A SNP molecular marker related to the alkali tolerance of alfalfa and application thereof

Abstract

The application discloses a SNP molecular marker related to the alkali resistance of Medicago sativa and application thereof. One technical solution of the application is that a composition for detecting the polymorphism or genotype (i.e. allele) of a Chr7-16804032 site in the genome of Medicago sativa is applied to identify or assist in identifying the alkali resistance of Medicago sativa. The composition for detecting the polymorphism or genotype of the Chr7-16804032 site can be combined with other substances (such as substances for detecting single nucleotide polymorphisms or genotypes of other molecular markers related to the alkali resistance of Medicago sativa) to prepare a product for identifying Medicago sativa varieties with strong alkali resistance.

Description

TECHNICAL FIELD

[0001] The present application relates to the application of molecular markers, in particular to a SNP molecular marker related to the alkali tolerance of Medicago sativa and the application thereof. BACKGROUND

[0002] Medicago sativa is a perennial herb of the genus Medicago in the family Leguminosae, with high yield and high protein content, and is a high-quality forage grass. Medicago sativa has developed root system, with thick main root, and can prevent water and soil, prevent water and soil loss, and fix soil and conserve soil moisture. As a legume, Medicago sativa can improve soil and has the effect of fixing nitrogen fertilizer, and has certain improvement effect on saline-alkali land.

[0003] Marker assisted selection (MAS) is genotype-based selection, which is not affected by external environmental factors, and is more and more widely used in breeding practice. SNP is the abbreviation of single nucleotide polymorphism, which refers to the variation of a single nucleotide on the genome, including substitution, transversion, deletion and insertion. CAPS is a kind of molecular marker that can be used to identify or assist in identifying the polymorphism or genotype of SNP site, which is designed according to the DNA sequence of known site, and a certain DNA fragment near the site is amplified by PCR technology, and then the fragment is recognized and cut by a certain restriction enzyme, and then the polymorphism or genotype of SNP site can be identified or assisted in identifying. By identifying or assisting in identifying the saline-alkali Medicago sativa material through molecular markers, more saline-alkali tolerant Medicago sativa varieties can be selected. SUMMARY

[0004] One of the technical problems to be solved by the present application is how to identify or assist in identifying the alkali tolerance of Medicago sativa.

[0005] In order to solve the above technical problem, the present application provides any one of the following A1-A3 applications, and the method of A4:

[0006] A1, the application of a substance for detecting the polymorphism or genotype (i.e. allele) of Chr7-16804032 site in the genome of Medicago sativa in identifying or assisting in identifying the alkali tolerance of Medicago sativa; the Chr7-16804032 site is a SNP site in the genome of Medicago sativa, and the nucleotide type is G or T, which is the 92nd nucleotide of SEQ ID No. 1;

[0007] A2, the application of a substance for detecting the polymorphism or genotype (i.e. allele) of Chr7-16804032 site in the genome of Medicago sativa in preparing a product for identifying or assisting in identifying the alkali tolerance of Medicago sativa; the Chr7-16804032 site is a SNP site in the genome of Medicago sativa, and the nucleotide type is G or T, which is the 92nd nucleotide of SEQ ID No. 1;

[0008] A3、the application of a substance for detecting the polymorphism or genotype (i.e. allele) of the Chr7-16804032 locus in the alfalfa genome in alfalfa breeding or in the preparation of alfalfa breeding products; the Chr7-16804032 locus is a SNP locus in the alfalfa genome, and the nucleotide species is G or T, which is the 92nd nucleotide of SEQ ID No. 1.

[0009] The purpose of the breeding includes breeding alfalfa with strong alkali resistance.

[0010] A4、a method for identifying or assisting in identifying the alkali resistance of alfalfa, comprising detecting the genotype of the alfalfa to be tested, and identifying or assisting in identifying the alkali resistance of the alfalfa according to the genotype of the alfalfa to be tested; the genotype is the genotype of the Chr7-16804032 locus in the alfalfa genome; the Chr7-16804032 locus is a SNP locus in the alfalfa genome, and the nucleotide species is G or T, which is the 92nd nucleotide of SEQ ID No. 1.

