A urine PCR kit for predicting minimal change disease in adults

Abstract

This invention relates to the field of medical diagnostic technology, specifically providing a urine PCR kit for predicting minimal change disease (MND) in adults. The kit for detecting MND in adults provided by this invention contains primer sequences for amplifying miR-98-5p. This invention also provides a kit for distinguishing MND from other kidney diseases in adults, the kit containing primer sequences for detecting the relative expression levels of miR-98-5p, miR-204-5p, and / or miR-194-5p in urine samples. Using the kit provided by this invention for the diagnosis of MND, from morning urine collection to obtaining the final result, only 8-12 hours are required, saving patients valuable time and facilitating early treatment and benefit.

Description

Technical Field

[0001] This invention relates to the field of disease detection technology, and in particular to a urine PCR kit for predicting minimal change disease in adults. Background Technology

[0002] Minimal change disease (MND) is the most common cause of nephrotic syndrome in children and the third most common type of primary glomerulonephritis in adults. MND accounts for approximately 70%-90% of nephrotic syndrome cases in children under 10 years of age and 10%-30% in adults. MND typically has a rapid onset, presenting with typical nephrotic syndrome symptoms, significant edema, and may be accompanied by severe pleural effusion and ascites.

[0003] Because patients with minimal change disease (MND) often present with significant hypoalbuminemia, they are prone to serious complications such as infection, thrombosis, embolism, electrolyte disturbances, and acute kidney injury. Before the advent of glucocorticoids, the mortality rate for MND patients could be as high as 20%, with secondary infections being the most common cause of death. MND responds well to glucocorticoid therapy, with approximately 90% of patients achieving remission with this treatment. Therefore, for some patients, especially children, a definitive diagnosis can be made based on the complete remission of nephrotic syndrome achieved with adequate glucocorticoid therapy, without the need for a renal biopsy.

[0004] However, inferential diagnosis has significant drawbacks. First, it cannot guarantee accuracy. Second, for glomerulonephritis such as membranous nephropathy that is unresponsive to glucocorticoids alone, using glucocorticoids alone not only delays the patient's treatment but also easily leads to serious complications such as infection, embolism, and renal function progression. Currently, the gold standard for diagnosing minimal change disease is still pathological diagnosis following renal biopsy. However, since renal biopsy is an invasive procedure, and a pathological diagnosis of minimal change disease does not change the patient's treatment plan (adequate glucocorticoid therapy), there is an urgent clinical need for a biomarker that can accurately and non-invasively diagnose minimal change disease.

[0005] Another challenge in diagnosing minimal change disease (MND) is its tendency to be misdiagnosed due to the similarity of its early symptoms to those of other kidney diseases. Like membranous nephropathy and focal segmental glomerulosclerosis, most MND patients present with nephrotic syndrome at onset, characterized by massive proteinuria (greater than 3.5 g / day), hypoalbuminemia (plasma albumin less than 30 g / L), hyperlipidemia, and significant edema. These symptoms are difficult to differentiate based solely on clinical manifestations and laboratory tests. Furthermore, the treatment methods for MND differ significantly from those for other kidney diseases, and misdiagnosis can lead to missed opportunities for optimal treatment. Summary of the Invention

[0006] The purpose of this invention is to provide a non-invasive, rapid, and accurate method for diagnosing minimal change disease (MND) using urinary sediment miRNAs. This aims to address a series of problems with current methods or indicators for diagnosing MND, including the need for invasive renal biopsy for pathological diagnosis, the inaccuracy of inferential diagnoses, and delays in patient care.

[0007] In order to overcome the shortcomings of the prior art, in a first aspect, the present invention provides the application of miR-98-5p in the preparation of a test kit for adult minimal change disease nephropathy.

[0008] Secondly, the present invention provides a kit for detecting minimal change disease in adults, the kit containing primer sequences for amplifying miR-98-5p.

[0009] In the kit for detecting minimal change disease in adults provided by this invention, the primer sequence is shown in SEQ ID NO.1, and is used to detect the relative expression level of miR-98-5p in a urine sample.

[0010] In the kit for detecting minimal change disease in adults provided by this invention, the relative expression level of miR-98-5p in urine samples is detected by quantitative real-time PCR.

