Gene-specific upstream and downstream primers are as follows:
[0057] Upstream primer qPCR-F: 5′- TCACTCGATGTGGCAGTTGTTGG -3′,
[0058] Downstream primer qPCR-R: 5′- CTGACCGTGCCGAAGTCCTTG -3′.
[0059] Real time PCR relative quantitative detection The expression levels of genes in different insect stages were detected by real-time PCR using TB Green Premix Ex Tap Kit (Takara) with 18s gene as internal reference gene on a fluorescence quantitative PCR instrument. -△△Ct The relative quantitative analysis of gene expression differences in the samples was performed using the ΔCt method (ΔCt = average Ct value of the target gene - average Ct value of the reference gene). All experiments were performed with three biological replicates.
[0060] Reaction system (12 μL): SYBR Green PCR Mix, 6 μL; forward primer (10 μM), 0.5 μL; reverse primer (10 μM), 0.5 μL; cDNA template, 1 μL; RNase-free water, 4 μL.
[0061] The reaction program was as follows: 95 °C for 2 min; 40 cycles (95 °C for 15 s; 59 °C for 30 s; 72 °C for 30 s); 95 °C for 15 s; 60 °C for 60 s; 95 °C for 30 s; and 60 °C for 15 s.
[0062] The results are as follows As shown, relative to the expression level in the male stage, The gene expression level in females was the highest, significantly higher than that in all other insect stages (t-test, confidence interval 95%), followed by that in larvae. The gene is mainly expressed during the infection period of coffee nematode.
[0063] Example 4: Subcellular localization of Pc-CZ recombinant protein in Nicotiana benthamiana
[0064] 1. Gene cDNA was used as a template to amplify the target sequence by conventional PCR. The specific primer sequences are as follows:
[0065] PGWC-Pc-cz-F: 5′-AGCAGGCTTTGACTTTAGGTCGTCCAAAATGACTCAATCTCTGC-3′;
[0066] PGWC-Pc-cz-R: 5′-TGGGTCTAGAGACTTTAGGTCCGACATCATTTATTAATTGTCC-3′;
[0067] The PCR reaction system was as follows: ddH2O, 8.5 μL; dNTP Mix (10 Mm each), 0.5 μL; 2×PhantaMax Buffer, 12.5 μL; upstream and downstream primers, 1 μL each; Phanta Max Super-Fidelity DNA Polymerase, 0.5 μL; and cDNA template, 1 μL.
[0068] PCR reaction conditions were as follows: initial denaturation at 95°C for 3 min; 35 cycles (denaturation at 95°C for 15 s; annealing at 60°C for 15 s; extension at 72°C for 1 min); and final extension at 72°C for 5 min.
[0069] After the reaction, the PCR product was detected by 1% agarose gel electrophoresis, and the amplified fragment was purified, recovered, connected, transformed, and sent to the company for sequencing.
[0070] 2. Use LR recombinase (Invitrogen) to recombine the entry vector pGWC-PC-CZ with the expression vector pEarleyGate104 to generate the recombinant expression vector pEarleyGate104-PC-CZ. Transform the recombinant plasmid into competent Agrobacterium GV3101 cells using the freeze-thaw method. Spread an appropriate amount of the shake culture onto LB plates containing the appropriate antibiotics and incubate at 28°C for 48 hours.
[0071] 3. Re-streak the successfully transformed bacterial suspension and select a single colony to inoculate into LB liquid medium (with antibiotics) at 28°C with shaking. Centrifuge at room temperature at 4000 rpm for 15 minutes. Discard the supernatant and resuspend the cells in suspension buffer (10 mM MgCl₂, 10 mM MES, and 200 μM As in sterile water). Adjust the OD600 to 0.8-1.0 using the suspension buffer. Mix thoroughly, let the suspension stand for 3 hours, and then inject the mixed bacterial suspension into 4-5-leaf Nicotiana benthamiana seedlings using a 1 ml syringe, injecting 3-4 leaves per seedling. 48-72 hours after injection, prepare sections and observe the infiltrated areas for fluorescence using a laser confocal microscope. The excitation wavelength is 488 nm, and the receiving wavelength is 520-550 nm.
[0072] Test results (such as Figure 3 (shown) showed that Pc-CZ protein was localized in the nucleus and cytoplasm of Nicotiana benthamiana leaf cells.
[0073] Example 5: By RNAi silencing Genetic verification of its application as a target in resistance to root rot nematodes
[0074] 1. Design Gene-specific primers (containing T7 promoter sequence) were used to amplify the template for synthesizing dsRNA, which was purified and used in the next experiment. As a control, the primers are as follows:
[0075] RCZ-T7F1: 5′- GGATCC GAGTGGGAAAAAATGGTGGC-3′,
[0076] RCZ-R1: 5′-TCGGTCATTCAGCATCCCCA-3′,
[0077] RCZ-F1: 5′- GAGTGGGAAAAAAATGGTGGC-3′,
[0078] RCZ-T7R1: 5′-GGATCC TCGGTCATTCAGCATCCCCA-3′;
[0079] eGFP-T7F1: 5′-GGATCC CAGTGCTTCAGCCGCTACC-3′,
[0080] eGFP-R1: 5′-AGTTCACCTTGATGCCGTTCTT-3′,
[0081] eGFP-F1: 5′-CAGTGCTTCAGCCGCTACC-3′,
[0082] eGFP anti-T7A:5′-GGATCC AGTTCACCTTGATGCCGTTCTT-3′.
