Millet drought stress gene SiCCA1 and its application

Abstract

This invention relates to millet drought stress genes. SiCCA1 This invention relates to the field of genetic engineering technology, specifically using the Yugu No. 1 genome as a reference for isolation and acquisition. SiCCA1 Genes, as identified through abiotic stress resistance testing of transgenic materials, show that heterologous overexpression... SiCCA1 Genes can enhance the drought resistance and salt stress tolerance of transgenic plants, providing new ideas for drought-resistant millet breeding and offering new insights for expanding the application of millet in the current agricultural restructuring.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and relates to millet drought stress genes, specifically millet drought stress genes. SiCCA1 Cloning and applications. Background Technology

[0002] Among the many factors affecting plant growth and development, drought is one of the major abiotic stresses limiting crop growth. Drought causes enormous losses in crop yields, jeopardizing global food security and regional development stability. Since the beginning of the 21st century, extreme droughts have occurred repeatedly in parts of the world, causing significant impacts on agricultural production and people's lives. Therefore, clarifying the functions of drought-related genes, studying the molecular mechanisms of drought stress, and improving plant drought resistance are of great significance for increasing food yields in arid and semi-arid regions.

[0003] Millet originated in China and is widely cultivated in arid and semi-arid regions, exhibiting exceptionally high water use efficiency. Due to its remarkable drought resistance, small genome (approximately 510 Mb), self-pollination, and short growth period, it has gradually evolved into an ideal model species for C4 plant genetics and molecular research, following the completion of genome sequencing. Although millet is a drought-tolerant crop, drought remains the biggest limiting factor affecting its yield. With the intensification of global warming, drought stress is occurring more frequently, severely restricting the development of the millet industry. How to develop and expand the millet industry and ensure food security in arid regions has always been an important issue facing scientists.

[0004] Early research on drought resistance in millet mainly focused on the preliminary screening of drought-resistant resources and basic physiological analysis of drought resistance. With the development of molecular biology techniques and the completion of millet genome sequencing, significant progress has been made in the discovery, cloning, and identification of functional genes related to drought resistance in millet. Li et al. demonstrated the abscisic acid-responsive DREB-binding protein gene by constructing transgenic materials overexpressing Arabidopsis thaliana and transgenic millet. SiARDP Positively regulates drought resistance in millet. Pan et al. discovered this through transgenic technology. SiLTP Genes can significantly improve the drought resistance of millet. Li et al. subsequently confirmed this. SiASR4 yes SiARDP The target genes of transcription factors, as demonstrated by genetic transformation. SiASR4 It can improve the resistance of millet to abiotic stresses such as drought. Furthermore, the study discovered embryonic development protein genes. SiLEA14 Autophagy protein gene SiATG8a and abscisic acid stress maturation genes ASR1This is also closely related to the drought resistance of millet. Furthermore, Researcher Diao Xianmin's team reported screening 20 key candidate genes for drought resistance through transcriptome analysis of extreme materials combined with drought-related QTLs. These studies provide high-quality gene resources for elucidating the molecular mechanisms of drought stress in millet, but a more in-depth analysis of the molecular mechanisms is still lacking.

[0005] Furthermore, although previous studies have shown that the biological clock influences abiotic stress, the impact of drought stress on the millet biological clock and its key components remains largely unknown. Yi Fei et al., through transcriptome analysis of samples from Yugu No. 1 millet seedlings taken 24 hours after drought treatment began at both day and night, mapped the "crosstalk" between drought stress and the biological clock in millet, identifying key genes involved in the interaction between drought stress and the biological clock. This provides crucial candidate genes for further molecular design breeding using the biological clock to improve the drought resistance of millet and other gramineous plants. However, current research on the molecular mechanisms by which millet biological clock genes regulate drought resistance remains weak. Therefore, elucidating the drought stress network regulated by biological clock genes can provide new insights for drought-resistant millet breeding and offer new perspectives for expanding the application of millet in current agricultural restructuring. Summary of the Invention

[0006] To address the aforementioned problems, the purpose of this invention is to provide a millet drought stress gene that has been cloned for the first time. SiCCA1 Furthermore, we constructed expression vectors to obtain heterologous transgenic plants and studied the application of this gene in the resistance of transgenic plants to abiotic stress.