[0011] In the kit for detecting adult minimal change nephropathy provided by this invention, when the relative expression level of miR-98-5p is greater than 0.0039, the probability of identifying adult minimal change nephropathy in the test sample is greater than 99%.

[0012] Thirdly, the present invention provides the use of miR-98-5p, miR-204-5p and miR-194-5p in the preparation of a kit for differentiating adult minimal change disease from other kidney diseases.

[0013] Fourthly, the present invention provides a kit for distinguishing adult minimal change nephropathy from other nephropathy, the kit containing primer sequences for detecting the relative expression levels of miR-98-5p, miR-204-5p and / or miR-194-5p in urine samples.

[0014] In the kit provided by this invention for differentiating adult minimal change disease from other kidney diseases, the primer sequence for detecting miR-98-5p is shown in SEQ ID NO.1; the primer sequence for detecting miR-204-5p is shown in SEQ ID NO.2; and the primer sequence for detecting miR-194-5p is shown in SEQ ID NO.3.

[0015] Using the kit provided by this invention for differentiating adult minimal change nephropathy from other nephropathy, RNA was extracted from urine sediment in urine samples of nephropathy patients and reverse transcribed to synthesize cDNA. The relative expression levels of miR-98-5p, miR-204-5p, and / or miR-194-5p in the cDNA were obtained based on SYBR Green quantitative PCR. Nephropathy patients with significantly elevated relative expression levels of miR-98-5p, miR-204-5p, or miR-194-5p were identified as adult minimal change nephropathy patients.

[0016] When using the kit provided by this invention to distinguish between adult minimal change nephropathy and other nephropathy, if the relative expression level of miR-98-5p is higher than 0.0015, or the relative expression level of miR-204-5p is higher than 0.1043, or the relative expression level of miR-194-5p is higher than 0.0719, then the nephropathy patient is an adult minimal change nephropathy patient.

[0017] The beneficial effects of this invention are as follows:

[0018] (1) This invention has discovered miRNA marker miR-98-5p that can effectively distinguish between healthy people and minimal change disease. Based on the relative expression level of miR-98-5p in urine samples, it is possible to diagnose whether or not someone has minimal change disease.

[0019] (2) The present invention also discovered miRNA markers miR-98-5p, miR-204-5p and miR-194-5p that can distinguish between minimal change disease and other kidney diseases; and the three miRNA markers used in combination have a better distinguishing effect.

[0020] (3) Based on the above findings, the present invention provides a test kit that can diagnose minimal change disease non-invasively, quickly and accurately. Patients diagnosed with the disease can be treated immediately with a sufficient dose of glucocorticoids without the need for invasive renal biopsy and long waiting for pathological results. It is also significantly more accurate than inferential diagnosis.

[0021] (4) This invention only requires the patient to provide a morning urine sample, which has a significant advantage over current renal biopsy procedures as it is non-invasive. A diagnosis can be made on the same day without hospitalization. Collecting a morning urine sample poses no risk or trauma to the patient and is very safe and reliable.

[0022] (5) This invention uses quantitative real-time PCR, which is simple to operate, reliable in results, and the kit is very convenient to promote in the later stages. No additional manpower or resources are required for special training, thus giving this invention a wider application space and the advantage of rapid promotion. In contrast, the existing technology requires renal biopsy and pathological diagnosis, which is more difficult to operate and requires a high level of expertise from nephrologists, pathologists, and ultrasound specialists, making it difficult to promote rapidly in a short period of time.

[0023] (6) The kit provided by this invention can be used to diagnose minimal change disease in just 8-12 hours from morning urine collection to the final result, saving patients valuable time and facilitating early treatment and early benefit. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0025] Figure 1 This is a graph showing the differences in urinary miRNAs between the minimal change disease group and the normal control group.

[0026] Figure 2 This is the ROC curve of urinary miRNAs in the minimal change disease group compared to the normal control group.

[0027] Figure 3 This is a graph showing the differences in urinary miRNAs between the minimal change disease group and the disease control group.

[0028] Figure 4 This is the ROC curve of three miRNAs in urine from the minimal change disease group, which distinguishes them from the disease control group.