[0083] 2. Using the purified DNA obtained above as template, perform in vitro transcription and synthesis according to the instructions of Script MaxTM Thermo T7 Transcription kit (TOYOBO). dsRNA, e dsRNA was used as a control, and a water control was set up. Mixed worm-stage coffee nematodes were washed with DEPC water and added to The cells were incubated in a dsRNA soaking solution at 25°C in a shaker at 100 rpm for 12 h, 24 h, 36 h, and 48 h before the following experiments:
[0084] ① After incubation, the nematodes in different treatment groups were washed three times with DEPC-treated water, and RNA was extracted and detected by qRT-PCR after reverse transcription. The expression level of the gene was measured to detect the silencing efficiency of the target gene, and three biological replicates were set up for the experiment.
[0085] ②Coffee Pratylenchus coffeae dsRNA and e After 24 h of dsRNA soaking treatment, the carrot callus tissue was inoculated with 30 female worms per dish. After inoculation, the carrot callus tissue was placed in a 25°C constant temperature incubator for dark culture. After 60 days, the carrot callus tissues with different treatments were crushed with a blender, separated by sieving, and the number of coffee nematodes was counted to detect the presence of coffee nematodes. Effects of gene silencing on the fecundity of the coffee nematode Pratylenchus coffeae. Nematodes soaked in dsRNA for the same time served as controls, and nematodes without any treatment served as blank controls. Each treatment was repeated five times.
[0086] ③Select tomato seedlings with uniform growth (about 10 cm in height), clean the roots and place them in a sterile beaker (1 plant / cup), add dsRNA, e Coffee nematodes (1000 per cup) were treated with dsRNA and DEPC-treated water, and three biological replicates were performed for each treatment. Nematodes in tomato roots were stained with acid fuchsin 48 hours after inoculation, and the number of nematodes was counted under a microscope to detect Effects of gene silencing on the fecundity of Pratylenchus coffee nematode.
[0087] ④For detection The effect of silencing on the pathogenicity of coffee nematode was studied by comparing the treatment group with the highest silencing efficiency ( A pot experiment was conducted by inoculating tomato seedlings (approximately 15 cm tall) with nematodes treated with dsRNA for 24 hours. The inoculum was 1,000 per plant, with five biological replicates. Sixty days after inoculation, symptoms of tomato root damage by P. coffeei were observed. Growth parameters such as plant height, aboveground fresh weight, and root fresh weight were measured, and the number of nematodes in the tomato rhizosphere was isolated and counted.
[0088] e Tomato plants inoculated with P. coffeae treated with dsRNA for 12 h and without any treatment were used as controls, and the experiment was set up with 5 biological replicates.
[0089] The test results are shown in 、 5 , 6, 7, the results show that dsRNA treatment can effectively inhibit the expression of target genes, and the silencing efficiency of target genes is highest after immersion treatment for 24 h. After 24 h of dsRNA treatment, the fecundity, infectivity and pathogenicity of P. coffeei tomato were significantly reduced compared with the control group (t-test, 95% confidence interval).
[0090] The above results show that The gene plays an important role in the reproduction, infection and pathogenicity of coffee nematode and can be used as a target gene for plant root rot nematode resistance engineering.
[0091] Although some preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.
[0092] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if such changes and modifications of the present invention fall within the scope of the claims and their equivalents, the present invention is intended to include such changes and modifications.
Claims
1. A gene related to root rot nematode infection and pathogenicity Pc-CZ , whose nucleotide sequence is shown in SEQ ID NO.
1.
2. The root rot nematode according to claim 1 Pc-CZ The amino acid sequence of the Pc-CZ protein encoded by the gene is shown in SEQ ID NO.
2.
3. Inhibit the root rot nematode infection and pathogenicity-related genes described in claim 1 Pc-CZ The nucleotide sequence of the expressed dsRNA is shown in SEQ ID NO.
4.
4. Containing the root rot nematode infection and pathogenicity-related gene according to claim 1 Pc-CZ recombinant expression vector, transgenic cell line, recombinant bacteria or recombinant gene expression cassette.
5. The root rot nematode infection-related gene according to claim 1 Pc-CZ The in situ hybridization probe has a nucleotide sequence as shown in SEQ ID NO.
3.
6. The root rot nematode infection-related gene according to claim 1 Pc-CZ The application of the invention in preventing and controlling coffee nematode is characterized in that: Genes related to root rot nematode infection and pathogenicity Pc-CZ Express silence.
7. A method for controlling Pratylenchus coffeei, characterized in that: The steps include: The coffee nematode is made to ingest the dsRNA according to claim 3 to reduce the infectivity of the coffee nematode and its pathogenicity to the host plant.
Citation Information
Patent Citations
Pc-CD protein of coffee brevis nematode, and coding gene and application thereof
CN113912698A
Insecticidal, acarid killing, nematode killing, mollusk killing, disinfection or bacterium killing composition and pest control method of pest
JP2014114246A