[0007] To achieve the above objectives, the specific solution adopted by the present invention is as follows:

[0008] Firstly, millet drought stress genes SiCCA1 Its genomic DNA is 3418 bp in length, containing 6 exons and 5 introns, and its nucleotide sequence is shown in SEQ ID NO: 1; its cDNA is 2244 bp in length, and its nucleotide sequence is shown in SEQ ID NO: 2, encoding 747 amino acids.

[0009] Secondly, a protein involved in abiotic stress in millet, said protein being composed of the above-mentioned... SiCCA1 Obtained from gene encoding.

[0010] Thirdly, a recombinant expression vector comprising the above-mentioned... SiCCA1 Gene.

[0011] Fourthly, a host cell obtained by transformation of the aforementioned recombinant expression vector.

[0012] Fifthly, the above SiCCA1 Application of genes in plant resistance to abiotic stress.

[0013] Furthermore, the abiotic stresses are drought stress and salt stress.

[0014] Sixthly, a method for improving the tolerance of plants to abiotic stress, said method utilizing the above-mentioned... SiCCA1 Gene overexpression vectors were constructed, and then plants were transformed using Agrobacterium-mediated genetic transformation to obtain transgenic plants.

[0015] Preferably, the method for improving the tolerance of plants to abiotic stress includes the following steps:

[0016] Step 1: Constructing the overexpression vector: SiCCA1 The CDS linker was linked to the 35S promoter and homologously ligated to the plant expression vector pCM1307 using recombinase homologous recombination. The restriction sites were XbaI and KpnI. The primers used were SiCCA1-OE-F with the sequence shown in SEQ ID NO: 3 and SiCCA1-OE-R with the sequence shown in SEQ ID NO: 4.

[0017] Step 2: Obtaining transgenic Arabidopsis: The overexpression vector obtained in Step 1 is transformed into Agrobacterium to obtain positive Agrobacterium containing the target vector. Then, the Agrobacterium flower immersion method is used to transform plants to obtain heterologous overexpression. SiCCA1 Genetically modified plants.

[0018] Beneficial effects: This invention uses Yugu No. 1 as a reference genome for isolation and acquisition. SiCCA1 Genes, as identified through abiotic stress resistance testing of transgenic materials, show that heterologous overexpression... SiCCA1 Genes can enhance the drought resistance and salt stress tolerance of transgenic plants, providing new ideas for drought-resistant millet breeding and offering new insights for expanding the application of millet in the current agricultural restructuring. Attached Figure Description

[0019] Figure 1 This is a multiple sequence alignment and phylogenetic tree construction diagram of the SiCCA1 protein and its homologs; in the figure, 'a' represents the alignment of the conserved MYB-DNA binding domain at the N-terminus of the CCA1 homolog; the amino acid sequences were aligned using ClustalX, and the red boxes indicate highly conserved MYB-DNA binding domains; Si, millet; Zm, maize; Sb, sorghum; Os, rice; Bd, *Brachypophthalmia ulmoides*; At, Arabidopsis thaliana; Br, Chinese cabbage; Gm, soybean; Pt, *Populus tomentosa*.

[0020] b represents the phylogenetic tree analysis of the CCA1 amino acid sequence; the phylogenetic tree was constructed using the Neighbor-Joining method in MEGA11 software, repeated 1000 times.

[0021] Figure 2 yes SiCCA1 Agarose gel image of gene cDNA amplification.

[0022] Figure 3 It is heterologous overexpression SiCCA1 Figure 1 shows the drought stress tolerance analysis of Arabidopsis thaliana seedlings. In the figure, a represents the phenotypes of wild-type and transgenic Arabidopsis thaliana grown on MS medium for 7 days, transferred to MS medium, and cultured for 10 days on MS medium containing 100 mM Mannitol and 300 mM Mannitol; b represents the fresh weight of wild-type and transgenic Arabidopsis thaliana cultured on MS medium and MS medium containing Mannitol for 10 days; c represents the root length of wild-type and transgenic Arabidopsis thaliana cultured on MS medium and MS medium containing Mannitol for 10 days. P <0.05,** P <0.01, *** P <0.001( t test).