[0011] Another technical problem to be solved by the present application is how to breed alfalfa.

[0012] In order to solve the above technical problems, the present application provides the following technical solutions:

[0013] B1、the application of the method of A4 in alfalfa breeding.

[0014] The purpose of the breeding includes breeding alfalfa with strong alkali resistance.

[0015] B2、a method for breeding alfalfa, comprising: detecting the polymorphism of the Chr7-16804032 locus in the alfalfa genome, and selecting alfalfa with the Chr7-16804032 locus in the homozygous type of T in the alfalfa genome as a parent for breeding.

[0016] The purpose of the breeding includes breeding alfalfa with strong alkali resistance.

[0017] The following any one of 1)-3) containing a composition for detecting the polymorphism or genotype (i.e. allele) of the Chr7-16804032 locus in the alfalfa genome also belongs to the protection scope of the present application:

[0018] 4) a product for detecting a single nucleotide polymorphism or genotype related to the alkali resistance of alfalfa;

[0019] 5) a product for identifying or assisting in identifying the alkali resistance of alfalfa;

[0020] 6) Products used for alfalfa breeding.

[0021] In the above-mentioned applications, methods and products, the Chr7-16804032 site is a SNP site in the alfalfa genome, and its nucleotide type is G or T, which is the 92nd nucleotide of SEQ ID No.1. The polymorphism or genotype (i.e., allele) of the Chr7-16804032 site in the alfalfa genome can be specifically the nucleotide type of the Chr7-16804032 site detected. The genotype of the Chr7-16804032 site in the alfalfa genome can be GG, TT or GT. The GG is a homozygous type in which the Chr7-16804032 site in the alfalfa genome is G, the TT is a homozygous type in which the Chr7-16804032 site in the alfalfa genome is T, and the GT is a heterozygous type in which the Chr7-16804032 site in the alfalfa genome is G and T.

[0022] In the method described in A4, the alkali resistance of the alfalfa to be tested can be identified or auxiliary identified based on the genotype of the alfalfa to be tested, and the alkali resistance of the alfalfa to be tested with the genotypes TT and GT can be stronger or potentially stronger than the alkali resistance of the alfalfa to be tested with the genotype G / G.

[0023] In the above applications, methods and products, the alfalfa breeding is to cultivate alfalfa with strong alkali resistance.

[0024] In the above applications, methods and products, the composition for detecting the polymorphism or genotype (i.e., allele) of the Chr7-16804032 site in the alfalfa genome can be the reagents and / or instruments required for determining the polymorphism or genotype of Chr7-16804032 by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography and SNP chip. Among them, SNP chip includes chips based on nucleic acid hybridization reaction, chips based on single base extension reaction, chips based on allele-specific primer extension reaction, chips based on "one-step" reaction, chips based on primer ligation reaction, chips based on restriction endonuclease reaction, chips based on protein DNA binding reaction, and chips based on fluorescent molecule DNA binding reaction.

[0025] In the above applications, methods and products, the composition for detecting the polymorphism or genotype (i.e., allele) of the Chr7-16804032 site in the alfalfa genome is as follows 1), 2) or 3):

[0026] D1) the composition for detecting the polymorphism or genotype of the Chr7-16804032 site in the alfalfa genome comprises PCR primers for amplifying an alfalfa genomic DNA fragment including the Chr7-16804032 site and an XbaI enzyme;

[0027] D2) the composition for detecting the polymorphism or genotype of the Chr7-16804032 site in the alfalfa genome is a PCR reagent containing the PCR primers and an XbaI enzyme;

[0028] D3) A kit containing the PCR primers described in D1) or the PCR reagents described in D2) and XbaI enzyme.

[0029] In the above applications, methods and products, the PCR primers may be single-stranded DNA having a nucleotide sequence of SEQ ID No. 2 and single-stranded DNA having a nucleotide sequence of SEQ ID No. 3.

[0030] In the above applications, methods and products, the product may be a reagent or a kit or a system, and the system may include a combination product of a reagent or a kit, an instrument and analysis software.