[0029] Figure 5 This is a graph showing the differences in urinary miRNAs between the minimal change disease group and all control groups.

[0030] Figure 6 This is the ROC curve of three urinary miRNAs used to diagnose minimal change disease. Detailed Implementation

[0031] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0032] Example 1: Detection of expression levels of miR-98-5p, miR-204-5p, and miR-194-5p in urine

[0033] 1) Collection and transportation of morning urine

[0034] Collect 50-100 ml of morning urine from patients with minimal change disease, healthy individuals, and disease control groups using 50 ml sterile centrifuge tubes. Use 1-2 tubes per patient and store the urine in an ice box or at 4°C before transporting it back to the laboratory for processing.

[0035] 2) Obtaining urine sediment

[0036] Place the collected morning urine into a pre-cooled centrifuge at 4℃ and centrifuge at 3000g for 30 minutes. Carefully discard the supernatant after centrifugation. Carefully aspirate the remaining small amount of supernatant at the bottom of the tube with a pipette tip, leaving the urine sediment.

[0037] 3) Total RNA was extracted from urine sediment using TRIzol.

[0038] Add 1 ml of TRIzol (4°C) to the urine sediment obtained in step 2 and mix thoroughly by pipetting. Transfer the mixture to a sterilized RNase-free EP tube and let it stand at room temperature for 5 minutes. Add 200 μl of chloroform (trichloromethane) stored at room temperature and vortex vigorously for 15-20 seconds until the chloroform is completely mixed and the liquid turns pinkish-white. Let it stand at room temperature for 3 minutes. Centrifuge the mixture at 12000 rpm for 15 minutes in a pre-chilled 4°C centrifuge. You will see the liquid in the EP tube separate into three layers (the upper clear aqueous phase is RNA, the middle white phase is protein, and the lower pink phase is DNA). Carefully transfer the upper clear aqueous phase to a new RNase-free EP tube, avoiding aspirating the middle white protein layer as much as possible. Add an equal volume of isopropanol (pre-chilled at -20°C) and incubate on ice for 20 minutes (at this point, RNA will precipitate from the liquid to a solid state). Centrifuge at 12000 rpm for 15 minutes in a pre-chilled 4°C centrifuge, discarding the supernatant. Add 1 ml of 75% DEPC ethanol and mix by inverting. Centrifuge at 12000 rpm for 5 minutes in a pre-chilled 4°C centrifuge, discarding the supernatant. Air dry for 10-15 minutes (until the solution turns from white to transparent), add 10-15 μl of DEPC water, gently vortex to mix, and incubate on ice for 30 minutes to form an RNA solution. Take 1-2 μl of the RNA solution, measure and record the RNA concentration using a Nanodrop 2000c.

[0039] 4) The obtained total RNA was reverse transcribed into cDNA.

[0040] The total RNA obtained in step 3 was reverse transcribed into cDNA using the TIANGEN miRcute Enhanced miRNA cDNA First-Strand Synthesis Kit. The miRNA RT Enzyme Mix, stored at -20℃, was kept on ice beforehand. The 2× miRNA RT Reaction Buffer, stored at -20℃, was thawed and gently inverted or pipetted to mix. The total RNA mass of each patient's sample was fixed at 500 ng (total system 500 ng). The required volume of RNA solution was calculated based on the concentration measured using a NANODROP 2000c. A new RNase-free EP tube was prepared, and 10 μl of 2× miRNA RT Reaction Buffer, the calculated RNA solution volume, and 8 μl of RNase-free double-distilled water (minus the required RNA solution volume) were added sequentially. Finally, the miRNA RT Enzyme Mix was added. After brief centrifugation, the reaction was carried out at 42℃ for 60 minutes (miRNA A-tailing reaction and reverse transcription reaction), and then at 95℃ for 3 minutes (enzyme inactivation reaction).