[0023] Figure 4 It is heterologous overexpression SiCCA1 Figure 1 shows the salt stress tolerance analysis of Arabidopsis thaliana seedlings. In the figure, a represents the phenotypes of wild-type and transgenic Arabidopsis thaliana grown on MS medium for 7 days, transferred to MS medium, and cultured for 10 days on MS medium containing 100 mM NaCl and 200 mM NaCl; b represents the fresh weight of wild-type and transgenic Arabidopsis thaliana cultured on MS medium and MS medium containing NaCl for 10 days; c represents the root length of wild-type and transgenic Arabidopsis thaliana cultured on MS medium and MS medium containing NaCl for 10 days. P <0.05,** P <0.01, *** P <0.001( t test).

[0024] Figure 5 yes SiCCA1 Expression pattern analysis diagram; in the diagram, 'a' represents... SiCCA1 Detection of induced expression under drought and salt stress; b is... SiCCA1 The organizational expression pattern.

[0025] Figure 6 This is a subcellular localization map of the SiCCA1 protein; Note: H2B-mCherry indicates the nuclear localization marker, and the scale bar is 5μm. Detailed Implementation

[0026] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention.

[0027] I. Millet SiCCA1 Gene cloning and cDNA sequence acquisition

[0028] Based on previous reports on rice OsCCA1 Gene sequences were obtained from rice using a homology search performed on the Phytozome (https: / / phytozome-next.jgi.doe.gov / ). OsCCA1 The homologous gene in millet is named SiCCA1 . SiCCA1 Encoding a transcription factor containing a conserved MYB-DNA binding domain at its N-terminus. Figure 1 a). Phylogenetic analysis revealed that SiCCA1 is highly homologous to rice OsCCA1 and maize ZmCCA1a proteins. Figure 1 b). We used Yugu No. 1 as a reference genome for isolation. SiCCA1 The full-length gene sequence analysis revealed that its genomic DNA is 3418 bp in length, containing 6 exons and 5 introns, while the full-length cDNA is 2244 bp encoding 747 amino acids. Using cDNA obtained from reverse transcription of total RNA from Yugu No. 1 as a template, PCR amplification was performed... Figure 2 The target fragment was recovered and ligated into the pEASY-Blunt Zero (Beijing TransGen Biotech Co., Ltd.) cloning vector. After successful sequencing, millet seeds were obtained. SiCCA1 The cDNA sequence.

[0029] two, SiCCA1 Functional verification of genes

[0030] (1) Construction of overexpression vector

[0031] The expression vector used in this experiment was named SiCCA1-OE, which is derived from the expression vector of Yugu No. 1. SiCCA1 The CDS-linked 35S promoter was ligated to the plant expression vector pCM1307 (described in the article "Li, Gangling et al., RGN1 controls grain number and shapes panicle architecture in rice. PlantBiotechnology Journal") using homologous recombination with recombinase (Zhongmei Taihe Seamless Cloning Kit). The restriction enzyme sites were XbaI and KpnI, and the primers used are shown below:

[0032] SiCCA1-OE-F:CCGTCGACGAGCTCTCTAGAATGACCTCAACTCCAAGTGACC

[0033] SiCCA1-OE-R:TTGCGGAGTACCCGGGTACCTCAGGTTGATTCTTCGCTTCCA

[0034] All the primers mentioned above were written in the 5' to 3' direction.

[0035] The structure of the SiCCA1-OE vector is described as follows: The small fragment between the XbaI and KpnI restriction sites of the pCM1307 vector is replaced with... SiCCA1 The recombinant positive plasmid obtained after sequencing the coding region.

