Anti-inhibin antibodies and their applications

Abstract

The present disclosure provides anti-inhibin antibodies and their applications. The antibodies can relieve the inhibitory effect of inhibin on the secretion of endogenous follicle-stimulating hormone (FSH), promote endogenous FSH secretion and promote animal follicle development. To a certain extent, they can replace the use of FSH or pregnant mare serum gonadotropin (PMSG) in animal reproduction and production, and can be used to promote animal reproduction, synchronize estrus, conception and farrowing, embryo transfer, improve ovulation quality, promote livestock reproduction, and induce estrus in female animals.

Description

Technical Field

[0001] The present disclosure belongs to the field of animal reproduction technology. Specifically, the present disclosure relates to an anti-inhibin antibody and its application in assisting animal reproduction. Background Art

[0002] Inhibin is a water-soluble protein hormone secreted by the animal gonads. It belongs to the transforming growth factor β superfamily (TGF-β) and is named for its potent inhibitory effect on the production and secretion of follicle-stimulating hormone (FSH) from the pituitary gland. Inhibin exists as an αβ heterodimer, with the β subunits divided into five types: βA, βB, βC, βD, and βE. Currently, inhibin A (αβA) and inhibin B (αβB) have been studied extensively. Both inhibit FSH synthesis and secretion. Inhibin A is primarily secreted by the dominant follicle and corpus luteum, while inhibin B is secreted by small and medium-sized antral follicles. Numerous studies have reported that neutralizing inhibin through active or passive immunotherapy can stimulate endogenous FSH production and secretion, stimulate follicular development, and increase ovulation in female animals. These studies suggest that both approaches have the potential to regulate livestock reproductive performance and are of great value to livestock production and economic animal reproduction.

[0003] Currently, there are relevant patents and articles reporting that partial peptide segments of the inhibin α subunit are coupled to some carrier proteins or recombinant inhibin α subunit protein is directly used as an immunogen to actively immunize female animals, thereby relieving the inhibitory effect of inhibin on the secretion of derived FSH. The number of ovulations after immunization can be significantly increased. However, inhibin is an influencing factor for the implantation of fertilized eggs. Active immunization-induced long-term antibody neutralization of inhibin has a negative impact on the conception rate, which may lead to an increase in the number of ovulations but a decrease in the conception rate.

[0004] At the same time, the effects of passive immunization with inhibin on the reproductive performance of female animals have also been extensively studied. By immunizing animals with antigens prepared by coupling partial peptide fragments of the inhibin α subunit with certain carrier proteins, the corresponding inhibin antiserum (AIS) is prepared. The AIS is then injected into female animals to passively neutralize endogenous inhibin. This method has significantly increased the number of ovulations in mice, sheep, pigs, cattle, horses, and fish. According to a patent (CN111134084A) published by Pan Jianzhi et al. of the Zhejiang Academy of Agricultural Sciences, AIS has also shown clinical efficacy superior to pregnant mare serum gonadotropin (PMSG) in timed insemination procedures in pigs, outperforming PMSG in terms of ovulation rate, reducing ovarian cyst rates, and improving hormone secretion in gilts. Therefore, if AIS is used instead of PMSG during superovulation or timed insemination, the reproductive performance of female animals can be further improved. However, AIS is a polyclonal antibody with complex components and large batch-to-batch differences, making it difficult to meet the basic principle of drug quality control. In addition, animals need to be repeatedly injected with immunogens each time they are prepared, which takes a long preparation cycle. Finally, blood must be drawn from the immunized animals, which may lead to abnormal death of the animals in the middle of the process and is not in line with animal ethics.

[0005] A patent published in 1991 (WO1991010449A1) mentions the use of inhibin-neutralizing antibodies to stimulate superovulation in domestic mammals, specifying that the antibodies can be either polyclonal or monoclonal. However, the specification only discloses the preparation of polyclonal antibodies and their use in superovulation in domestic mammals, without disclosing any information regarding the preparation and use of monoclonal antibodies.

[0006] Therefore, since active immunization with inhibins has a negative impact on conception rates and the AIS components used for passive immunization are complex and difficult to drug, the animal breeding field, especially economic animals, requires monoclonal antibodies with clear components and the ability to specifically neutralize inhibins. Summary of the Invention

[0007] The present disclosure relates to an anti-inhibin antibody or an antigen-binding portion thereof, which is used for immunoneutralization of inhibin, promoting the production and secretion of endogenous FSH, stimulating follicle development in female animals and increasing the number of ovulations.

[0008] The present disclosure provides a method for preparing anti-inhibin monoclonal antibody hybridoma cell lines 4D826 and 1E57, the method comprising:

[0009] (1) using a pre-prepared porcine inhibin α subunit 6-25 fragment (the polypeptide sequence is shown in SEQ ID NO. 24 in the sequence list) coupled with a carrier protein as an immunogen to immunize an animal;

[0010] (2) isolating spleen cells from the immunized animal and fusing them with appropriate myeloma cells under conditions suitable for producing hybridoma cells;

[0011] (3) Screening and culturing the hybridoma cells obtained as described above.

[0012] The present disclosure provides an anti-inhibin antibody, or an antigen-binding portion thereof, selected from 4D8 and 1E5.

[0013] The present disclosure provides an anti-inhibin antibody or an antigen-binding portion thereof, which has heavy chain CDRs as shown in the amino acid sequences of SEQ ID NOs. 1, 2, and 3, and light chain CDRs as shown in the amino acid sequences of SEQ ID NOs. 4, 5, and 6; and an anti-inhibin antibody or an antigen-binding portion thereof, which has heavy chain CDRs as shown in the amino acid sequences of SEQ ID NOs. 11, 12, and 13, and light chain CDRs as shown in the amino acid sequences of SEQ ID NOs. 14, 15, and 16.

[0014] The present disclosure provides an anti-inhibin antibody or an antigen-binding portion thereof, which has a 4D8 monoclonal antibody heavy chain variable region as shown in the amino acid sequence of SEQ ID NO.7, and a 4D8 monoclonal antibody light chain variable region as shown in the amino acid sequence of SEQ ID NO.9; and an anti-inhibin antibody or an antigen-binding portion thereof, which has a 1E5 monoclonal antibody heavy chain variable region as shown in the amino acid sequence of SEQ ID NO.17, and a 1E5 monoclonal antibody light chain variable region as shown in SEQ ID NO.19.

[0015] The present disclosure provides nucleic acids encoding the above-mentioned anti-inhibin antibodies or antigen-binding portions thereof, such as the nucleic acid sequence encoding the heavy chain variable region of the 4D8 monoclonal antibody as shown in SEQ ID NO.8, and the nucleic acid sequence encoding the light chain variable region of the 4D8 monoclonal antibody as shown in SEQ ID NO.10; and the nucleic acid sequence encoding the heavy chain variable region of the 1E5 monoclonal antibody as shown in SEQ ID NO.18, and the nucleic acid sequence encoding the light chain variable region of the 1E5 monoclonal antibody as shown in SEQ ID NO.20.

[0016] The present disclosure provides an expression vector comprising the isolated nucleic acid sequence and an expression control sequence operatively linked to the sequence.

[0017] The present disclosure provides an antibody expression system, which is constructed by transfecting the above construct into host cells.

[0018] The present disclosure provides a recombinant preparation method for the anti-inhibin antibody, comprising the following steps: culturing an expression system containing the antibody under conditions suitable for expressing the antibody, thereby expressing the antibody, and purifying and isolating the antibody.

[0019] The host cells used are all prior art and can be directly obtained through commercial channels. The culture medium used in the culture is also various conventional culture media. Those skilled in the art can select a suitable culture medium based on experience to optimize the culture conditions. After the host cells grow to a certain density, a suitable method can be selected to induce the start of monoclonal antibody expression, and the cells are continued to be cultured. In the above method, the recombinant monoclonal antibody can be expressed in the cell or on the cell membrane, and of course it may also be secreted outside the cell, after which the recombinant protein can be separated and purified by physical, chemical and other properties. Obviously, these technologies are well known to those skilled in the art in the art, and the above method includes but is not limited to: single technology such as protein renaturation, centrifugation, ultrafiltration, chromatography, HPLC or the combination of several technologies.

[0020] The target monoclonal antibody gene sequence obtained from the monoclonal hybridoma cell line can reproduce the activity of the monoclonal antibody after constructing an expression vector and CHO recombinant expression, thereby obtaining a recombinant anti-inhibin monoclonal antibody.

[0021] The present disclosure provides a use of the above-mentioned anti-inhibin antibody in the preparation of a drug for promoting animal reproduction, estrus synchronization, conception and birth, embryo transplantation, improving ovulation quality, promoting livestock reproduction, and inducing estrus in female livestock; the above-mentioned animals include mice, pigs, cattle, and sheep. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the specification and, together with the description, serve to explain the principles of the specification.

[0023] Figure 1 The results show the effect of recombinant monoclonal antibody 4D8 on improving the ovulation quality of ICR mice.

[0024] Figure 2 The figure shows the effect of recombinant monoclonal antibody 1E5 on improving the ovulation quality of ICR mice.

[0025] Figure 3 The results show the effect of ascites monoclonal antibody 4D8 on improving the ovulation quality of ICR mice.

[0026] Figure 4 The results show the effect of ascites mAb 1E5 on improving the ovulation quality of ICR mice.

[0027] Figure 5 The results show the effect of PMSG on improving the ovulation quality of ICR mice.

[0028] Figure 6 The results show the effect of goat polyclonal antibody on improving the ovulation quality of ICR mice. DETAILED DESCRIPTION

[0029] I. Definition

[0030] In this disclosure, unless otherwise indicated, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, terms and laboratory procedures related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology used herein are those widely used in the respective fields and are common procedures. To facilitate a better understanding of this disclosure, definitions and explanations of relevant terms are provided below.

[0031] Provided herein is an antibody (e.g., a monoclonal antibody) and an antigen-binding portion thereof that specifically binds to an inhibin. In a specific aspect, provided herein is an anti-inhibin monoclonal antibody that specifically binds to an inhibin, wherein the anti-inhibin antibody comprises a variant of a parent antibody. In a specific aspect, provided herein is an antibody that specifically binds to an inhibin (e.g., a mammalian inhibin). In a specific aspect, provided herein is an anti-inhibin antibody (e.g., a 5-13 amino acid substitution in the framework region of the heavy chain variable region) comprising a modification in one or more amino acid residues that maintains an affinity for the antigen compared to the parent antibody without the modification. The term "inhibin" refers to any inhibin molecule known to those skilled in the art. For example, the above-mentioned inhibin can be from a mammal, for example, an inhibin can be from a mouse, pig, cattle, or sheep.