[0041] 5) Quantitative real-time PCR detection of CT values ​​for urinary miR-98-5p, miR-204-5p, miR-194-5p, and housekeeping gene U6:

[0042] Based on SYBR Green quantitative PCR, the CT values ​​(cycle counts) of miR-98-5p, miR-204-5p, and miR-194-5p in the cDNA synthesized in step 4 were detected. The kit used was the TIANGEN miRcute Plus miRNA quantitative PCR kit. The 2×miRcute Plus miRNA Premix and Reverse Primer were thawed at room temperature; the thawed 2×miRcute Plus miRNA Premix was then mixed by inverting and gently centrifuged before use. Place the synthesized cDNA, RNase-free double-distilled water, and other reaction reagents on ice. Prepare the reaction system for quantitative real-time PCR: 10 μL of 2×miRcute Plus miRNA Premix, 0.4 μL of miR-98-5p, miR-204-5p, miR-194-5p, or U6 primers, 0.4 μL of Reverse Primer, 2 μL of miRNA first-strand cDNA, and 7.2 μL of RNase-free double-distilled water to bring the total reaction volume to 20 μL. Set the reaction conditions for each type of PCR instrument as follows: one cycle at 95°C for 15 minutes (initial template denaturation); followed by 40 to 45 cycles at 94°C for 20 seconds (template denaturation during PCR cycles) and 60°C for 34 seconds (annealing, extension). Each sample was prepared with two auxiliary wells (i.e., two additional replicates were performed under the same conditions). In the reaction, the housekeeping gene (U6) from the same patient was simultaneously amplified along with miR-98-5p, miR-204-5p, and miR-194-5p to determine the relative expression level of the target gene in the sample.

[0043] 6) The relative expression levels of miR-98-5p, miR-204-5p, and miR-194-5p were compared using the 2-Δct relative quantification method among the minimal change disease group, the normal healthy group, and the disease control group (IgA nephropathy, membranous nephropathy, and focal segmental glomerulosclerosis):

[0044] Using SPSS statistical software or Excel, the relative expression levels of urinary miR-98-5p, miR-204-5p, and miR-194-5p were calculated using the 2-Δct relative quantification method, i.e., 2-[(CT value of target gene in minimal change disease group - CT value of housekeeping gene in minimal change disease group)]. The 2-Δct value represents the expression levels of miR-98-5p, miR-204-5p, and miR-194-5p of patients in different groups relative to the internal reference gene U6 snRNA.

[0045] Example 2: Differences in urinary miR-98-5p, miR-204-5p, and miR-194-5p levels between the minimal change disease group and the normal control group.

[0046] Sixty patients with minimal change disease confirmed by renal biopsy were included in the study, and 60 age- and sex-matched healthy individuals served as the normal control group. The levels of urinary miR-98-5p, miR-204-5p, and miR-194-5p in the minimal change disease group were calculated using quantitative real-time PCR. The results showed that the urinary levels of miR-98-5p (P<0.001), miR-204-5p (P=0.017), and miR-194-5p (P=0.001) in the minimal change disease group were significantly higher than those in the normal control group. Figure 1 In the urine of patients with minimal change disease, the expression levels of miR-98-5p, miR-204-5p, and miR-194-5p were 0.0156±0.0377, 0.369±0.6761, and 0.2765±0.4799, respectively. In the urine of the normal control group, the expression levels of miR-98-5p, miR-204-5p, and miR-194-5p were 0.001±0.0009, 0.1337±0.3055, and 0.1231±0.3074, respectively.

[0047] Compared with the normal control group, the efficacy of miR-98-5p, miR-204-5p, and miR-194-5p levels in diagnosing minimal change disease was determined using ROC curves. As shown in the figure, the areas under the curve (AUC) of the ROC curves for miR-98-5p, miR-204-5p, and miR-194-5p were all statistically significant. Figure 2 (and Table 1).

[0048] Table 1. Areas under the maximum ROC curve that differentiate urinary miR-98-5p, miR-204-5p, and miR-194-5p in the minimal change disease group from those in the normal control group.

[0049]

[0050] The maximum AUC of miR-98-5p was 0.845. At maximum specificity, the cutoff value for miR-98-5p was 0.0039, with a specificity of 100% and a sensitivity of 50.0% (Table 2). Combining the three miRNAs did not further improve diagnostic performance.

[0051] Table 2. Maximum sensitivity and maximum specificity of urinary miR-98-5p in the minimal change disease group compared with the normal control group.