[0031] The present invention discloses a new SNP site, Chr7-16804032, for detecting alkaline resistance in alfalfa. When the nucleotide type at this site is T, an XbaI enzyme recognition site is formed, and the genotype at this site can be detected using a CAPS method. Examples of the present invention verify that strains with a genotype of TT at the Chr7-16804032 site are more alkali-resistant than strains with a genotype of GG. This invention has important theoretical significance and economic value for the use of molecular markers to assist in the selection of alfalfa varieties with strong alkaline resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 This is the result of genome-wide association analysis of alkali stress in alfalfa in Example 1 of the present invention.

[0033] Figure 2 Schematic diagram of the Chr7-16804032 site in Example 1 of the present invention. When the Chr7-16804032 site is T, the recognition sequence "TCTAGA" of the XbaI enzyme is formed.

[0034] Figure 3 This is a gel image of the CAPS experiment of Chr7-16804032 site of some strains in Example 2 of the present invention.

[0035] Figure 4Figure 2 is a box plot of the distribution of ARI corresponding to the genotype of the Chr7-16804032 locus of the alfalfa population in Example 2 of the present application. G / G means that the genotype of the Chr7-16804032 locus is GG, G / T means that the genotype of the Chr7-16804032 locus is GT, and T / T means that the genotype of the Chr7-16804032 locus is TT. The dots are extreme values of the data, and the difference is tested by One-way ANOVA, and different lowercase letters represent the results of significant difference analysis between treatments, with P < 0.05.

[0036] Figure 5 Figure 3 is the alkali sensitivity comparison result of the strain with the genotype of the Chr7-16804032 locus being GG and the strain with the genotype of the Chr7-16804032 locus being TT in Example 3 of the present application. A84 is the strain with the genotype of the Chr7-16804032 locus being GG, and the other strains are the strains with the genotype of the Chr7-16804032 locus being TT.

[0037] Figure 6 Figure 4 is the ARI statistics and protein content statistics of the strain with the genotype of the Chr7-16804032 locus being GG and the strain with the genotype of the Chr7-16804032 locus being TT under alkali stress in Example 3 of the present application. A84 is the strain with the genotype of the Chr7-16804032 locus being GG, and the other strains are the strains with the genotype of the Chr7-16804032 locus being TT. Figure 6 Figure 4A is the ARI statistics result, and the difference is tested by One-way ANOVA, and different lowercase letters represent the results of significant difference analysis between treatments, with P < 0.05. Figure 6 Figure 4B is the protein content statistics result; A84 is the strain with the genotype of the Chr7-16804032 locus being GG, and the other strains are the strains with the genotype of the Chr7-16804032 locus being TT, and the difference is tested by Student's t-test, and * represents that the significant difference analysis result between different strains is P < 0.05. DETAILED DESCRIPTION

[0038] The present application will be further described in detail below in conjunction with specific embodiments, and the embodiments given are only for the purpose of illustrating the present application, and are not intended to limit the scope of the present application. The embodiments provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not constitute any limitation on the present application in any way.

[0039] In the following examples, the experimental methods are all conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial channels, unless otherwise specified. In the quantitative tests in the following examples, three repeated experiments were set, and the average value was taken.

[0040] In the following examples, the alfalfa variety WL319HQ is a product of Beijing Zhengdao Seed Co., Ltd.

[0041] Example 1

[0042] The present invention uses the Alkali Resistance Index (ARI), which is the ratio of fresh weight after alkali stress to fresh weight before alkali stress, to measure the strength of plant alkali resistance. Through two GWAS analysis results, two repeated experiments ARI1 and ARI2, 22 and 19 SNP sites (-log ) that may be associated with alkali stress traits were obtained in the alfalfa variety WL319HQ, respectively. 10 (P)>5.0)( Figure 1 Points above the ARI1 horizontal line and points above the ARI2 horizontal line), and a SNP site was co-located ( Figure 1 The black arrow indicates the location of the locus, designated Chr7-16804032. This locus is located at position 16804032 on chromosome 7 of the Medicago sativa reference genome, specifically nucleotide position 92 of SEQ ID No. 1. Its nucleotide type is either G or T, represented by the letter K. Its first allele is GG (i.e., homozygous for nucleotide position G at SEQ ID No. 1); its second allele is TT (i.e., homozygous for nucleotide position T at SEQ ID No. 1); and its third allele is GT (i.e., heterozygous for nucleotide position G and T at SEQ ID No. 1).