[0032] As used herein and unless otherwise specified, the term "about" or "approximately" means within plus or minus 10% of a given value or range. Where an integer is required, the term means within plus or minus 10% of a given value or range, rounded up or down to the nearest integer.

[0033] With respect to antibody chain polypeptide sequences, the phrase "substantially identical" is understood to mean antibody chains that exhibit at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference polypeptide sequence. With respect to nucleic acid sequences, the phrase is understood to mean nucleic acid sequences that exhibit at least greater than 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference nucleic acid sequence.

[0034] Sequence "identity" or "identity" has an art-recognized meaning, and the percentage of sequence identity between two nucleic acid or polypeptide molecules or regions can be calculated using published techniques. Sequence identity can be measured along the full length of a polynucleic acid or polypeptide or along a region of the molecule. Although there are many methods for measuring the identity between two polynucleic acids or polypeptides, the term "identity" is well known to those skilled in the art (Carrillo, H. & Lipman, D., SIAM J Applied Math 48:1073 (1988)).

[0035] A "substitution" variant is one in which at least one amino acid residue in the native sequence has been removed and a different amino acid has been inserted in the same position. The substitution can be single, where only one amino acid is substituted in the molecule, or multiple, where two or more amino acids are substituted in the same molecule. Multiple substitutions can be at consecutive sites. Likewise, a single amino acid can be substituted by multiple residues, where such a variant includes both substitutions and insertions. An "insertion" variant is one in which one or more amino acids are inserted adjacent to an amino acid at a specific position in a native sequence. Adjacent to an amino acid means linked to the α-carboxyl or α-amino functional group of that amino acid. A "deletion" variant is one in which one or more amino acids in the native amino acid sequence have been removed. Typically, deletion variants have one or two amino acids deleted within a specific region of the molecule.

[0036] In the context of the variable domains of antibodies, the term "variable" refers to those parts of the related molecule that have extensive sequence differences between antibodies and are used for specific recognition and binding of a particular antibody to its specific target. However, the variability is not evenly distributed throughout the variable domain of an antibody. The variability is concentrated in three segments called complementarity determining regions (CDRs; i.e., CDR1, CDR2, and CDR3), or hypervariable regions, which are located in the variable domains of both the light and heavy chains. The more highly conserved portions of the variable domains are called framework (FR) regions or framework sequences. Each variable domain of a native heavy and light chain consists of four FR regions, which primarily adopt a β-sheet configuration and are connected by three CDRs, which form loops that connect and, in some cases, form part of the β-sheet structure. The CDRs of each chain are typically linked adjacently by FR regions and, with the help of the CDRs from the other chain, contribute to the formation of the antibody target binding site (epitope or determinant) (see Kabat et al., Sequences of Proteins of Immunological Interest, National Institute of Health, Bethesda, MD (1987)). As used herein, the numbering of immunoglobulin amino acid residues is based on the immunoglobulin amino acid residue numbering system of Kabat et al., unless otherwise indicated. A CDR may have the ability to specifically bind to a cognate epitope.

[0037] As used herein, an "antibody fragment" or "antigen-binding portion" of an antibody refers to any portion of a full-length antibody that is less than the full length but comprises at least a portion of the variable region (e.g., one or more CDRs and / or one or more antibody binding sites) of an antibody that binds to an antigen, and thus retains binding specificity and at least part of the specific binding ability of the full-length antibody. Thus, an antigen-binding portion refers to an antibody fragment that comprises an antigen-binding portion that binds to the same antigen as the antibody from which the antibody fragment was derived. Antibody fragments include antibody derivatives produced by enzymatic treatment of full-length antibodies, as well as synthetically produced derivatives, such as recombinantly produced derivatives. Antibodies include antibody fragments. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, single-chain Fv (scFv), Fv, dsFv, diabodies, Fd and Fd' fragments, and other fragments, including modified fragments (see, e.g., Methods in Molecular Biology, Vol 207: Recombinant Antibodies for Cancer Therapy Methods and Protocols (2003); Chapter 1; p 3-25, Kipriyanov). The fragment may include multiple chains linked together, for example, by disulfide bonds and / or by peptide linkers. Antibody fragments generally contain at least or about 50 amino acids, and typically at least or about 200 amino acids. An antigen-binding portion includes any antibody fragment that, when inserted into an antibody framework (e.g., by replacing corresponding regions), results in an antibody that immunospecifically binds (i.e., exhibits a Ka of at least or about 107-108 M-1) to an antigen. A "functional fragment" or "anti-inhibin antibody analog" is a fragment or analog that prevents or substantially reduces the ability of the receptor to bind to a ligand or initiate signal transduction. As used herein, a functional fragment is generally synonymous with an "antibody fragment" and, with respect to antibodies, may refer to a fragment that prevents or substantially reduces the ability of the receptor to bind to a ligand or initiate signal transduction, such as an Fv, Fab, F(ab')2, etc. "Fv" fragments consist of a dimer (VH-VL dimer) formed by non-covalent association of the variable domains of one heavy chain and one light chain. In this configuration, the three CDRs of each variable domain interact to define a target binding site on the surface of the VH-VL dimer, as in the case of an intact antibody. These six CDRs collectively confer target binding specificity to the intact antibody. However, even a single variable domain (or half of an Fv comprising only three target-specific CDRs) can still have the ability to recognize and bind to a target.

[0038] As used herein, the term "bispecific" (Bispecific antibody, BsAb) refers to an antibody and / or antigen-binding molecule that can specifically bind to two different antigenic determinants. Typically, a bispecific antibody and / or antigen-binding molecule comprises two antigen-binding sites, each of which is specific for a different antigenic determinant. In certain embodiments, a bispecific antibody and / or antigen-binding molecule can simultaneously bind to two antigenic determinants, particularly two antigenic determinants expressed on two different cells.

[0039] As used herein, "monoclonal antibody" refers to a population of identical antibodies, meaning that each individual antibody molecule in the monoclonal antibody population is identical to other antibody molecules. This characteristic is in contrast to the characteristic of a polyclonal population of antibodies, which comprises antibodies with a variety of different sequences. Monoclonal antibodies can be prepared by many well-known methods (Smith et al. (2004) J. Clin. Pathol. 57, 912-917; and Nelson et al., J Clin Pathol (2000), 53, 111-117). For example, monoclonal antibodies can be prepared by immortalizing B cells, for example, by fusing with myeloma cells to produce hybridoma cell lines or by infecting B cells with viruses such as EBV. Recombinant technology can also be used to prepare antibodies from a clonal population of host cells in vitro by transforming host cells with a plasmid carrying an artificial sequence of nucleic acid encoding the antibody.

[0040] As used herein, the term "hybridoma" or "hybridoma cell" refers to a cell or cell line (usually a myeloma or lymphoma cell) produced by the fusion of an antibody-producing lymphocyte and a non-antibody-producing cancer cell. As known to those of ordinary skill in the art, hybridomas can proliferate and continuously produce a specific monoclonal antibody. Methods for producing hybridomas are known in the art (see, for example, Harlow & Lane, 1988). When referring to the term "hybridoma" or "hybridoma cell," it also includes subclones and progeny cells of the hybridoma.

[0041] As used herein, a full-length antibody is an antibody having two full-length heavy chains (e.g., VH-CH1-CH2-CH3 or VH-CH1-CH2-CH3-CH4) and two full-length light chains (VL-CL) and a hinge region, such as antibodies naturally produced by antibody-secreting B cells and antibodies with the same domains produced synthetically.

[0042] "Humanized" antibodies refer to non-human (e.g., mouse) antibody forms that are chimeric immunoglobulins, immunoglobulin chains, or fragments thereof (e.g., Fv, Fab, Fab', F(ab')2, or other antigen-binding subsequences of antibodies) that contain minimal sequence derived from non-human immunoglobulin. Preferably, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a complementarity determining region (CDR) of the recipient antibody are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat, or rabbit having the desired specificity, affinity, and capacity.

[0043] In addition, in humanization, it is also possible to mutate the amino acid residues in the CDR1, CDR2 and / or CDR3 regions of VH and / or VL to improve one or more binding properties (e.g., affinity) of the antibody. For example, PCR-mediated mutations can be used to introduce mutations, and their effects on antibody binding or other functional properties can be evaluated using in vitro or in vivo tests as described herein. Typically, conservative mutations are introduced. Such mutations can be amino acid substitutions, additions, or deletions. In addition, the mutations in the CDRs are generally no more than one or two. Therefore, the humanized antibodies mentioned in the present disclosure also encompass antibodies comprising one or two amino acid mutations in the CDRs.

[0044] As used herein, the term "CDR" refers to a complementarity-determining region, and each heavy chain and light chain of a known antibody molecule has three CDRs. CDRs are also referred to as hypervariable regions and are present in the variable regions of each heavy and light chain of an antibody, with very high variability sites in the primary structure of the CDRs. In this specification, the CDRs of the heavy chain are represented by CDR1, CDR2, and CDR3 at the amino terminus of the amino terminal sequence of the heavy chain, and the CDRs of the light chain are represented by CDR1, CDR2, and CDR3 at the amino terminus of the amino terminal sequence of the light chain. These sites are adjacent to each other in the tertiary structure and determine the specificity of the antigen to which the antibody binds.

[0045] As used herein, the term "epitope" refers to any antigenic determinant on an antigen to which the paratope of an antibody binds. Epitopic determinants typically comprise chemically active surface patterns of molecules, such as amino acids or sugar side chains, and typically have specific three-dimensional structural characteristics as well as specific charge characteristics.