[0052]

[0053] Example 3: Method for differentiating adult minimal change disease from other kidney diseases

[0054] Sixty patients with minimal change disease (MND) confirmed by renal biopsy were included in the study, along with 290 patients in the disease control group (194 with IgA nephropathy, 83 with membranous nephropathy, and 13 with focal segmental glomerulosclerosis). Quantitative real-time PCR was used to calculate the urinary miR-98-5p, miR-204-5p, and miR-194-5p levels among the groups. The results showed that the urinary miR-98-5p (P = 0.001), miR-204-5p (P = 0.003), and miR-194-5p (P < 0.001) levels in the MND group were significantly higher than those in the other nephropathy groups. Figure 3 ).

[0055] In patients with minimal change disease, the expression levels of miR-98-5p, miR-204-5p, and miR-194-5p in urine were 0.0156±0.0377, 0.369±0.6761, and 0.2765±0.4799, respectively. In other nephropathy groups, the expression levels of miR-98-5p, miR-204-5p, and miR-194-5p in urine were 0.005±0.0113, 0.0995±0.1357, and 0.1005±0.1562, respectively.

[0056] Compared with other nephropathy groups, the efficacy of miR-98-5p, miR-204-5p, and miR-194-5p levels in diagnosing minimal change disease was determined using ROC curves. The results showed that the areas under the curves (AUC) of the ROC curves for miR-98-5p, miR-204-5p, and miR-194-5p were all statistically significant (Table 3).

[0057] Table 3. Areas under the largest ROC curves that differentiate urinary miR-98-5p, miR-204-5p, and miR-194-5p in the minimal change nephropathy group from other nephropathy groups.

[0058]

[0059] The highest AUC for miR-194-5p was 0.721. Combining the three miRNAs increased the AUC to 0.732 (Table 4 and...). Figure 4 ).

[0060] Table 4. Area under the largest ROC curve that distinguishes the three urinary miRNAs in the minimal change disease group from other nephropathy groups.

[0061]

[0062] Example 4: Differences in urinary miR-98-5p, miR-204-5p, and miR-194-5p levels between the minimal change disease group and all control groups.

[0063] Sixty patients with minimal change disease confirmed by renal biopsy were included. All control groups consisted of 60 age- and sex-matched healthy individuals (n=60) and 290 disease control groups (n=194 in IgA nephropathy, 83 in membranous nephropathy, and 13 in focal segmental glomerulosclerosis). Urinary miR-98-5p, miR-204-5p, and miR-194-5p levels were calculated using quantitative real-time PCR. Results showed that the urinary miR-98-5p (P<0.001), miR-204-5p (P=0.031), and miR-194-5p (P<0.001) levels in the minimal change disease group were significantly higher than those in all control groups. Figure 5 ).

[0064] In patients with minimal change disease, the expression levels of miR-98-5p, miR-204-5p, and miR-194-5p in urine were 0.0156±0.0377, 0.369±0.6761, and 0.2765±0.4799, respectively. In all control groups, the expression levels of miR-98-5p, miR-204-5p, and miR-194-5p in urine were 0.0100±0.0542, 0.1267±0.1583, and 0.1243±0.2634, respectively.

[0065] Compared with all control groups, the efficacy of miR-98-5p, miR-204-5p, and miR-194-5p levels in diagnosing minimal change disease was determined using ROC curves. The results showed that the areas under the curves (AUC) of the ROC curves for miR-98-5p, miR-204-5p, and miR-194-5p were all statistically significant (Table 5).

[0066] Table 5 shows the area under the maximum ROC curve for urinary miR-98-5p, miR-204-5p, and miR-194-5p in diagnosing minimal change disease.

[0067]

[0068] The highest AUC for miR-194-5p was 0.727. Combining the three miRNAs increased the AUC to 0.736 (Table 6 and...). Figure 6 ).

[0069] Table 6 shows the area under the maximum ROC curve for the combined diagnosis of minimal change disease using three urinary miRNAs.