[0043] Schematic diagram of SNP1 site is shown in Figure 2 When the Chr7-16804032 site is T, the recognition sequence "TCTAGA" of the XbaI enzyme is formed. Therefore, the CAPS test can be used to identify the SNP site: the identification primers are composed of CAPS-F and CAPS-R:

[0044] CAPS-F: 5'-GGATCAACTGCCGTCTTTAA-3' (SEQ ID No. 2, identical to positions 1-20 of SEQ ID No. 1);

[0045] CAPS-R: 5'-CATTATCAATTCTCCTGAGC-3' (SEQ ID No. 3, reverse complement to the sequence at positions 249-268 of SEQ ID No. 1).

[0046] After PCR amplification, XbaI enzyme was used for enzyme digestion. The electrophoresis bands after CAPS experiment are as follows:

[0047] The electrophoresis band of the homozygous strain with the Chr7-16804032 allele type of GG was at 268 bp;

[0048] The homozygous strain with the TT allele of Chr7-16804032 showed two bands, one of 176 bp and the other of 92 bp;

[0049] The heterozygous strain with the GT allele of Chr7-16804032 had three bands, sized 268 bp, 176 bp, and 92 bp, respectively.

[0050] Example 2

[0051] Method for constructing a WL319HQ strain population: Alfalfa is self-incompatible and cross-pollinates, resulting in genetic variation between individuals of the same variety, with intraspecific variation greater than interspecific variation. Based on this, seeds of alfalfa WL319HQ were planted in soil. Stem segments from each seed were cut and rooted to create a single strain. These cuttings were used in subsequent experiments to ensure genetic stability.

[0052] In this example, a total of 243 alfalfa lines (Table 4) from the WL319HQ line population were used to determine the Alkali Resistance Index (ARI) and perform a CAPS experiment.

[0053] 1. Determination of alkali resistance index

[0054] Plant the alfalfa strains to be tested in 8cm×8cm pots, with one strain planted per pot. Each strain to be tested was planted in 3 pots. Each strain was divided into an alkaline stress treatment group and a control group, as follows:

[0055] Alkali stress treatment group: After the plants were mowed twice, they were irrigated with 100mM NaHCO3 aqueous solution (solute: NaHCO3, solvent: water), with each irrigation volume of 1L, once a week, for a total of three times, and the final soil alkaline content was 1.17%. After one month of growth, the aboveground part was mowed and its fresh weight was measured as the fresh weight after alkaline stress.

[0056] Control group: After the plants were mowed twice, they were irrigated with 1 L of water each time, once a week, for a total of three times. After one month of growth, the aboveground parts were mowed and their fresh weight was measured as the fresh weight before alkali stress.

[0057] ARI is calculated using the following formula:

[0058] ARI = fresh weight after alkali stress / fresh weight before alkali stress × 100%

[0059] 2. CAPS experiment

[0060] 2.1 DNA extraction

[0061] The alfalfa materials to be tested were used to extract DNA from each sample using a plant genomic DNA extraction kit (Tiangen Plant Genome Rapid Extraction Kit, product number DP321).

[0062] 2. CAPS assay for genotyping

[0063] The identification primers CAPS-F and CAPS-R are used to form a PCR reaction system. The specific PCR reaction system is as follows:

[0064] Table 1 PCR reaction system (10 μL)

[0065] Reagent name Volume (μL) 2×TaqMasterMix 5 Primer F 0.5 Primer R 0.5 DNA template 1 H2O 3

[0066] Table 2 PCR reaction conditions

[0067]

[0068] The amplified product was collected and digested with XbaI enzyme. Specifically, the enzyme digestion system was added to the amplified product and digested at 37°C overnight. The specific reaction system is shown in Table 3.