[0036] (2) Construction of GFP vector

[0037] The GFP vector used in this experiment was named SiCCA1-GFP, which is derived from the GFP vector in Yugu No. 1. SiCCA1 The CDS-linked 35S promoter was ligated to the plant expression vector pSuper1300 using homologous recombination with recombinase (Zhang, Quan et al., Natural variation in tiller number 1 affects its interaction with TIF1 to regulate tillering in rice. Plant Biotechnology Journal). The restriction sites were PstI and KpnI, and the primers used were as follows:

[0038] SiCCA1-GFP-F: GACTCTAGAAAGCTTCTGCAGATGACCTCAACTCCAAGTGACC

[0039] SiCCA1-GFP-R: GCCCTTGCTCACCATGGTACCGGTTGATTCTTCGCTCTCAAGA

[0040] All the primers mentioned above were written in the 5' to 3' direction.

[0041] The structure of the SiCCA1-GFP vector is described as follows: The small fragment between the PstI and KpnI restriction sites of the pSuper1300 vector is replaced with... SiCCA1 The recombinant positive plasmid obtained after sequencing the coding region.

[0042] (3) Obtaining transgenic Arabidopsis

[0043] a. Inoculate a single colony of Agrobacterium GV3101 containing the target vector into 5 mL of LB liquid medium (containing 100 mg / L Kan and 25 mg / L Rif) and incubate at 28°C with shaking at 180 rpm for 16 h.

[0044] b. Inoculate all bacterial culture into 250 mL LB liquid medium (containing 100 mg / L Kan and 25 mg / L Rif), and incubate at 28°C with shaking at 180 rpm until OD. 600 The value is 0.8~1.2.

[0045] c. Centrifuge at 4000 rpm at room temperature for 15 min, collect the bacterial cells, and discard the supernatant.

[0046] d. Add 100 mL of Arabidopsis thaliana transformation solution to resuspend the bacterial cells.

[0047] e. Soak the Arabidopsis inflorescence in Agrobacterium transformation solution for 30 seconds to 1 minute, place it flat on a tray, cover it with a plastic bag to keep it moist, and then cover it with a black tray to avoid light for 24 hours.

[0048] f. Then, stand the flowerpot upright and cultivate it under normal light conditions until harvesting.

[0049] (4) Identification of drought resistance in transgenic materials

[0050] In order to determine SiCCA1 Whether it participates in the Arabidopsis drought stress response, we first examined the expression of... SiCCA1 Transgenic Arabidopsis thaliana was subjected to drought stress treatment. Sterilized Col-0 wild-type and overexpressing... SiCCA1 Arabidopsis seeds were sown in MS medium and vernalized at 4°C for 3 days. After 7 days of culture under 22°C 16 h / 8 h light conditions, seedlings of uniform growth from wild-type and transgenic Arabidopsis were transferred to MS medium and MS medium containing 100 mM Mannitol and 300 mM Mannitol, respectively, for 10 days for phenotypic observation. Phenotypic analysis showed that on empty MS medium, the growth of wild-type and transgenic seedlings was basically the same. Under the treatment of 100 mM and 300 mM Mannitol, the growth of both wild-type and transgenic seedlings was inhibited and slowed, but the inhibition of transgenic seedlings was significantly weaker than that of wild-type. Furthermore, the leaves of wild-type Arabidopsis turned yellow, while the leaves of transgenic seedlings were greener, and their overall condition was significantly better than that of wild-type. Figure 3a). Simultaneously, the fresh weight and root length of transgenic and wild-type seedlings were measured under normal and Mannitol treatment conditions. The results showed that under normal growth conditions, there was no significant difference in fresh weight and root length between transgenic and wild-type seedlings. However, under Mannitol treatment conditions, the fresh weight and root length of wild-type seedlings were significantly lower than those of the overexpression seedlings. Figure 3 b) Figure 3c) illustrates heterologous overexpression SiCCA1 Arabidopsis thaliana seedlings showed significantly stronger drought resistance than wild-type. Further salt stress treatment was applied to the transgenic Arabidopsis thaliana. The same results showed that under NaCl treatment, the growth, biomass, and root length of the transgenic Arabidopsis thaliana were significantly higher than those of the wild-type. Figure 4 This indicates heterologous overexpression. SiCCA1 The transgenic plants also showed significantly greater tolerance to salt stress than the wild type.