[0070]

[0071] The main materials used in this embodiment are:

[0072] 1) Extract TRIzol from total RNA;

[0073] 2) miRcute Enhanced miRNA cDNA First Strand Synthesis Kit: Model KR211, manufactured by TIANGEN;

[0074] 3) Primers: The primer sequence for miR-98-5p is: CTCCTGAGGTAGTAAGT TGTATTGTTA (SEQ ID NO.1);

[0075] The primer sequence for miR-204-5p is: CACGCTTCCCTTTGTCATCCTAT (SEQ ID NO.2);

[0076] The primer sequence for miR-194-5p is: ACGTGTAACAGCAACTCCATGTG G (SEQ ID NO.3);

[0077] The primer sequence for the housekeeping gene U6 snRNA is: AAAGCAGGCUUUAAAG GAACCU (SEQ ID NO.4);

[0078] 4) miRcute Enhanced miRNA Quantitative Detection Kit (SYBR Green): Model FP411, manufactured by TIANGEN.

[0079] 5) Other reagents: chloroform, isopropanol, DEPC water, and RNase-free double-distilled water.

[0080] The main equipment in this embodiment is:

[0081] 1) Various PCR instruments.

[0082] 2) Various types of benchtop low-temperature high-speed centrifuges.

[0083] 3) SPSS software: Any version of SPSS software is acceptable.

[0084] The main operation steps in this embodiment are as follows:

[0085] 1) Sample collection and preservation

[0086] Collect 50-100 ml of morning urine from patients with minimal change disease, IgA nephropathy, membranous nephropathy, focal segmental glomerulosclerosis, and healthy individuals using 50 ml sterile centrifuge tubes. Use 1-2 tubes per patient and store in an ice box or at 4°C before transporting them back to the laboratory for processing.

[0087] 2) Separation of urine sediment

[0088] The collected morning urine was centrifuged at 3000g for 30 minutes at 4°C. The supernatant of the urine was discarded, and the small amount of supernatant remaining at the bottom of the tube was carefully aspirated with a pipette tip, while retaining the urine sediment.

[0089] 3) Extraction of total RNA from urine sediment (TRIzol method)

[0090] Add 500 μL of TRIzol pre-chilled at 4°C to the total urine sediment, mix well by pipetting, and transfer the liquid to a new 1.5 ml EP tube without RNase. Let stand at room temperature for 5 min.

[0091] Add 200 μl of chloroform (trichloromethane) at room temperature, shake vigorously for 15 seconds until the chloroform is completely mixed, and let stand at room temperature for 3 minutes.

[0092] Centrifuge at 4℃ and 12000rpm for 15 minutes. The liquid in the EP tube can be seen to separate into 3 layers (the upper transparent aqueous phase is RNA, the middle white phase is protein, and the lower pink phase is DNA).

[0093] Carefully transfer the upper clear aqueous phase to a sterilized 1.5ml EP tube without RNase, avoiding aspirating the middle protein layer as much as possible.

[0094] Add an equal volume of isopropanol at -20°C and incubate on ice for 20 minutes (to precipitate the RNA from the liquid to a solid).

[0095] Centrifuge at 4℃ and 12000rpm for 15 minutes, then discard the supernatant;

[0096] Add 1 ml of 75% DEPC ethanol and mix by inverting.

[0097] Centrifuge at 4℃, 12000 rpm, for 5 min, and discard the supernatant;

[0098] Carefully aspirate the liquid with a pipette tip, air dry for 5-15 minutes (from white to transparent), add 10-15 μl of DECP water, gently vortex to mix, and incubate on ice for 30 minutes to form an RNA solution.

[0099] Take 1-2 μl of RNA solution and measure the RNA concentration using a Nanodrop 2000c.

[0100] 4) Reverse transcription to synthesize cDNA

[0101] Total RNA extracted was reverse transcribed into cDNA using the TIANGEN miRcute enhanced miRNA cDNA first-strand synthesis kit.

[0102] Place the miRNA RT Enzyme Mix frozen at -20℃ on ice for later use. Thaw the frozen 2× miRNA RT Reaction Buffer and gently invert to mix.

[0103] The total RNA mass of the sample was fixed at 500 ng (total system 500 ng), and the volume of RNA solution (Total RNA) added was calculated based on the measured concentration.