[0069] Table 3 CAPS reaction system (12 μL)

[0070]

[0071]

[0072] The digestion products were subjected to agarose gel electrophoresis and analyzed according to the following standards:

[0073] The electrophoresis band of the homozygous strain with the Chr7-16804032 allele type of GG was at 268 bp;

[0074] The homozygous strain with the TT allele of Chr7-16804032 showed two bands, one of 176 bp and the other of 92 bp;

[0075] The heterozygous strain with the GT allele of Chr7-16804032 had three bands, sized 268 bp, 176 bp, and 92 bp, respectively.

[0076] The ARI determination results and genotyping results of each sample are shown in Table 4, and the genotyping statistical results are shown in Table 5:

[0077] Table 4

[0078]

[0079]

[0080]

[0081]

[0082]

[0083]

[0084]

[0085]

[0086]

[0087] Table 5

[0088] genotype GG GT TT Corresponding strain coefficient 74 158 11

[0089] The bands of some strains are shown in Figure 3 :

[0090] The homozygous strain (A84) with the Chr7-16804032 allele type of GG had an electrophoresis band at 268 bp;

[0091] Homozygous lines with the TT allele type of Chr7-16804032 (A70, A74, A85, A103, A133, A157, A159, A170, A251, A266, and A267) showed two bands, one of 176 bp and the other of 92 bp;

[0092] The heterozygous strain (A79) with the GT allele type of Chr7-16804032 showed three bands with sizes of 268 bp, 176 bp and 92 bp respectively.

[0093] The ARI distribution box plot corresponding to the genotype of the Chr7-16804032 locus in the population is shown in Figure 4 , indicating that the alkali tolerance of alfalfa lines with the TT genotype was significantly higher than that of alfalfa lines with the GT genotype, and the alkali tolerance of alfalfa lines with the GT genotype was significantly higher than that of alfalfa lines with the GG genotype. This indicates that the alkali tolerance of plants is improved after the Chr7-16804032 site changes from G to T.

[0094] The homozygous strain A84 with the screened Chr7-16804032 allele type of GG was selected for a phenotypic comparison experiment with the homozygous strains (A70, A74, A85, A103, A133, A157, A159, A170, A251, A266 and A267) with the screened Chr7-16804032 allele type of TT.

[0095] The alfalfa strains to be tested were planted in 8cm×8cm pots, with one plant per pot. Each strain to be tested was planted in 3 pots. Each strain was divided into an alkaline stress treatment group and a control group, as follows:

[0096] Alkali stress treatment group: After the plants were mowed twice, they were irrigated with 100mM NaHCO3 aqueous solution (solute: NaHCO3, solvent: water), with each irrigation volume of 1L, once a week, for a total of three times, and the final soil alkaline content was 1.17%. After one month of growth, the aboveground part was mowed and its fresh weight was measured as the fresh weight after alkaline stress.

[0097] Control group: After the plants were mowed twice, they were irrigated with 1 L of water each time, once a week, for a total of three times. After one month of growth, the aboveground parts were mowed and their fresh weight was measured as the fresh weight before alkali stress.

[0098] ARI is calculated using the following formula:

[0099] ARI = fresh weight after alkali stress / fresh weight before alkali stress × 100%

[0100] The protein content of different strains was determined as follows.

[0101] See the results Figure 5 and Figure 6 The results showed that the strains with the TT genotype at the Chr7-16804032 locus (A70, A74, A85, A103, A133, A157, A159, A170, A251, A266, and A267) had significantly higher ARI under alkaline stress than the strain with the GG genotype (A84). There was no significant difference in alkaline tolerance among the strains with the TT genotype, verifying that the alkali tolerance of the plants increased after the Chr7-16804032 locus changed from G to T. To better adapt to agricultural production, the alkali tolerance index and protein content of the different strains were measured. It was found that the alkali tolerance index and protein content of the strains with the TT genotype under alkaline stress were significantly higher than those of the strains with the GG genotype. This shows that the strains with the TT genotype are more adaptable to alkaline stress environments.

[0102] Therefore, the Chr7-16804032 locus is associated with plant alkali tolerance. This molecular marker is accurate and efficient in detection, and convenient and stable in amplification, which is of great significance for molecular marker-assisted selection and improving the efficiency of identifying different alkali-tolerant alfalfa varieties.