[0046] As used herein, "specifically binds" or "immunospecifically binds" with respect to an antibody or antigen-binding portion thereof are used interchangeably herein and refer to the ability of an antibody or antigen-binding portion to form one or more non-covalent bonds with a cognate antigen through non-covalent interactions between the antibody combining sites of the antibody and the antigen. The antigen may be an isolated antigen or present on a tumor cell. Typically, an antibody that immunospecifically binds (or specifically binds) to an antigen is present at a level of about 1×107 M -1 or 1x10 8 M -1 or greater affinity constant Ka (or 1x10 -7 M or 1×10 -8 The affinity constant can be determined by standard kinetic methods of antibody reactions, such as immunoassays, surface plasmon resonance (SPR) (Rich and Myszka (2000) Curr. Opin. Biotechnol 11: 54; Englebienne (1998) Analyst. 123: 1599), isothermal titration calorimetry (ITC), or other kinetic interaction assays known in the art (see, e.g., Paul, ed., Fundamental Immunology, 2nd ed., Raven Press, New York, pages 332-336 (1989); see also U.S. Pat. No. 7,229,619 for exemplary SPR and ITC methods for calculating the binding affinity of antibodies). Instruments and methods for real-time detection and monitoring of binding rates are known and commercially available (see, BiaCore 2000, Biacore AB, Upsala, Sweden and GE Healthcare Life Sciences; Malmqvist (2000) Biochem. Soc. Trans. 27:335).

[0047] As used herein, the terms "polynucleic acid" and "nucleic acid molecule" refer to an oligomer or polymer comprising at least two linked nucleic acids or nucleic acid derivatives, including deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), typically linked together by phosphodiester bonds. As used herein, the term "nucleic acid molecule" is intended to include DNA molecules and RNA molecules. Nucleic acid molecules can be single-stranded or double-stranded and can be cDNA.

[0048] As used herein, isolated nucleic acid molecules are nucleic acid molecules isolated from other nucleic acid molecules present in the natural origin of nucleic acid molecules. "Isolated" nucleic acid molecules such as cDNA molecules can be prepared by recombinant technology without substantially containing other cellular materials or culture medium, or can be synthesized without substantially containing chemical precursors or other chemical compositions. The exemplary isolated nucleic acid molecules provided herein comprise the isolated nucleic acid molecules of the antibody or antigen-binding portion thereof provided by coding.

[0049] As used herein, "operably linked" with respect to nucleic acid sequences, regions, elements, or domains means that the nucleic acid regions are functionally related to each other. For example, a promoter can be operably linked to a nucleic acid encoding a polypeptide such that the promoter regulates or mediates transcription of the nucleic acid.

[0050] As used herein, "expression" refers to the process of producing a polypeptide by transcription and translation of a polynucleic acid. The expression level of a polypeptide can be assessed using any method known in the art, including, for example, methods for measuring the amount of polypeptide produced by a host cell. Such methods may include, but are not limited to, quantification of polypeptides in cell lysates by ELISA, gel electrophoresis followed by Coomassie blue staining, Lowry protein assay, and Bradford protein assay.

[0051] As used herein, a "host cell" is a cell that is used to receive, maintain, replicate, and amplify a vector. Host cells can also be used to express polypeptides encoded by the vector. When the host cell divides, the nucleic acid contained in the vector is replicated, thereby amplifying the nucleic acid. The host cell can be a prokaryotic cell, such as Escherichia coli; or a lower eukaryotic cell, such as a yeast cell - Pichia pastoris / Saccharomyces cerevisiae or a filamentous fungus; or a higher eukaryotic cell, such as a mammalian cell CHO / 293T, various COS cells, HeLa cells, HEK cells such as HEK 293 cells, mouse myeloma (NS0) cells, baby hamster kidney (BHK) cells, etc.

[0052] As used herein, a "vector" is a replicable nucleic acid that, when transformed into an appropriate host cell, can express one or more heterologous proteins from the vector. Vectors include those into which nucleic acids encoding polypeptides or fragments thereof can be introduced, typically by restriction digestion and ligation. Vectors also include those that contain nucleic acids encoding polypeptides. Vectors are used to introduce nucleic acids encoding polypeptides into host cells for the purpose of amplifying nucleic acids or for expressing / displaying polypeptides encoded by nucleic acids. Vectors are typically kept episomal, but can be designed to integrate genes or portions thereof into chromosomes of the genome. Artificial chromosome vectors, such as yeast artificial vectors and mammalian artificial chromosomes, are also contemplated. The selection and use of such vectors are well known to those skilled in the art.

[0053] As used herein, vectors also include “viral vectors” or “viral vectors.” Viral vectors are engineered viruses that are operably linked to exogenous genes to transfer (as vehicles or shuttles) the exogenous genes into cells.

[0054] As used herein, "expression vector" includes vectors capable of expressing DNA, which is operably linked to regulatory sequences that can affect the expression of such DNA fragments, such as promoter regions. Such additional fragments may include promoter and terminator sequences, and may optionally include one or more replication origins, one or more selection markers, enhancers, polyadenylation signals, etc. Expression vectors are generally derived from plasmids or viral DNA, or may contain elements of both. Therefore, an expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, phage, recombinant virus or other vector, which, when introduced into an appropriate host cell, results in the expression of the cloned DNA. Suitable expression vectors are well known to those skilled in the art and include expression vectors that are replicable in eukaryotic and / or prokaryotic cells, as well as expression vectors that remain free or that are integrated into the host cell genome. Expression vectors used herein refer to bacterial plasmids, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known to those skilled in the art.

[0055] As used herein, "treating" an individual suffering from a disease or condition means that the individual's symptoms are partially or completely alleviated, or remain unchanged after treatment. Thus, treatment includes prevention, treatment, and / or cure. Prevention refers to preventing the underlying disease and / or preventing the worsening of symptoms or the development of the disease. Treatment also includes any pharmaceutical use of any of the antibodies or antigen-binding portions thereof provided, as well as compositions provided herein.

[0056] II. Detailed description of specific implementation plan

[0057] In one aspect, the present disclosure provides an anti-inhibin antibody or antigen-binding portion thereof, comprising a heavy chain CDR selected from the amino acid sequence of SEQ ID NO. 1, 2, 3, 11, 12, 13 or any variant thereof, and a light chain CDR selected from the amino acid sequence of SEQ ID NO. 4, 5, 6, 14, 15, 16 or any variant thereof.

[0058] According to the previous aspect, the antibody or its antigen-binding portion comprises a heavy chain CDR1 selected from the amino acid sequence SEQ ID NO.1, 11 or any variant thereof, a heavy chain CDR2 selected from the amino acid sequence SEQ ID NO.2, 12 or any variant thereof, and a heavy chain CDR3 selected from the amino acid sequence SEQ ID NO.3, 13 or any variant thereof; and a light chain CDR1 selected from the amino acid sequence SEQ ID NO.4, 14 or any variant thereof, a light chain CDR2 selected from the amino acid sequence SEQ ID NO.5, 15 or any variant thereof, and a light chain CDR3 selected from the amino acid sequence SEQ ID NO.6, 16 or any variant thereof.

[0059] The antibody or antigen binding portion thereof according to the previous aspect comprises a combination of heavy and light chain CDRs selected from the group consisting of:

[0060] (1) heavy chain CDR1, CDR2 and CDR3 comprising the heavy chain CDR1, CDR2 and CDR3 sequences of SEQ ID NOs. 1, 2 and 3, respectively, or any variants thereof, and light chain CDR1, CDR2 and CDR3 comprising the light chain CDR1, CDR2 and CDR3 sequences of SEQ ID NOs. 4, 5 and 6, respectively, or any variants thereof;

[0061] (2) heavy chain CDR1, CDR2 and CDR3 comprising the heavy chain CDR1, CDR2 and CDR3 sequences of SEQ ID NOs. 11, 12 and 13, respectively, or any variants thereof, and light chain CDR1, CDR2 and CDR3 comprising the light chain CDR1, CDR2 and CDR3 sequences of SEQ ID NOs. 14, 15 and 16, respectively, or any variants thereof.

[0062] In some embodiments, the above-mentioned antibody or its antigen-binding portion comprises a heavy chain variable region selected from the amino acid sequence SEQ ID NO. 7, 17 or any variant thereof, and a light chain variable region selected from the amino acid sequence SEQ ID NO. 9, 19 or any variant thereof.

[0063] In some embodiments, the above-mentioned antibody or antigen-binding portion thereof comprises a heavy chain variable region having an amino acid sequence of SEQ ID NO. 7 or any variant thereof, and a light chain variable region having an amino acid sequence of SEQ ID NO. 9 or any variant thereof.

[0064] In some embodiments, the above-mentioned antibody or its antigen-binding portion comprises a heavy chain variable region with the amino acid sequence of SEQ INNO.17 or any variant thereof, and a light chain variable region with the amino acid sequence of SEQ ID NO.19 or any variant thereof.

[0065] In one aspect, the disclosure provides a bispecific or multispecific molecule comprising the antibody or antigen-binding portion thereof of any of the preceding aspects.

[0066] In one aspect, the disclosure provides a nucleic acid molecule encoding an antibody, or antigen-binding portion thereof, or a bispecific or multispecific molecule according to any of the preceding aspects.

[0067] In some embodiments, the nucleic acid comprises an antibody heavy chain variable region nucleic acid sequence selected from SEQ ID NO. 8, 18 or any variant thereof, and an antibody light chain variable region nucleic acid sequence selected from SEQ ID NO. 10, 20 or any variant thereof.

[0068] In some embodiments, the nucleic acid comprises a heavy chain variable region nucleic acid sequence of SEQ ID NO. 8 or any variant thereof, and a light chain variable region nucleic acid sequence of SEQ ID NO. 10 or any variant thereof.

[0069] In some embodiments, the nucleic acid comprises a heavy chain variable region nucleic acid sequence of SEQ ID NO. 18 or any variant thereof, and an antibody light chain variable region nucleic acid sequence of SEQ ID NO. 20 or any variant thereof.

[0070] In one aspect, the present disclosure provides an anti-inhibin antibody, or antigen binding portion thereof, having at least greater than 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the antibody, or antigen binding portion thereof, of any of the preceding aspects.

[0071] In one aspect, the present disclosure provides a nucleic acid molecule encoding an antibody or antigen-binding portion thereof according to any of the preceding aspects, or a nucleic acid molecule having at least greater than 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity thereto.

[0072] In one aspect, the present disclosure provides a vector comprising a nucleic acid according to any of the preceding aspects.

[0073] In one aspect, the present disclosure provides a cell comprising a vector according to any of the preceding aspects.

[0074] In one aspect, the present disclosure provides an expression system constructed by introducing an expression vector comprising the aforementioned nucleic acid into a host cell.

[0075] In some embodiments, the expression vector comprises any one selected from a bacterial plasmid, a yeast plasmid, a plant cell virus, and a mammalian cell virus (such as an adenovirus or a retrovirus).

[0076] In some embodiments, the expression vector is pcDNA3.1(+).