[0104] Prepare a new RNase-free 0.5ml EP tube, add 10μl of 2×miRNA RT Reaction Buffer, the calculated RNA solution volume, and 8μl of RNase-free double-distilled water minus the required RNA solution volume; finally, add miRNA RTEnzyme Mix.

[0105] After a brief centrifugation, the reaction was carried out at 42°C for 60 min (miRNA A-tailing reaction and reverse transcription reaction), and then at 95°C for 3 min (enzyme inactivation reaction).

[0106] 5) Detect the expression levels of miR-98-5p, miR-204-5p, and miR-194-5p:

[0107] The expression levels of miR-98-5p, miR-204-5p, and miR-194-5p in the synthesized cDNA were detected using SYBR Green real-time PCR technology, and the kit used was the miRcute enhanced miRNA real-time detection kit from TIANGEN.

[0108] Melt 2×miRcute Plus miRNA Premix and Reverse Primer at room temperature; mix the melted 2×miRcute Plus miRNA Premix by inverting the container, centrifuge slightly, and set aside.

[0109] Place the synthesized cDNA, RNase-free double-distilled water, and other reaction reagents on ice; prepare the reaction mixture as follows: 10 μl of 2×miRcute Plus miRNA Premix, 0.4 μl of miR-98-5p, miR-204-5p, miR-194-5p, or U6 primer, 0.4 μl of Reverse Primer, 2 μl of miRNA first-strand cDNA, and 7.2 μl of RNase-free double-distilled water. Bring the reaction mixture to a final volume of 20 μl.

[0110] The reactions were performed using various PCR instruments under the following conditions: 1× (one cycle) – 95℃, 15 min (initial template denaturation); followed by 40-45× (40 to 45 cycles) – 94℃, 20 sec (template denaturation during PCR cycles) and 60℃, 34 sec (annealing, extension). Two auxiliary wells were provided for each sample containing miR-98-5p, miR-204-5p, miR-194-5p, and U6 (i.e., two additional replicates were performed under the same conditions). Housekeeping gene (U6) was amplified simultaneously with the test sample to determine the expression level of the target gene in the sample.

[0111] 6) The expression levels of miR-98-5p, miR-204-5p, and miR-194-5p were compared between the minimal change disease group and the control group (including the normal control group and the disease control group) using the 2-Δct relative quantification method:

[0112] Using SPSS statistical software, the expression levels of miR-98-5p, miR-204-5p, and miR-194-5p were compared using the 2-Δct relative quantification method, i.e., 2-[(CT value of target gene in minimal change disease group - CT value of housekeeping gene in minimal change disease group)]. The 2-Δct value represents the expression levels of miR-98-5p, miR-204-5p, and miR-194-5p in patients from different groups relative to the internal reference gene U6 snRNA.

[0113] 7) ROC curves for the combined diagnosis of minimal change disease using miR-98-5p, miR-204-5p, and miR-194-5p:

[0114] With a healthy control group as the general population, the area under the ROC curve (AUC) for the combined diagnosis of minimal change disease using the three biomarkers miR-98-5p, miR-204-5p, and miR-194-5p was 0.821 (ranges 0.697 and 0.946). With a healthy control group and disease control groups (IgA nephropathy, membranous nephropathy, and focal segmental glomerulosclerosis) as the general population, the AUC for the combined diagnosis using the three miRNA biomarkers was 0.736 (ranges 0.636 and 0.835).

[0115] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Use of a reagent for detecting the expression amount of miR-98-5p in the preparation of a kit for detecting adult minimal change nephropathy.

2. Use according to claim 1, characterized in that, The kit detects the expression amount of miR-98-5p relative to the housekeeping gene U6 in the urine sample by fluorescence quantitative PCR.

3. Use according to claim 2, characterized in that, When the relative expression amount of miR-98-5p relative to the housekeeping gene U6 is greater than 0.0039, it is identified that the probability of the sample under test developing adult minimal change nephropathy is greater than 99%.

4. Use of a reagent for detecting the expression amount of miR-98-5p, miR-204-5p and miR-194-5p in the preparation of a kit for differentiating adult minimal change nephropathy from other nephropathies.

Images