A attenuated, controllable replication forward HSV tracer system, and a construction method and application thereof

By knocking out the γ34.5 gene of HSV-1H129 and inserting a self-degrading chimeric gene, a low-toxicity recombinant HSV virus was constructed, which solved the problems of high toxicity and low sensitivity of HSV and achieved long-term neural circuit cross-synaptic tracing and efficient gene expression.

CN116262911BActive Publication Date: 2026-02-17SHENZHEN INST OF ADVANCED TECH CHINESE ACAD OF SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202111524089.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-12-14
Publication Date
2026-02-17
Estimated Expiration
2041-12-14

AI Technical Summary

Technical Problem

Existing herpes simplex virus (HSV) tools suffer from high virulence and low sensitivity. In particular, HSV-1H129 infection leads to rapid cell apoptosis, making it impossible to perform long-term neural circuit structure tracing and functional analysis.

Method used

By completely knocking out the double copy of the γ34.5 gene in the HSV-1H129 genome and inserting a fluorescent gene expression cassette, a controllable expression γ34.5 self-degradation chimeric gene was constructed, which limited the viral replication rate, reduced virulence, and formed a recombinant HSV virus.

Benefits of technology

It achieves low-toxicity, long-term transsynaptic tracing of neural circuits, applicable to neural circuit labeling, gene transduction, targeted gene therapy, etc., reducing viral toxicity while maintaining efficient gene expression.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116262911B_ABST
    Figure CN116262911B_ABST
Patent Text Reader

Abstract

The application provides an attenuated, replication-controllable forward HSV tracing system and a construction method and application thereof. Specifically disclosed is a recombinant herpes simplex virus type 1 crossing a nerve synapse, which is obtained by knocking out two copies of a nerve virulence factor coding gene gamma 34.5 in a H129 strain genome, then back-supplementing an expression-controllable gamma 34.5 self-degradation recombination gene into the original gene site of gamma 34.5, and the expression-controllable gamma 34.5 self-degradation recombination gene contains the gamma 34.5 gene with a function domain participating in the cell autophagy process knocked out and a degradation sequence PEST. The herpes simplex virus provided by the application can be used as a gene transduction carrier for long-term high expression of a target gene, long-term, anterograde crossing multi-level synapse structure tracing of a nerve circuit, functional nerve circuit analysis and the like, and has wide application value in nervous system targeted gene therapy, oncolytic virus therapy, virus replication and pathogenic mechanism analysis, animal infection model establishment and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, involving neurobiology and molecular virology, specifically involving the attenuation modification of a herpes simplex virus tracing system. The attenuated recombinant herpes simplex virus provided by this invention can be used for neural circuit labeling, gene transduction, oncolytic therapy, establishment of animal infection models, analysis of viral replication and pathogenesis mechanisms, and screening of antiviral drugs. Background Technology

[0002] Viral transsynaptic tracing technology has been increasingly widely used in neural circuit analysis in recent years. Traditional neural network tracing methods, such as dyes, compound tracers, and protein peptides, can be transported along axons but cannot cross synapses, thus only marking local neuronal morphology. Neurotropic viruses, on the other hand, have significant advantages as tracing tools: 1) highly efficient infection of nerve cells; 2) ability to spread across synapses; 3) controllable transsynaptic direction, allowing specific retrograde or anterograde propagation; 4) self-replication after crossing synapses without signal attenuation; and 5) the ability to carry complex regulatory elements and diverse markers.

[0003] Currently, commonly used neurotropic viruses mainly include pseudorabies virus (PRV) and herpes simplex virus (HSV) from the Alphaherpesviridae family, and rabies virus (RV) from the Rhabdoviridae family. Others include vesicular stomatitis virus (VSV). Among them, PRV Bartha strain and RV are retrograde transsynaptic infections, while VSV can spread in both directions. Relatively speaking, HSV-1H129 strain can specifically spread transsynaptically in the anterograde direction, which is consistent with the direction of nerve impulse transmission and is very suitable for labeling output neural networks.

[0004] Herpes simplex virus type 1 (HSV 1) is a widely distributed, opportunistic pathogen. It is a large enveloped virus, about 200 nm in diameter, with a core of double-stranded DNA genome of about 153 kb, composed of covalently linked long fragments (UL) and short fragments (US). Each fragment has an inverted repeat sequence at its end, thus it can form 4 isoforms.