[0077] In some embodiments, the host cell is a prokaryotic host cell or a eukaryotic host cell.

[0078] In some embodiments, the prokaryotic host cell is a bacterial cell.

[0079] In some embodiments, the bacterial cell is Escherichia coli.

[0080] In some embodiments, the eukaryotic host cell is selected from any one of a fungus, a plant, an insect, and a mammal.

[0081] In some embodiments, the fungal eukaryotic host cell is selected from any one of yeast (such as Pichia pastoris and Saccharomyces cerevisiae) and filamentous fungi.

[0082] In some embodiments, the mammalian eukaryotic host cell is selected from any one of Chinese hamster ovary (CHO) cells, murine myeloma (NSO) cells, baby hamster kidney (BHK) cells, and human embryonic kidney (HEK) cells (such as HEK293 cells).

[0083] In some embodiments, the host cell is a Chinese Hamster Ovary (CHO) cell.

[0084] According to the expression system of the previous aspect, the method for introducing the expression vector into the host cell is selected from transfection, transformation or infection.

[0085] In some embodiments, the expression vector is introduced into the host cell by transfection.

[0086] In some embodiments, the transfection method includes electroporation transfection, calcium phosphate transfection, liposome transfection, protoplast fusion transfection, microinjection, electroporation, gene gun, cationic polymer and viral vector infection.

[0087] In one aspect, the present disclosure provides a composition comprising the antibody or antigen-binding portion thereof, bispecific or multispecific molecule, nucleic acid, vector and cell of any of the preceding aspects.

[0088] In one aspect, the present disclosure provides the use of the antibodies or antigen-binding portions thereof, bispecific or multispecific molecules, nucleic acids, vectors, cells and compositions of any of the aforementioned aspects in the preparation of medicaments for promoting animal reproduction, estrus synchronization, conception and farrowing, embryo transfer, improving ovulation quality, promoting livestock reproduction, and inducing estrus in female animals.

[0089] In some embodiments, the animals include mice, pigs, cattle, and sheep.

[0090] In one aspect, the present disclosure provides a method for promoting animal reproduction, estrus synchronization, conception and farrowing, embryo transfer, improving ovulation quality, promoting livestock reproduction or inducing estrus in female livestock, which comprises administering the aforementioned antibody or antigen-binding portion thereof to the animal.

[0091] In some embodiments, the dosage is 0.1 to 1000 μg / kg.

[0092] In some embodiments, administration is by intraperitoneal, intramuscular, or subcutaneous injection.

[0093] In some embodiments, the antibody or antigen-binding portion thereof and the bispecific or multispecific molecule are administered at a dose of 0.1 to 1000 μg / kg via intraperitoneal, intramuscular, or subcutaneous injection.

[0094] The antibodies herein and their derivatives, fragments, analogs and homologs can be incorporated into pharmaceutical compositions suitable for administration. The principles and considerations involved in preparing such compositions and guidance for selecting components are well known in the art.

[0095] Such compositions typically comprise an antibody and a pharmaceutically acceptable carrier. When an antibody fragment is used, a minimal inhibitory fragment that specifically binds to the target protein binding domain may be preferred. For example, based on the variable region sequence of the antibody, a peptide molecule that retains the ability to bind to the target protein sequence can be designed. Such peptides can be chemically synthesized and / or produced by recombinant DNA technology (see, for example, Marasco et al., Proc. Natl. Acad. Sci. USA, 90:7889-7893 (1993)).

[0096] As used herein, the term "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are compatible with drug administration. Suitable pharmaceutically acceptable carriers are described in the latest edition of Remington's Pharmaceutical Sciences, a standard reference work in this field, which is incorporated herein by reference. Preferred examples of such carriers or diluents include, but are not limited to, water, saline, Ringer's solution, dextrose solution, and 5% human serum albumin. Liposomes and non-aqueous carriers, such as immobilized oils, may also be used. The use of such media and agents for pharmaceutically active substances is well known in the art. Except where any conventional media or agents are incompatible with the antibody, their use in the composition is contemplated.

[0097] The pharmaceutical compositions of the above embodiments are formulated to be compatible with their intended route of administration. Examples of routes of administration include parenteral, such as intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (i.e., topical), transmucosal, and rectal administration. Solutions or suspensions for parenteral, intradermal, or subcutaneous administration may include the following components: sterile diluents for injection such as water, saline solutions, fixed oils, polyethylene glycols, glycerol, propylene glycol, or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetates, citrates, or phosphates, and agents for regulating osmotic pressure such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. Parenteral formulations can be packaged in ampoules, disposable syringes, or multiple-dose vials made of glass or plastic.

[0098] Pharmaceutical compositions suitable for injection include sterile aqueous solutions (water-soluble in this case) or dispersions and sterile powders for the immediate preparation of sterile injections or dispersions. For intravenous administration, suitable pharmaceutically acceptable carriers include physiological saline, antibacterial water, Cremophor EL™ (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid enough to be easily injectable. It must be stable under manufacturing and storage conditions and must be able to prevent the contamination of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, a polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol, etc.), and a suitable mixture thereof. For example, by utilizing a coating such as lecithin, maintaining the desired particle size in the case of a dispersion, and utilizing a surfactant, suitable fluidity can be maintained. Prevention of microbial action can be achieved by various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols (such as mannitol, sorbitol), sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0099] As needed, sterile injectable solutions can be prepared by incorporating the antibody in the desired amount into a suitable solvent having one or a combination (as needed) of the ingredients listed above, followed by filtration sterilization. Generally, dispersions are prepared by incorporating the antibody into a sterile carrier containing an alkaline dispersion medium and the other ingredients required by those listed above. With regard to sterile powders for the preparation of sterile injectable solutions, the preparation method is vacuum drying and freeze drying to obtain a powder comprising the active ingredient and any additional desired ingredients from a sterile filtered solution of the aforementioned ingredients.

[0100] For administration by inhalation, the compounds are delivered in the form of an aerosol spray from a pressured container or dispenser which contains a suitable propellant, such as a gas such as carbon dioxide, or a nebulizer.

[0101] Administration can also be systemically administered through mucosal or transdermal means. For transmucosal or transdermal administration, penetrants suitable for the permeability barrier are used in the formulation. Such penetrants are generally known in the art and include detergents, bile salts, and fusidic acid derivatives for transmucosal administration. Transmucosal administration can be achieved by using nasal sprays or suppositories. For transdermal administration, one or more antibodies can be formulated into ointments, ointments, gels, or creams as are generally known in the art.

[0102] The compounds may also be prepared for rectal delivery in the form of suppositories (eg, with conventional suppository bases such as cocoa butter or other glycerides) or retention enemas.

[0103] In one embodiment, the antibodies can be prepared with carriers that prevent them from being rapidly eliminated by the body, such as slow-release / controlled-release formulations, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations will be apparent to those skilled in the art.

[0104] It is particularly advantageous to formulate parenteral compositions in dosage unit form for ease of administration and consistency of dosage. As used herein, dosage unit form refers to physically separable units suitable as unit dosages for the subject to be treated; each unit contains a predetermined quantity of one or more antibodies calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specifications of the dosage unit forms of the above-described embodiments are dictated by and directly dependent on the unique characteristics of the antibody and the specific therapeutic effect to be achieved, and the limitations inherent in the art of formulating such antibodies for use in treating individuals.

[0105] The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.

[0106] The formulations described herein may also include more than one antibody, depending on the specific condition to be treated, preferably those with complementary activities that do not negatively affect each other. Alternatively or in addition, the composition may include, for example, an agent that enhances its function, such as a cytotoxic agent, a cytokine, a chemotherapeutic agent, or a growth inhibitory agent. Such molecules are suitably present in combination in an amount effective for the intended purpose. For example, they may be present in combination in the kit or during use.

[0107] In one embodiment, one or more antibodies can be administered in a combined therapy, i.e., in combination with other agents, such as therapeutic agents (which can be used to treat pathological conditions or disorders, such as various forms of cancer, autoimmune disorders, and inflammatory diseases). The term "combined" herein refers to administering the agents substantially synchronously, simultaneously, or sequentially. If administered sequentially, the first of the two compounds is still preferably detected at an effective concentration at the treatment site when the second compound is administered. In one case, "combined" can also be the simultaneous inclusion of an antibody of the present disclosure and other therapeutic agents in a kit.

[0108] For example, combination therapies can comprise one or more antibodies described herein co-formulated and / or co-administered with one or more additional therapeutic agents (e.g., one or more cytokine and growth factor inhibitors, immunosuppressants, anti-inflammatory agents, metabolic inhibitors, enzyme inhibitors, and / or cytotoxins or cytostatic agents, as described in more detail below.) Such combination therapies can advantageously utilize lower dosages of the administered therapeutic agents, thereby avoiding possible toxicities or complications associated with various monotherapies.

[0109] For purposes of clarity and conciseness, features are described herein as part of the same or separate embodiments; however, it will be understood that the scope of the present disclosure may include embodiments having a combination of all or some of the described features.

[0110] Example

[0111] Example 1: Preparation of anti-inhibin monoclonal antibody hybridoma cells

[0112] 1. Preparation of Immunogen

[0113] A Uniprot database search revealed 100% homology between the 6-25 fragment of the inhibin α subunit from mouse, rat, pig, cattle, and sheep. Therefore, this fragment was selected as an antigenic peptide to screen for anti-inhibin monoclonal antibodies that are active against mouse, rat, pig, cattle, and sheep. The antigenic peptide fragment was conjugated to bovine serum albumin (BSA) and used as an immunogen, enhancing its immunogenicity.

[0114] 2. Immunization of Animals

[0115] Three 6-8 week old female BALB / c mice were selected. All of the above mice were SPF grade and purchased from Zhejiang Weitonglihua Experimental Animal Technology Co., Ltd. The immune reagent was Freund's adjuvant, purchased from Shanghai Biyuntian Biotechnology Co., Ltd. The immunization scheme is shown in Table 1:

[0116] Table 1. Immune pathways and cycles

[0117]

[0118] 3. Preparation of Hybridoma Cells

[0119] 3.1 Preparation before fusion

[0120] (1) Macrophage extraction:

[0121] After immunization, the mice were killed by pulling the neck, soaked in alcohol for 5-10 minutes, and then removed and placed in an inverted position on the dissecting table. The limbs were fixed, and the abdomen was scrubbed again with 75% alcohol. Under sterile conditions, the abdominal skin was cut open to expose the peritoneum, and then wiped and disinfected with 75% alcohol.