[0051] three, SiCCA1 Gene expression and subcellular localization analysis in various tissues of millet

[0052] (1) Analysis of induced expression

[0053] In order to reveal SiCCA1 The function of millet under abiotic stress was first examined. SiCCA1 Expression profiles under drought and salt stress. Yugu No. 1 seeds were sterilized, sown into 96-well PCR plates, and cultured in a light incubator with nutrient solution for three weeks. Afterwards, the seeds were treated with 20% PEG6000 and 150 mM NaCl, respectively, and samples were taken at 0, 2, 6, 12, and 24 h. Expression level detection revealed that, regardless of drought or salt stress, [the expression profile was positive]. SiCCA1 Gene expression was significantly upregulated, indicating that SiCCA1 Positive response to drought and salt stress ( Figure 5 a).

[0054] (2) Analysis of organizational expression patterns

[0055] Total RNA was extracted from different tissues of the millet variety Yugu No. 1 at various stages. The first strand of cDNA was then synthesized using reverse transcriptase M-MLV (Baori Biotechnology Co., Ltd.). This first strand of cDNA was then used as a template for amplification using primers SiCCA1-RT-F and SiCCA1-RT-R. SiCCA1 Specific fragments of the gene were amplified from millet using primers SiActin7-F and SiActin7-R. SiActin7 Specific fragments of genes are used as internal controls for real-time quantitative analysis.

[0056] SiCCA1-RT-F:CAGCCGGTGACACTAACCA

[0057] SiCCA1-RT-R:CGACCCTCTTCAGAAACTTCCTT

[0058] SiActin7-F: AAATTGTGCTCAGCGGTGG

[0059] SiActin7-R:TGGAAGGTGCTAAGGGAGGC

[0060] Real-time quantitative PCR was performed on an Applied Biosystems 7500 Real Time PCR system (ABI, USA). Three biological replicates were set up per experiment, and each biological replicate was performed three times mechanically. The method reported by Livak KJ and Schmittgen TD (2001), i.e., 2... -△△CT Calculate the relative expression level.

[0061] △△CT=(CT.Target-CT.Ubiquitin)Time x-(CT.Target-CT.Ubiquitin)Time 0

[0062] Time x represents any time point, and Time 0 represents the target gene expression at 1-fold after Ubiquitin correction.

[0063] The results are as follows Figure 5 As shown in b. SiCCA1 It is expressed at high levels in roots, leaves, leaf sheaths, stems, and stem nodes, but at low levels in spikes.

[0064] (3) Subcellular localization of SiCCA1 in protoplasts

[0065] To investigate the subcellular localization of SiCCA1, this study used the constructed SiCCA1-GFP vector as a template, transformed it into protoplasts, and observed the localization results.

[0066] a. Disinfect the hulled millet seeds of variety Yugu No. 1 with 75% alcohol for 3-5 minutes, then rinse twice with sterile water. Next, disinfect with 20% sodium hypochlorite solution (28 degrees Celsius, 160 rpm on a shaker), changing the sodium hypochlorite solution every 20 minutes, for a total of two treatments. Finally, rinse 5-8 times with sterile water and air dry in a clean bench for 4-5 hours.

[0067] b. Inoculate the sterilized seeds into 1 / 2 MS medium and grow them in the dark for 12 days.

[0068] c. Chop the rice seedlings from (b) with a blade, add them to Enzyme Solution I, and gently shake to mix. After filtering through a 400-mesh nylon membrane, add the chopped tissue to Enzyme Solution II.

[0069] d. Place Enzyme Solution II containing shredded tissue in a vacuum pump, evacuate at 50 kPa for 0.5 h, and then treat at room temperature on a shaker at 40 rpm for 3-4 hours to promote protoplast dissociation and release.

[0070] e. Filter the protoplasts containing Enzyme Solution II through a 400-mesh nylon membrane to remove the chopped rice tissue and collect the protoplasts in a 50ml centrifuge tube. Wash the protoplasts with 100ml of W5 solution, centrifuge at 150g for 5min (3 acel 9brake) to collect the protoplasts.