[0005] Wild-type HSV virus is highly virulent; mice infected with it in the central nervous system typically die within one week. The most important neurovirulence factor gene of HSV has been identified as the γ34.5 gene, which encodes the multifunctional ICP34.5 protein involved in important processes such as viral replication regulation, assembly, and autophagy. The γ34.5 gene has two copies in the HSV genome, located in the terminal repeat sequences TRL and IRL of the UL long fragment, respectively. The full-length gene is 1007 bp and encodes the multifunctional ICP34.5 protein (coding frame shown in SEQ ID NO. 1): After infection by pathogens or viruses, the body's cells quickly activate an innate immune response, including inducing the production of interferon and other important antiviral proteins. Viral infection phosphorylates the eukaryotic translation initiation factor eIF2α, leading to the termination of cellular protein synthesis, thereby inhibiting viral replication. HSV has evolved various strategies to evade host defense mechanisms in order to replicate itself. ICP34.5 forms a complex by binding to host protein phosphatase 1 (PP1), regulating and mediating the dephosphorylation of eIF2α, thereby maintaining the host cell's protein synthesis and metabolism, which serves the viral replication process. ICP34.5 also has functions such as antagonizing interferon-induced antiviral protein production and antagonizing host cell autophagy to clear the virus.

[0006] As mentioned above, due to the inherent properties of HSV viruses, current HSV tool viruses generally suffer from high virulence and low abundance of exogenous gene expression. In brain mapping technology, the HSV-1H129 strain is most widely used for anterograde transsynaptic tracing studies. However, current HSV tool viruses generally suffer from high virulence and low sensitivity. H129 is a strain isolated from the brain of a patient who died of encephalitis; the wild-type strain is highly virulent, and infected cells generally undergo rapid apoptosis within two days. Mice infected with H129 in the brain typically only survive for 3-5 days, making long-term neural circuit structure tracing impossible, let alone functional circuit analysis. Therefore, the inherent virulence of HSV H129 virus is one of the biggest problems it currently faces as a neural system tracing tool.

[0007] Previous research by the inventors confirmed that ICP34.5 plays an important regulatory role in the replication and assembly of HSV virus itself, and that complete knockout of the double-copy ICP34.5 gene significantly reduces viral virulence. However, after knockout of the double-copy γ34.5 gene, HSVΔγ34.5 infection of mouse brain neurons results in a replication-deficient genotype, lacking the ability to propagate across synapses, and is no longer suitable for cross-synaptic tracing of the output loop, especially across multiple synapses. Summary of the Invention

[0008] The purpose of this invention is to solve the above-mentioned problems and provide a low-virulence herpes simplex virus multi-level synaptic tracing system. The low-virulence HSV is obtained by completely knocking out two copies of the neurovirulence factor γ34.5 gene in the HSV-1H129 genome, inserting the complete fluorescent gene expression cassette into the knocked-out γ34.5 gene locus, and then adding back the controllable expression of the γ34.5 recombinant gene constructed by chimerating with the protein degradation sequence PEST into the original gene locus, thereby achieving controllable micro-expression of the self-degradation of ICP34.5 protein, thus obtaining a recombinant HSV virus with slower replication and reduced virulence.

[0009] Complete knockout of the double-copy ICP34.5 gene (HSVΔγ34.5) significantly reduced viral virulence. However, HSVΔγ34.5 infection of mouse brain neurons resulted in a replication-deficient variant, lacking transsynaptic propagation ability, and was no longer suitable for transsynaptic tracing of the output loop. Therefore, a novel attenuated anterograde HSV tracing system was designed to reintroduce a controllable expression level of the γ34.5 gene to its original genomic locus. By introducing the eukaryotic degradation sequence PEST, the expressed ICP34.5 protein was self-degraded, thus maintaining ICP34.5 at a consistently low expression level, limiting viral replication rate while ensuring a significant reduction in viral virulence.

[0010] Another objective of this invention is to provide applications of a low-toxicity herpes simplex virus tracing system, including: neural circuit labeling and tracing, large-capacity gene transduction vectors, targeted gene therapy of the nervous system, analysis of viral replication and pathogenesis mechanisms, establishment of animal infection models, screening of antiviral drugs, and oncolytic therapy.

[0011] A weakened herpes simplex virus anterograde transsynaptic virus tracing system was constructed using the following series of methods: Two copies of the neurovirulence factor γ34.5 were completely knocked out of the HSV-1H129 genome; a complete fluorescent gene expression cassette, including the hUbC promoter, a fluorescent gene, and a WPRE fragment, was inserted into the knocked-out γ34.5 gene locus; then, a controllable γ34.5 self-degradation chimeric gene was constructed, and the autophagy-related functional domain and the stop codon in the γ34.5 gene coding frame were knocked out to obtain γ34.5d20; subsequently, γ34... The .5d20 gene was obtained by chimerizing TEVsite (a 7-amino acid cleavage sequence derived from tobacco mosaic virus, which can be specifically recognized and cleaved by TEV protease) and PEST (a eukaryotic protein degradation sequence) to obtain the recombinant chimeric gene γ34.5d20-TEVsite-PEST. Finally, the new γ34.5d20-TEVsite-PEST chimeric gene was added back into the original γ34.5 gene site of the HSV recombinant virus to achieve micro-controllable expression of ICP34.5 protein, thereby obtaining a recombinant HSV virus with slower replication and reduced virulence.