[0122] Use a 10ml syringe to draw up 5ml of sterile DMEM medium, lift the peritoneum with forceps and inject it into the mouse's abdominal cavity. At the same time, use your fingers to press the abdomen from both sides or lift the thighs to allow the medium to flow fully in the abdominal cavity. After 5 minutes, wait for the liquid to turn yellow, lift the peritoneum with forceps again, and draw out the liquid with a syringe to obtain the medium containing macrophages. Centrifuge at 1000rpm for 5 minutes, wash once with PBS, and resuspend in 10ml of HAT medium. Count and set aside.

[0123] (2) Culture and collection of myeloma cells sp2 / 0

[0124] The cells (growing well and in the logarithmic phase) cultured in a T75 culture flask were gently tapped and washed once with PBS. The cells were then suspended in 10 ml of PBS and counted for later use.

[0125] (3) Preparation of spleen cells

[0126] After macrophages were extracted from mice, the peritoneum was cut open using sterile techniques, the spleen was removed, and placed in incomplete culture medium. A large number of cells were obtained by crushing them by pressing. After centrifugation at 1000 rpm for 5 minutes, they were washed 2-3 times with PBS and finally suspended in 10 ml of PBS. An appropriate amount was taken for counting and set aside.

[0127] 3.2 Cell fusion

[0128] Take the previously prepared myeloma cells and spleen cells, mix them at a ratio of 1:10, wash them once with incomplete culture medium in a 50 ml centrifuge tube, centrifuge at 1000 rpm for 8 minutes, discard the supernatant and aspirate the remaining liquid, and gently tap the bottom of the centrifuge tube to loosen the cell pellet;

[0129] Use a pipette to add 1 ml of 50% PEG (pH 8.0) preheated to 40°C within 60 seconds while stirring gently.

[0130] Use a 10ml pipette to add 20ml of preheated incomplete medium within 90s and let it stand at room temperature for 10min;

[0131] Centrifuge at 1000 rpm for 6 min and discard the supernatant;

[0132] Add 5 ml of HAT medium, gently pipette the cell pellet to suspend and mix, then add macrophages and add more HAT medium to 60 ml;

[0133] Aliquot 200 μl into each well of a 96-well cell culture plate and culture in a 37°C, 5% CO2 incubator;

[0134] After 7 days of culture, the HAT medium was replaced with the HT medium.

[0135] 3.3 Monoclonalization of Hybridoma Cells

[0136] The inhibin α subunit 6-25 fragment conjugated to chicken ovalbumin (OVA) was diluted to a concentration of 10 μg / ml in a sodium bicarbonate solution at pH 9.6. 100 μl was added to each well of an ELISA plate (96-well plate) and incubated at 2-8°C overnight. The next day, the plate was washed and patted dry, and then blocked with 5% BSA (200 μl per well) and incubated at 37°C for 1 hour.

[0137] After washing and patting the plate dry, aseptically take 100 μl of the culture supernatant after fusion and add it to the ELISA plate and incubate at 37°C for 1 hour;

[0138] After washing, the secondary antibody (goat anti-mouse, HRP-labeled) was added, 100 μl per well, and incubated at 37°C for 1 h;

[0139] After washing the plate, add 100 μl of color developing solution to each well, incubate at 37°C for 5-10 min, add 50 μl of stop solution, and read the absorbance at a wavelength of 460 nm.

[0140] Wells with absorbance values ​​greater than 0.5 were selected, and the cells were aspirated and transferred to a 24-well plate (a total of 38 positive wells were obtained, the positive rate was low, and the data from one round were too many and not shown), and continued to be cultured in a 37°C, 5% CO2 incubator;

[0141] After 5-7 days, the supernatant of cells cultured in the 24-well plate was tested in the same manner, and the positive results were rescreened (the values ​​are not shown here). The cells in the 15 positive wells with the highest absorbance values ​​were selected and transferred to a six-well plate and continued to be cultured in a 37°C, 5% CO2 incubator; the remaining positive clones were directly preserved and stored in liquid nitrogen.

[0142] After two rounds of subclone screening, six subclones were obtained from the cells in the six-well plate. Among them, the cell culture supernatants of 4D826 and 1E57 had the highest titers. The titer test results are shown in Table 2.

[0143] Table 2 Titer detection of cell culture supernatants of hybridoma cell lines 4D826 and 1E57

[0144]

[0145]

[0146] 4. Subtype Analysis of Anti-Inhibin Monoclonal Antibodies

[0147] The monoclonal antibody subtype identification kit of Fuinde Technology (Wuhan) Co., Ltd. was used to identify the antibody subtypes secreted by the two hybridoma cell lines 4D826 and 1E57 according to the instructions. The results showed that the immunoglobulin heavy chain subtypes secreted by the two cell lines were both IgG1, and the light chain subtypes were both Kappa.

[0148] 5. Preparation of Ascites

[0149] One week in advance, 0.5 ml of paraffin oil (purchased from Sigma) was injected into the mouse peritoneal cavity. One week after sensitization, the actively growing hybridoma cells 4D826 and 1E57 were centrifuged and the culture medium was discarded. The cells were resuspended in PBS or incomplete culture medium and the cell concentration was adjusted to 2 × 10 7 10 cells / ml, and 0.1 ml of the cell suspension was injected into the mouse peritoneal cavity. After 7-10 days, the abdominal cavity of the mouse was significantly enlarged, and ascites fluid was collected. The mouse can be sacrificed and the ascites fluid was aspirated. Cell debris and lipids were removed by centrifugation at 8000 rpm for 20 minutes at 4°C. An equal volume of glycerol was then added and stored at -20°C. Indirect ELISA testing revealed a monoclonal antibody titer of 1:4,000,000 in the ascites fluid.

[0150] Example 2: Cloning of variable region coding sequences of anti-inhibin monoclonal antibodies and vector construction

[0151] 1. Gene sequencing and sequence synthesis

[0152] (1) Determination of the heavy and light chain variable regions of the monoclonal cell lines 4D826 and 1E57

[0153] The two monoclonal cell lines 4D826 and 1E57 whose titers of the above cell culture supernatants reached 1:25600 were sent for sequencing.

[0154] The amino acid sequence of the heavy chain variable region of the 4D8 monoclonal antibody is shown in SEQ ID NO. 7, the nucleic acid sequence thereof is shown in SEQ ID NO. 8, and the CDR1, CDR2 and CDR3 thereof are shown in SEQ ID NOs. 1, 2 and 3, respectively.

[0155] <-------------------FR1------------------->CDR1<----------FR2---------->CDR2<----------

[0156] QVQLKQSGPSLVQPSQSLSITCTVS GFSLTTCGVN WVRQSPGKGLEWLG VIWRGGSTDYNAAFMS RMSITK

[0157] -------FR3----------------------------->CDR3<------FR4------->

[0158] DNSKSQVFFKMNSLPADDTAKYYFAK RKILLNGTVP TGQGTTLTVSS

[0159] Nucleic acid sequence

[0160] CAGGTGCAGCTGAAGCAGTCCGGACCCTCCCTGGTGCAGCCCTCCCAGTCCCTGTCCATCACCTGCACCG

[0161] TGTCCGGATTCTCCCTGACCACCTGCGGAGTGAACTGGGTGAGACAGTCCCCGGAAAGGGACTGGAGT

[0162] GGCTGGGAGTGATCTGGAGAGGAGGATCCACCGACTACAACGCCGCCTTCATGTCCAGAATGTCCATCAC

[0163] CAAGGACAACTCCAAGTCCCAGGTGTTCTTCAAGATGAACTCCCTGCCCGCCGACGACACCGCCAAGTAC

[0164] TACTTCGCCAAGAGAAAGATCCTGCTGAACGGAACCGTGCCCACCGGACAGGGAACCACCCTGACCGTG

[0165] TCCTCC

[0166] The amino acid sequence of the light chain variable region of the 4D8 monoclonal antibody is shown in SEQ ID NO.9, its nucleic acid sequence is shown in SEQ ID NO.10, and its CDR1, CDR2 and CDR3 are shown in SEQ ID NOs.4, 5 and 6, respectively.

[0167] <------------------FR1------------------>CDR1<-----------FR2----------->CDR2<--------------------------FR3--

[0168] DIQMTQTTSSLSASLGDRVTISC RASQDISNYLNWYQQKPDGTVKLLIY YTSRFHS GVPSRFSGSGSGTDYSLT

[0169] -------------------------->CDR3<-----FR4----->

[0170] ISNLEQEDIATYFC QQGYSLPPT FGGGTKLEIK

[0171] Nucleic acid sequence

[0172] GACATCCAGATGACCCAGACCACCTCCTCCCTGTCCGCCTCCCTGGGAGACAGAGTGACCATCTCCTGCA

[0173] GAGCCTCCCAGGACATCTCCAACTACCTGAACTGGTACCAGCAGAAGCCCGACGGAACCGTGAAGCTGC

[0174] TGATCTACTACACCTCCAGATTCCACTCCGGAGTGCCCTCCAGATTCTCCGGATCCGGATCCGGAACCGAC

[0175] TACTCCCTGACCATCTCCAACCTGGAGCAGGAGGACATCGCCACCTACTTCTGCCAGCAGGGATACTCCCT

[0176] GCCCCCCACCTTCGGAGGAGGAACCAAGCTGGAGATCAAG

[0177] The amino acid sequence of the heavy chain variable region of the 1E5 monoclonal antibody is shown in SEQ ID NO. 17, the nucleic acid sequence thereof is shown in SEQ ID NO. 18, and the CDR1, CDR2, and CDR3 thereof are shown in SEQ ID NOs. 11, 12, and 13, respectively.