[0071] f. Resuspend the protoplasts collected in (e) in MMG solution.

[0072] g. Add the extracted SiCCA1-GFP plasmid to a 2ml tube, add the protoplast and MMG mixture obtained in (f), and gently mix by hand.

[0073] h. Add 110 μl of 40% PEG, gently mix by inverting the container, and incubate at 28 degrees Celsius for 15 minutes in the dark.

[0074] i. Add W5, mix gently, centrifuge at 150g for 5 minutes and remove the supernatant.

[0075] j. Add 800 μl of W5 and incubate overnight at 28 degrees Celsius for 16 hours.

[0076] k. Laser confocal observation.

[0077] The reagent formulations used in the above protoplast extraction process are shown in Table 1.

[0078] Table 1. Reagents used for protoplast extraction

[0079] name formula Enzyme solution I 2.186g mannitol + 1 ml 0.2M MES, bring volume to 20ml with water. Enzyme solution II 2.186g mannitol + 1 ml 0.2M MES + 0.3g Cellulase R-10 + 0.15g Maceroayme R-10, bring to a final volume of 20ml with water. W5 <![CDATA[38.5 ml of 2M NaCl + 62.5 ml of 1M CaCl2 + 2.5 ml of 1M KCl + 5 ml of 0.2M MES, made up to 500 ml with water]]> MMG solution <![CDATA[2.186 g mannitol + 300 μl MgCl2 + 400 μl 0.2 M MES, made up to 20 ml with water]]> 40% PEG <![CDATA[8 g PEG4000 + 2 ml 1 M CaCl2 + 2.186 g mannitol, made up to 20 ml with water]]> 1M KCl 0.7455g KCl solid, diluted to 10ml with water. <![CDATA[1M MgCl2]]> <![CDATA[2.033 g of MgCl2·6H2O solid, made up to 150 ml with water]]> <![CDATA[1M CaCl2]]> <![CDATA[22.052 g of CaCl2·2H2O solid, made up to 150 ml with water]]> 2M NaCl 23.376g of NaCl solid was diluted with water to a final volume of 200ml. 0.2M MES 1.9524g of MES solid was diluted to 50ml with water, and the pH was adjusted to 5.7 with KOH solid.

[0080] The results are as follows Figure 6 As shown, SiCCA1 is a protein located in the cell nucleus.

[0081] It should be noted that the above-described embodiments should be understood as illustrative, not as limiting the scope of protection of this invention. The scope of protection of this invention is defined by the claims. For those skilled in the art, some non-essential improvements and adjustments made to this invention without departing from the essence and scope of this invention still fall within the scope of protection of this invention.

Claims

1. A method for improving the tolerance of plants to abiotic stress, wherein the abiotic stress is drought stress and salt stress, characterized in that: Using millet drought stress genes SiCCA1 An overexpression vector was constructed, and then the overexpression vector was transformed into recipient plants using an Agrobacterium-mediated genetic transformation method to obtain transgenic plants; The millet drought stress gene SiCCA1 Its genomic DNA is 3418 bp in length, containing 6 exons and 5 introns, and its nucleotide sequence is shown in SEQ ID NO: 1; its cDNA is 2244 bp in length, and its nucleotide sequence is shown in SEQ ID NO: 2, encoding 747 amino acids.

2. The method for improving the tolerance of plants to abiotic stress according to claim 1, characterized in that: Includes the following steps: Step 1: Constructing the overexpression vector: SiCCA1 The CDS linker was linked to the 35S promoter and homologously ligated to the plant expression vector pCM1307 using recombinase homologous recombination. The restriction sites were XbaI and KpnI. The primers used were SiCCA1-OE-F with the sequence shown in SEQ ID NO: 3 and SiCCA1-OE-R with the sequence shown in SEQ ID NO:

4. Step 2: Obtaining transgenic Arabidopsis: The overexpression vector obtained in Step 1 is transformed into Agrobacterium to obtain positive Agrobacterium containing the target vector. Then, the Agrobacterium flower immersion method is used to transform plants to obtain heterologous overexpression. SiCCA1 Genetically modified plants.

Images