[0103] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

[0104] Sequence Listing

[0105] SEQ ID No.1

[0106] 5'-GGATCAACTGCCGTCTTTAATCATATTGCATTGGGTTTCACTCCACTTTC TAACATGGACAAGAGCTTACGATTAGAATTAGAAGACTAAKCTAGATAACCCCTGTGATCCACCTCAAGAGGGTAGGGAGAGGTTGCATCGTTAGTTTTTAGTTGCCGAAGGCATTAACCATTATCAGACAAGCAAAAACTGTTTAAACAAATAACTAAGTTTCTTTCTTATCTTTTGTTGTTATAATTCTTTTTTTGCTCAGGAGAATTGATAATG-3'.

Claims

1. Use of a substance for detecting the polymorphism or genotype of Chr7-16804032 in the alfalfa genome in assisting the identification of alfalfa alkali tolerance; Chr7-16804032 is a single nucleotide polymorphism (SNP) in the alfalfa genome, its nucleotide type is G or T, and it is the 92nd nucleotide in SEQ ID No. 1; the alfalfa is from the WL319HQ strain population.

2. Use of a substance for detecting the polymorphism or genotype of the Chr7-16804032 site in the alfalfa genome in the preparation of a product to assist in identifying alfalfa alkali resistance; the Chr7-16804032 site is a SNP site in the alfalfa genome, its nucleotide type is G or T, and it is the 92nd nucleotide in SEQ ID No. 1; the alfalfa is from the WL319HQ strain population.

3. Use of a substance for detecting the polymorphism or genotype of the Chr7-16804032 site in the alfalfa genome in alfalfa breeding or in the preparation of alfalfa breeding products; the Chr7-16804032 site is a SNP site in the alfalfa genome, its nucleotide type is G or T, and it is the 92nd nucleotide of SEQ ID No. 1; the alfalfa is from the WL319HQ strain population; and the alfalfa breeding is to cultivate alfalfa with strong alkali resistance.

4. A method for assisting in identifying the alkali resistance of alfalfa, comprising detecting the genotype of the alfalfa to be tested, and assisting in identifying the alkali resistance of the alfalfa based on the genotype of the alfalfa to be tested; the genotype is the genotype of the Chr7-16804032 site in the alfalfa genome; the Chr7-16804032 site is a SNP site in the alfalfa genome, the nucleotide type of which is G or T, and is the 92nd nucleotide of SEQ ID No. 1; the alfalfa is from the WL319HQ strain population.

5. Use of the method according to claim 4 in alfalfa breeding; the alfalfa is from the WL319HQ strain population; and the alfalfa breeding is to cultivate alfalfa with strong alkali resistance.

6. A method for breeding alfalfa, comprising: The polymorphism of the Chr7-16804032 site in claim 1 in the alfalfa genome is detected, and homozygous alfalfa with the Chr7-16804032 site as T in the alfalfa genome is selected as a parent for breeding; the alfalfa is from the WL319HQ strain population; and the alfalfa breeding is to cultivate alfalfa with strong alkali resistance.

7. The use according to any one of claims 1 to 3 and 5 or the method according to claim 4 or 6, characterized in that: The substance for detecting the polymorphism or genotype of the Chr7-16804032 site in the alfalfa genome is as follows: D1), D2) or D3): D1) the material for detecting the polymorphism or genotype of the Chr7-16804032 site in the alfalfa genome comprises PCR primers for amplifying a DNA fragment of the alfalfa genome including the Chr7-16804032 site and XbaI enzyme; D2) the substance for detecting the polymorphism or genotype of the Chr7-16804032 site in the alfalfa genome is a PCR reagent containing the PCR primers and an XbaI enzyme; D3) A kit containing the PCR primers described in D1) or the PCR reagents described in D2) and XbaI enzyme.

8. The use or method according to claim 7, characterized in that: The PCR primers are a primer pair consisting of the single-stranded DNA shown in SEQ ID No. 2 in the sequence listing and the single-stranded DNA shown in SEQ ID No. 3 in the sequence listing.

Images