[0178] <--------------------FR1------------------->CDR1<------------FR2----------->CDR2<-----

[0179] EVKLVESGPELKKPGETVKISCKAS GYTFTDYSMH WVKQAPGKGLKWMG WINTETGEPTYADDFKG RFAF

[0180] --------FR3-------------------------->CDR3<-------FR4------->

[0181] SLETSASTAYLQINNLKNEDTATYFCAY YGPPTYSLDY WGQGASVTVSS

[0182] Nucleic acid sequence

[0183] GAGGTGAAGCTGGTGGAGTCCGGACCCGAGCTGAAGAAGCCCGGAGAGACCGTGAAGATCTCCTGCAAG

[0184] GCCTCCGGATACACCTTCACCGACTACTCCATGCACTGGGTGAAGCAGGCCCCCGGAAAGGGACTGAAGT

[0185] GGATGGGATGGATCAACACCGAGACCGGAGAGCCCACCTACGCCGACGACTTCAAGGGAAGATTCGCCTT

[0186] CTCCCTGGAGACCTCCGCCTCCACCGCCTACCTGCAGATCAACAACCTGAAGAACGAGGACACCGCCACCTACTTCTGCGCCTACTACGGACCCCCCACCTACTCCCTGGACTACTGGGGACAGGGAGCCTCCGTGACCGTGTCCTCC

[0187] The amino acid sequence of the light chain variable region of the 1E5 monoclonal antibody is shown in SEQ ID NO. 19, the nucleic acid sequence thereof is shown in SEQ ID NO. 20, and the CDR1, CDR2, and CDR3 thereof are shown in SEQ ID NOs. 14, 15, and 16, respectively.

[0188] <------------------FR1------------------>CDR1<-----------FR2----------->CDR2<--------------------------FR3--DIQMTQTTSSLSASLGDRVTISC RAS QGISNYLN WYQQKPDGTVKLLIY YTSRLLSGVPSRFSGSGSGTDYSLT----------------------------->CDR3<-----FR4----->

[0189] ISNLEQEDIATYFC QQGYTLPFT FGSGTKLEIK

[0190] Nucleic acid sequence

[0191] GACATCCAGATGACCCAGACCACCTCCTCCCTGTCCGCCTCCCTGGGAGACAGAGTGACCATCTCCTGCAGAGCCTCCCAGGGAATCTCCAACTACCTGAACTGGTACCAGCAGAAGCCCGACGGAACCGTGAAGCTGCTGATCTACTACACCTCCAGAC TGCTGTCCGGAGTGCCCTCCAGATTCTCCGGATCCGGATCCGGAACCGACTACTCCCTGACCATCTCCAACCTGGAGCAGGAGGACATCGCCACCTACTTCTGCCAGCAGGGATACACCCTGCCCTTCACCTTCGGATCCGGAACCAAGCTGGAGATCAAG

[0192] (2) Determination of recombinant antibody signal peptide and constant sequence

[0193] The amino acid sequences of the signal peptides of the heavy chain and light chain are SEQ ID NO.21; the amino acid sequences of the constant regions of the heavy chain and light chain are SEQ ID NO.22 and SEQ ID NO.23, respectively.

[0194] The above sequences were combined according to certain requirements to form the full-length sequences of the recombinant antibody heavy chain and antibody light chain of monoclonal antibodies 4D8 and 1E5.

[0195] 2. Construction of recombinant expression vector

[0196] The vector pcDNA3.1(+) was subjected to double enzyme digestion reaction with the target genes of 4D8 and 1E5 using restriction enzymes Nhe I and Xho I, respectively. The system is as shown in Table 3:

[0197] Table 3 Enzyme digestion system

[0198] Element volume pcDNA3.1 / target gene 10 μl Nhe I 1.5 μl Xho I 1.5 μl 10X Buffer 5μl <![CDATA[ddH2O]]> Make up to 50 μl

[0199] The prepared reaction solution was placed in a 1.5 ml centrifuge tube, sealed, and placed in a 37°C water bath for 6 h. The enzyme-digested product was subjected to agarose gel electrophoresis.

[0200] The Tiangen Agarose Gel DNA Recovery Kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd., catalog number DP209) was used to recover the target DNA band in the agarose gel after electrophoresis according to the instructions.

[0201] Use T4 DNA ligase to ligate the target fragments of the heavy chain and light chain to the digested pcDNA3.1(+) vector. The reaction system is described in the instructions.

[0202] The ligation product was transformed according to the instructions of Tiangen DH5a competent cells, positive clones were screened and expanded, and plasmids were extracted using a plasmid extraction kit according to the instructions.

[0203] 3. Transient transfection of CHO cells to express recombinant anti-inhibin monoclonal antibodies

[0204] (1) CHO-s cell culture: Under conventional culture conditions in a 125 ml shake flask, when the cell density reaches 1×10 7 When 2×10 5 The initial density of cells / ml was inoculated into a new 125ml shake flask and cultured at 37℃ and 5% CO2. After 2 days, when the density reached 5×10 5 When the concentration of lipofectamine 2000 was 100 μg / ml, transient transfection was started according to the operating instructions of the transfection reagent lipo2000.

[0205] (2) After 7 days, the cell supernatant was collected, centrifuged at 5000 rpm for 30 min to remove cells and debris, filtered through 0.45 μm, and stored at 4°C for subsequent antibody purification.

[0206] Example 3: Preparation of goat polyclonal antibodies

[0207] 1. Preparation of Inhibin Antigen

[0208] The porcine inhibin α subunit 6-25 fragment (amino acid sequence shown as SEQ ID NO. 24 in the sequence listing) was synthesized using conventional techniques and coupled to BSA via the N-terminus.

[0209] 2. Immunity:

[0210] For the first immunization, 2 mg of the conjugated antigen was emulsified with Freund's complete adjuvant in a 1:1 ratio and immunized subcutaneously in the neck of a castrated male goat. For the second immunization, Freund's incomplete adjuvant was used. One week after the fifth immunization, a small serum sample was collected for ELISA titer testing. When the titer reached the required level, a booster immunization was performed and whole blood was collected. The results, shown in Table 4, showed antiserum titers exceeding 1:64,000.

[0211] Table 4 Sheep polyclonal antibody titer detection

[0212]

[0213]

[0214] Example 4: Purification of antibodies

[0215] Protein G affinity chromatography was used to purify antibodies. The samples to be purified included the ascites prepared in Example 1, the culture supernatant of transiently transfected cells prepared in Example 2, and the goat polyclonal antibody serum prepared in Example 3. The specific steps were as follows:

[0216] A. Wash the Protein G affinity chromatography column with 3-5 column volumes of purified water;

[0217] B. Wash the Protein G affinity chromatography column with 3-5 column volumes of 20 mM sodium phosphate buffer (pH 7.0);

[0218] C. Pump the desired purified sample into the chromatography column;

[0219] D. Elute with 100 mM citric acid buffer (pH 2.7), collect the elution peak, and neutralize the collected material with 1 M Tris buffer (pH 9.0);

[0220] E. Desalting by dialysis with 10 mM PB8.0 buffer;

[0221] F. Preliminary antibody identification by SDS-PAGE electrophoresis revealed that the purified monoclonal antibody prepared from ascites, the recombinant monoclonal antibody obtained by transient transfection of cells, and the goat polyclonal antibody all exhibited target bands at 50 kD and 25 kD, respectively, with purities exceeding 90%. Similarly, indirect ELISA assays revealed that the titer of the purified monoclonal antibody at a concentration of 1 g / L was 1:1,000,000, while the titer of the goat polyclonal antibody at 1 g / L was 1:16,000.

[0222] Example 5: Determination of Antibody Dosage by Mouse Superovulation Experiment

[0223] According to the literature (Ulcova-Gallova Z, Babcova K, Micanova Z, Bibkova K, Rumpik D. Hyperstimulation syndrome: the levels of inhibin A and B in sera and follicular fluids. Gynecol Endocrinol. 2014; 30(4): 298-301), the human body contains approximately 2.5 μg / L of inhibin, and when follicles are well developed, the level rises to above 5 μg / L. Based on this, and assuming a mouse weighs 25 g, the inhibin content in the body is estimated to be 5-10 μg. To investigate whether there is a correlation between dosage and ovulation rate, the antibody group was set up with four concentration gradients: 0.002 μg, 0.02 μg, 0.2 μg, and 20 μg per mouse, i.e., 0.1 μg / kg, 1 μg / kg, 10 μg / kg, and 1000 μg / kg. Referring to the established dosage regimen of PMSG, the dosage was set at 10 IU / mouse.

[0224] Five-week-old female ICR mice were randomly divided into 22 groups, each containing five mice. Specifically, the mice were injected with recombinant mAb 4D8 (four groups), recombinant mAb 1E5 (four groups), ascites mAb 4D8 (four groups), ascites mAb 1E5 (four groups), goat polyclonal antibody (four groups), and PMSG (four groups). Normal saline was used as a negative control. At 5:00 PM on Monday, mice were intraperitoneally injected with the above-mentioned doses of antibodies and 10 IU of PMSG. 48 hours later, 10 IU of human chorionic gonadotropin (hCG) was also injected intraperitoneally. Oocytes were retrieved and counted at 9:00 AM on Thursday. The results are shown in Table 5. It can be seen that the ovulation-inducing effect of the low-dose group (0.1μg / kg) is worse than that of the PMSG group, and the two medium-dose groups (1μg / kg, 10μg / kg) can significantly increase the ovulation of mice, but increasing the dosage (high-dose group, 1000μg / kg) will not promote ovulation within the same period of time; it can also be seen that under the same dosage of the monoclonal antibody group, the effect of each group of samples on the number of ovulations is not much different, and the dosage of 0.02μg / mouse (1μg / kg) can significantly increase the number of ovulations compared with PMSG. Therefore, subsequent mouse-related experiments will temporarily use a dosage of 0.02μg / mouse versus a PMSG dosage of 10IU, but it is not ruled out that the dosage may be adjusted as the research deepens.

[0225] Table 5 Effects of different monoclonal antibodies and dosages on the number of ovulated mice (per mouse)

[0226]

[0227] Example 6: Effects of different administration methods on mouse ovulation

[0228] Superovulation experiments in mice are generally performed through intraperitoneal administration, but considering its limitations in large animal applications, this experiment mainly determines whether subcutaneous and intramuscular administration can produce equivalent effects.

[0229] Five-week-old female ICR mice were randomly divided into 17 groups, each containing five mice. Specifically, the mice were administered 1 μg / kg recombinant mAb 4D8 (three groups), 1 μg / kg recombinant mAb 1E5 (three groups), 1 μg / kg ascites mAb 4D8 (three groups), 1 μg / kg ascites mAb 1E5 (three groups), 1 μg / kg goat polyclonal antibody (three groups), and 10 IU PMSG. Normal saline was used as a negative control. At 5:00 PM on Monday, 0.02 μg of the antibody and 10 IU PMSG were injected intraperitoneally, subcutaneously, and intramuscularly, respectively. 48 hours later, 10 IU hCG was injected intraperitoneally. Oocytes were retrieved and counted at 9:00 AM on Thursday. The results are shown in Table 6. The results show that the different samples, administered by different routes, had essentially the same ovulatory effect on mice. Therefore, in subsequent studies, intraperitoneal administration will be used in mouse experiments, while other animal models will be modified based on specific procedures. In pigs, cattle, and sheep, intramuscular administration is preferred.

[0230] Table 6 Effects of different administration methods on the number of ovulations in mice (per mouse)

[0231]

[0232]

[0233] Example 7: Application of Monoclonal Antibodies in Improving Ovulation Quality in ICR Mice

[0234] Five-week-old female ICR mice were randomly divided into six groups of 10 mice each: 1 μg / kg recombinant mAb 4D8, 1 μg / kg recombinant mAb 1E5, 1 μg / kg ascites mAb 4D8, 1 μg / kg ascites mAb 1E5, 10 IU PMSG, and 1 μg / kg goat polyclonal antibody. At 5:00 PM on Monday, the mice were intraperitoneally injected with the above-mentioned doses of antibodies and 10 IU PMSG. 48 hours later, 10 IU HCG was also intraperitoneally injected. Oocytes were retrieved at 9:00 AM on Thursday and their quality was assessed. Figures 1-6 As shown in the figure: It can be seen that all eggs in the antibody group were in the M2 stage, with clear hyaline membranes, and no dead eggs. Similarly, it can be concluded that the effects of recombinant mAbs and ascites mAbs on ovulation quality are similar.

[0235] Example 8: Effects of anti-inhibin monoclonal antibodies on conception rate and litter size in mice

[0236] The in vivo activity of recombinant and ascites-prepared monoclonal antibodies 4D8 and 1E5 was determined by comparing mouse conception rates and litter size. The disclosed products are intended to replace PMSG in animal breeding, using PMSG as the standard and normal saline as the negative control.

[0237] Seven-week-old female ICR mice were randomly divided into seven groups of 10 mice each. At 5:00 PM on the same day, each mouse was intraperitoneally administered 0.02 μg of antibody and 10 IU of PMSG. 48 hours later, 10 IU of HCG was injected and mated. After 20 days, conception rates were calculated, and the number of litters born was counted.

[0238] The results are shown in Table 7. At an antibody dosage of 1 μg / kg, the conception rate (90%) of the monoclonal antibody group was significantly higher than that of the PMSG group (80%) and the goat polyclonal antibody group (70%). The average litter size was at least 13, also higher than the 11.1 for PMSG and 10 for the goat polyclonal antibody group. It can be seen that both the recombinantly expressed mAb and the ascites-derived mAb performed well in conception rate and average litter size, but the slightly superior performance of the recombinant mAb may be due to the influence of mouse IgG contained in the ascites on the experiment.

[0239] Preferably, subsequent application research is carried out using recombinant 4D8 monoclonal antibody and recombinant 1E5 monoclonal antibody.

[0240] Table 7 Experimental study on the effects of monoclonal antibodies 4D8 and 1E5 on mouse conception and litter birth

[0241] Group Number of experiments Embryonic mice (number) Conception rate Number of litters (children) Average litter size (pcs) Recombinant 4D8 10 9 90％ 123 13.7±0.93 Recombinant 1E5 10 10 100％ 134 13.4±0.86 Ascites 4D8 10 9 90％ 118 13.1±1.00 Ascites 1E5 10 9 90％ 120 13.3±0.75 PMSG 10 8 80％ 89 11.1±0.89 Sheep polyclonal antibody 10 7 70％ 70 10.0±0.99 Normal saline 10 4 40％ 28 7.0±1.43

[0242] Example 9: Application of different dosages of antibodies in increasing sow litter size

[0243] One hundred and ten 210-day-old replacement three-way sows weighing 85-100 kg and with similar physical characteristics were selected. They were randomly divided into 11 groups: recombinant monoclonal antibody 4D8 (0.1 μg / kg, 1 μg / kg, 1000 μg / kg), recombinant monoclonal antibody 1E5 (0.1 μg / kg, 1 μg / kg, 1000 μg / kg), 10 IU PMSG, and goat polyclonal antibody groups (0.1 μg / kg, 1 μg / kg, 1000 μg / kg); normal saline was used as a negative control. Each donor pig in each group was injected intramuscularly behind the ear with the above-mentioned doses of the drugs. 80 hours later, 500 IU hCG was injected. The first insemination was performed 24 hours after hCG administration, followed by another insemination 16 hours later. The litter size of each group was recorded in detail.

[0244] The results are shown in Table 8. The total litter size in the 1 μg / kg 4D8 and 1E5 groups (125 and 131 piglets) was significantly higher than that in the 10 IU PMSG group (72 piglets) and the 1 μg / kg and 1000 μg / kg goat polyclonal antibody groups (both 66 piglets), and the difference was significant compared to the PMSG group (P < 0.05). The average litter size in the 1 μg / kg 4D8 and 1E5 groups (13.9 and 13.1 piglets) was also significantly higher than that in the 10 IU PMSG group (10.3 piglets) and the 1 μg / kg and 1000 μg / kg goat polyclonal antibody groups (9.4 piglets).

[0245] Table 8 Comparison of the effects of recombinant monoclonal antibody 4D8 / 1E5, PMSG, and goat polyclonal antibody on the litter size of gilts

[0246] Group Number of experimental heads Number of sows farrowing Total number of piglets born Average number of piglets born Monoclonal antibody 4D8-L 10 4 39 9.8±2.22 Monoclonal antibody 4D8-M 10 9 125 13.9±1.52 Monoclonal antibody 4D8-H 10 9 120 13.3±1.78 Monoclonal antibody 1E5-L 10 5 41 8.2±2.01 Monoclonal antibody 1E5-M 10 10 131 13.1±1.15 Monoclonal antibody 1E5-H 10 9 118 13.1±1.43 PMSG 10 7 72 10.3±1.24 Sheep polyclonal antibody-L 10 2 15 7.5±2.31 Sheep polyclonal antibody-M 10 7 66 9.4±1.39 Sheep polyclonal antibody-H 10 7 66 9.4±1.56 Normal saline 10 4 30 7.5±2.01

[0247] Note: L refers to 0.1 μg / kg; M refers to 1 μg / kg; H refers to 1000 μg / kg

[0248] Example 10: Use of antibodies in promoting estrus and ovulation synchronization in sows and multiparous sows

[0249] 80 replacement three-way sows and 80 multiparous sows, weighing 85-100 kg and not in estrus two weeks after weaning, of the same breed and with similar physical characteristics were selected. Without optimizing the dosage, the dosage for pigs was extrapolated based on the theoretical dosage and in vivo activity results in mice. The pigs were randomly divided into four groups: 1 μg / kg recombinant monoclonal antibody 4D8, 1 μg / kg recombinant monoclonal antibody 1E5, 10 IU PMSG, and 1 μg / kg goat polyclonal antibody. Each group was further divided into a primiparous sow group and a multiparous sow group.

[0250] The above-mentioned different doses of drugs were injected into the neck muscle behind the ears of each group of donor pigs. 80 hours later, 500 IU HCG was injected and the estrus of the sows in each group was observed. 72 hours later, eggs were surgically collected from the donor pigs and the number of ovulations was calculated.

[0251] In the prior art, the number of ovulations in a normal naturally estrus sow is usually 8-14 per head (see Chinese invention patent application CN111134084A; King B, et al. Ovulatory and endocrine responses after active immunization of gilts against a synthetic fragment of bovine inhibin. Journal of animal science. 1993; 71(4): 975-82; Ri-hong G, et al. A novel method to improve sow reproductive performance: Combination of pre-weaning immunization against inhibin and post-insemination hCG treatment. Journal of Integrative Agriculture. 2020: 0). As shown in Table 9, the donor pigs in the recombinant monoclonal antibody 4D8 group and the recombinant monoclonal antibody 1E5 group were in good estrus. At a dosage of 1 μg / kg, the estrus rates of primiparous and multiparous sows in the recombinant monoclonal antibody group were higher than 95%, which were higher than those in the PMSG group (85% and 80%) and the sheep polyclonal antibody group (70% and 65%). Moreover, the number of ovulations of sows in each group was higher than that of sows in normal natural estrus (8-14 ovulations / head); similarly, at a dosage of 1 μg / kg, the average number of ovulations of primiparous and multiparous sows in the recombinant monoclonal antibody 4D8 group was 24.8 and 25.5, respectively, and the average number of ovulations of primiparous and multiparous sows in the recombinant monoclonal antibody 1E5 group was 24.7 and 25.2, respectively, which were higher than those in the PMSG group (19.8 and 20.1) and the sheep polyantibody group (18.3 and 17.9), and the differences between the two groups were significant compared with the PMSG group (P<0.05).

[0252] Table 9 Effects of recombinant monoclonal antibody 4D8 / 1E5, PMSG, and goat polyclonal antibody on estrus and ovulation synchronization in reserve and multiparous sows

[0253]

[0254] Example 11: Use of antibodies in promoting superovulation in cows

[0255] Under natural conditions, a cow only produces one embryo at a time, which greatly limits the breeding of high-quality cattle. Therefore, it is necessary to develop a method that can produce multiple high-quality embryos at a time.

[0256] One hundred and ten healthy, disease-free Holstein cows aged 3-6 years were randomly divided into 11 groups: recombinant monoclonal antibody 4D8 (0.1 μg / kg, 1 μg / kg, 1000 μg / kg), recombinant monoclonal antibody 1E5 (0.1 μg / kg, 1 μg / kg, 1000 μg / kg), 10 IU PMSG, and goat polyclonal antibody (0.1 μg / kg, 1 μg / kg, 1000 μg / kg); normal saline was used as a negative control. Cows in each group were supplemented with 1 kg of concentrate feed in addition to their usual diet and given the corresponding drugs via intramuscular injection according to a conventional superovulation protocol. The cows were then observed for estrus. The first insemination occurred 12 hours after standing estrus, and the second insemination occurred 24 hours later. Embryos were collected non-surgically on Day 16, and the number of embryos was counted.

[0257] The results are shown in Table 10: The average number of embryos per cow in the 1 μg / kg recombinant mAb 4D8 and 1E5 groups (8.1 and 8.4) was significantly higher than that in the PMSG group (6.2) and the 1 μg / kg and 1000 μg / kg goat polyclonal antibody groups (5.1), with significant differences (P < 0.05). Similarly, the average number of viable embryos per cow in the 1 μg / kg recombinant mAb 4D8 and 1E5 groups (6.5 and 7.0) was significantly higher than that in the PMSG group (4.9) and the 1 μg / kg and 1000 μg / kg goat polyclonal antibody groups (3.5), with significant differences (P < 0.05).

[0258] Table 10 Comparison of recombinant monoclonal antibody 4D8 / 1E5, PMSG, and goat polyclonal antibody in promoting superovulation in Holstein cows

[0259]

[0260] Note: L refers to 0.1 μg / kg; M refers to 1 μg / kg; H refers to 1000 μg / kg

[0261] Example 12: Use of antibodies in improving estrus in anestrus cows

[0262] As can be seen from Example 11, a dosage of 1 μg / kg achieved good results in superovulation of cows and was highly feasible in practical applications. Therefore, it is planned to conduct research on improving anestrus in cows using this dosage.

[0263] After estrus monitoring, 40 Holstein cows that were unable to estrus were randomly divided into four groups: 1 μg / kg recombinant monoclonal antibody 4D8, 1 μg / kg recombinant monoclonal antibody 1E5, 10 IU PMSG, and 1 μg / kg goat polyclonal antibody. Each group of donor cows received the corresponding drugs via intramuscular injection at fixed time points according to the estrus synchronization schedule. Oestrus was observed by bull mounting and rectal examination.

[0264] The results are shown in Table 11. The anestrus cows were sensitive to the drug. The estrus rate of cows in the 1 μg / kg recombinant monoclonal antibody 4D8 and recombinant monoclonal antibody 1E5 groups was 80%, which was significantly higher than that in the PMSG group (60%) and the goat polyclonal antibody group (50%) (P<0.05).

[0265] Table 11 Comparison of recombinant monoclonal antibody 4D8 / 1E5, PMSG, and goat polyclonal antibody in inducing estrus in anestrus cows

[0266] Group Number of experimental heads Number of estrus Estrus rate Recombinant monoclonal antibody 4D8 10 8 80％ Recombinant monoclonal antibody 1E5 10 8 80％ PMSG 10 6 60％ Sheep polyclonal antibody 10 5 50％

[0267] Example 13: Use of antibodies in promoting estrus synchronization in ewes and increasing twinning rates

[0268] One hundred and ten healthy, disease-free female goats aged 1.5-3 years, weighing 30-45 kg, were randomly divided into four groups: recombinant monoclonal antibody 4D8 (0.1 μg / kg, 1 μg / kg, 1000 μg / kg), recombinant monoclonal antibody 1E5 (0.1 μg / kg, 1 μg / kg, 1000 μg / kg), 10 IU PMSG, and goat polyclonal antibody (0.1 μg / kg, 1 μg / kg, 1000 μg / kg); normal saline was used as a negative control. On any day of the estrus cycle, a progesterone vaginal suppository was placed in the donor goats, designated Day 0. Each donor goat received an intramuscular injection of 300 IU of the corresponding drug (Day 10), and the suppository was removed (Day 12). The goats were observed for signs of estrus and tested with test rams. Ewes were considered in estrus if their vulva showed redness, mucus discharge, and were receptive to mounting. The estrus rate was calculated. At the same time, the first insemination was performed 24 hours after estrus, and the second insemination was performed after an interval of 16 hours. The conception rate and twin lamb rate were recorded.

[0269] The results, as shown in Table 12, showed significant estrus in all groups. The estrus rate of ewes in the 1 μg / kg recombinant mAb 4D8 and 1E5 groups reached over 90%, significantly higher than that in the 10 IU PMSG group (70%) and the goat polyclonal antibody group (30%), and the difference was significant compared to the PMSG group (P < 0.05). Similarly, the conception rate of ewes in the 4D8 and 1E5 groups reached over 90%, higher than that in the PMSG group (80%) and the 1 μg / kg and 1000 μg / kg goat polyclonal antibody groups (30%). The twinning results showed that the twinning rate in the 1 μg / kg recombinant mAb 4D8 and 1E5 groups exceeded 60%, significantly higher than that in the PMSG group (43.8%) and the goat polyclonal antibody group (33.3%), with significant differences (P < 0.05).

[0270] Table 12 Comparison of the effects of recombinant monoclonal antibody 4D8 / 1E5, PMSG, and goat polyclonal antibody on estrus and twin lambs in female goats

[0271] Group Number of experimental heads Number of estrus Estrus rate Number of conceptions Conception rate Twin rate Monoclonal antibody 4D8-L 10 4 40％ 3 30 33.3％ Monoclonal antibody 4D8-M 10 10 90％ 9 90％ 66.7％ Monoclonal antibody 4D8-H 10 9 90％ 8 90％ 62.5％ Monoclonal antibody 1E5-L 10 5 50％ 4 50％ 50.0％ Monoclonal antibody 1E5-M 10 9 90％ 10 100％ 70％ Monoclonal antibody 1E5-H 10 9 90％ 8 80％ 62.5％ PMSG 10 7 70％ 7 70％ 43.8％ Sheep polyclonal antibody-L 10 2 20％ 1 10％ 0％ Sheep polyclonal antibody-M 10 4 40％ 3 30％ 33.3％ Sheep polyclonal antibody-H 10 4 40％ 3 30％ 33.3％ Normal saline 10 2 20％ 2 20％ 0％

[0272] Note: L refers to 0.1 μg / kg; M refers to 1 μg / kg; H refers to 1000 μg / kg.

Claims

1. An anti-inhibin antibody, or antigen-binding portion thereof, comprising a heavy chain and a light chain CDR combination selected from the group consisting of: (1) The heavy chain CDR1, CDR2 and CDR3 sequences of SEQ ID NOs. 1, 2 and 3, respectively, and the light chain CDR1, CDR2 and CDR3 sequences of SEQ ID NOs. 4, 5 and 6, respectively; (2) The heavy chain CDR1, CDR2 and CDR3 sequences are SEQ ID NOs. 11, 12 and 13, respectively, and the light chain CDR1, CDR2 and CDR3 sequences are SEQ ID NOs. 14, 15 and 16, respectively.

2. The antibody or antigen-binding portion thereof according to claim 1, comprising a heavy chain variable region selected from the amino acid sequence of SEQ ID NO. 7 or 17, and a light chain variable region selected from the amino acid sequence of SEQ ID NO. 9 or 19.

3. The antibody or antigen-binding portion thereof according to claim 1, comprising a heavy chain variable region having an amino acid sequence of SEQ ID NO. 7 and a light chain variable region having an amino acid sequence of SEQ ID NO.

9.

4. The antibody or antigen-binding portion thereof according to claim 1, comprising a heavy chain variable region having an amino acid sequence of SEQ ID NO. 17 and a light chain variable region having an amino acid sequence of SEQ ID NO.

19.

5. A nucleic acid encoding the antibody or antigen-binding portion thereof according to any one of claims 1 to 4. 6 . The nucleic acid according to claim 5 , comprising an antibody heavy chain variable region nucleic acid sequence selected from SEQ ID NO. 8 or 18, and an antibody light chain variable region nucleic acid sequence selected from SEQ ID NO. 10 or 20.

7. The nucleic acid according to claim 5, comprising a heavy chain variable region nucleic acid sequence having a nucleic acid sequence of SEQ ID NO. 8 and a light chain variable region nucleic acid sequence having a nucleic acid sequence of SEQ ID NO.

10.

8. The nucleic acid according to claim 5, comprising a heavy chain variable region nucleic acid sequence of SEQ ID NO. 18 and an antibody light chain variable region nucleic acid sequence of SEQ ID NO.

20.

9. A vector comprising the nucleic acid according to any one of claims 5 to 8.

10. A cell comprising the nucleic acid of any one of claims 5 to 8 or the vector of claim 9, which does not comprise a plant cell.

11. An expression system constructed by introducing an expression vector comprising the nucleic acid according to any one of claims 5 to 8 into a host cell; The expression vector is selected from any one of bacterial plasmids, yeast plasmids and mammalian cell viruses; The host cell is a prokaryotic host cell or a eukaryotic host cell, and the eukaryotic host cell does not include a plant cell. The expression system according to claim 11 , wherein the prokaryotic host cell is a bacterial cell. The expression system according to claim 12 , wherein the bacterial cell is Escherichia coli. The expression system according to claim 11 , wherein the eukaryotic host cell is selected from any one of fungi, insects and mammals. The expression system according to claim 14 , wherein the fungal eukaryotic host cell is selected from any one of yeast and filamentous fungi. The expression system according to claim 15 , wherein the yeast is Pichia pastoris or Saccharomyces cerevisiae.

17. The expression system of claim 14, wherein the mammalian eukaryotic host cell is selected from any one of Chinese hamster ovary (CHO) cells, murine myeloma (NS0) cells, baby hamster kidney (BHK) cells, and human embryonic kidney (HEK) cells. The expression system according to claim 17 , wherein the host cell is a Chinese Hamster Ovary (CHO) cell. The expression system according to claim 17 , wherein the host cell is a HEK293 cell.

20. The expression system according to claim 11, wherein the expression vector is pcDNA3.1(+).

21. The expression system according to claim 11, wherein the mammalian cell virus is an adenovirus or a retrovirus.

22. The expression system according to any one of claims 11 to 21, wherein the method for introducing the expression vector into the host cell is selected from transfection, transformation or infection.

23. The expression system according to claim 22, wherein the expression vector is introduced into the host cell by transfection.

24. The expression system of claim 23, wherein the transfection method comprises: Electroporation transfection, calcium phosphate transfection, liposome transfection, protoplast fusion transfection, microinjection, gene gun, cationic polymer and viral vector infection.

25. A composition comprising the antibody or antigen-binding portion thereof of any one of claims 1-4, the nucleic acid of any one of claims 5-8, the vector of claim 9 and / or the cell of claim 10.

26. Use of the antibody or antigen-binding portion thereof according to any one of claims 1 to 4, the nucleic acid according to any one of claims 5 to 8, the vector according to claim 9 and / or the cell according to claim 10 and / or the composition according to claim 25 in the preparation of a medicament for promoting animal reproduction; the animal being selected from mice, pigs, cattle and sheep.

27. The use according to claim 26, wherein the drug for promoting animal reproduction comprises a drug for estrus synchronization, conception and farrowing, embryo transplantation, improving ovulation quality or promoting livestock reproduction.

28. The use according to claim 27, wherein the drug for promoting livestock reproduction comprises a drug for inducing estrus in female animals.

Images