[0012] Specifically, in the viral recombination process of this invention, to facilitate HSV virus recombination spot picking, firstly, a recombinant HSV H129Δγ34.5-hUbC-tdTomato-WPRE expressing red fluorescent protein is constructed and purified by spot picking; secondly, a long coding frame (EGFP-IRES-γ34.5d20-TEVsite-PEST) is constructed, which connects the green fluorescent protein gene to the γ34.5 recombinant chimeric gene (γ34.5d20-TEVsite-PEST) via the IRES sequence; through homologous recombination, the long coding frame (EGFP-IRES-γ34.5d20-TEVsite-PEST) replaces the red fluorescent protein gene expression frame (hUbC-tdTomato-WPRE) from the previous step. Thus, green fluorescent viral spots are picked against a red fluorescent cell background. After 5 rounds of spot picking, a purified recombinant virus carrying the controllable expression of the γ34.5 chimeric gene and the green fluorescent protein reporter gene is obtained.

[0013] One aspect of the present invention provides a transsynaptic recombinant type 1 herpes simplex virus, wherein the type 1 herpes simplex virus is obtained by completely knocking out two copies of the neurovirulence factor encoding gene γ34.5 in the H129 strain genome; and then adding the controllable expression of the γ34.5 self-degradation recombinant gene back into the original γ34.5 gene site;

[0014] The controllable expression of the γ34.5 self-degrading recombinant gene includes the γ34.5 gene with its functional domain involved in autophagy knocked out, as well as the degradation sequence PEST.

[0015] Furthermore, the γ34.5 gene sequence, which contains the functional domain involved in autophagy, was knocked out, as shown in SEQ ID NO.2.

[0016] Furthermore, the sequence of the degradation sequence PEST is shown in SEQ ID NO.4.

[0017] Furthermore, the γ34.5 gene, which is involved in the autophagy process, and the degradation sequence PEST are connected by a flexible chain, preferably selected from the one shown in SEQ ID NO.3.

[0018] Furthermore, a tobacco mosaic virus-specific cleavage site, TEV site, is also included between the flexible chain and the degradation sequence PEST, the sequence of which is shown in SEQ ID NO.5.

[0019] Furthermore, the 3' end of the coding frame of the controllable γ34.5 self-degrading recombinant gene also contains a 3' non-coding sequence of the γ34.5 gene, the sequence of which is shown in SEQ ID NO.6.

[0020] Furthermore, the sequence of the controllable expression of the γ34.5 self-degradation recombinant gene (γ34.5d20-6GGGGS-TEVsite-PEST-3'UTR) is shown in SEQ ID NO.7.

[0021] Furthermore, to facilitate screening during recombination, the controllable expression of the γ34.5 self-degrading recombinant gene also includes a gene encoding a reporter protein.

[0022] Furthermore, the reporter protein is selected from fluorescent proteins, luminescent proteins, etc.

[0023] Furthermore, the fluorescent protein is selected from GFP, EGFP, Emerald, Citrine, Venus, mOrange, mCherry, TagBFP, mTurquoise, Cerulean, UnaG, dsRed, eqFP611, Dronpa, RFP, TagRFP, TdTomato, KFP, EosFP, Dendra, IrisFP, iRFP, and smURFP. Luminescent proteins include luciferase.

[0024] Furthermore, the controllable expression of the γ34.5 self-degrading recombinant gene also includes an internal ribosome entry site.

[0025] Furthermore, the sequence of the controllable expression of the γ34.5 self-degrading recombinant gene tandem with the fluorescent protein reporter gene is shown in SEQ ID NO.8.

[0026] Furthermore, the complete exogenous gene expression cassette (EGFP-IRES-γ34.5d20-TEVsite-PEST) containing the complemented γ34.5 self-degrading chimeric gene is inserted into the knocked-out γ34.5 gene locus, and the transcription direction remains consistent. This allows the use of the original promoter sequence upstream of γ34.5 without the need to introduce a new promoter, thus reducing the length of the inserted exogenous gene and its potential impact on the virus.

[0027] Another aspect of the present invention provides the use of the above-described recombinant type 1 herpes simplex virus in the preparation of anterograde multi-level synaptic labeling tracers for neural circuits.

[0028] Another aspect of the present invention provides the use of the above-described recombinant type 1 herpes simplex virus in the preparation of large-capacity gene transduction vectors.

[0029] Another aspect of the present invention provides the use of the above-described recombinant herpes simplex virus type 1 in the preparation of a drug vector for targeted gene therapy of the nervous system.

[0030] Another aspect of the present invention provides the use of the above-mentioned recombinant type 1 herpes simplex virus in the preparation of reagents for the analysis of viral replication and pathogenesis mechanisms.

[0031] Another aspect of the present invention provides the use of the above-described recombinant type 1 herpes simplex virus in the preparation of reagents for establishing animal infection models.

[0032] Another aspect of the present invention provides the use of the above-mentioned recombinant type 1 herpes simplex virus in the preparation of reagents for screening antiviral drugs.

[0033] Another aspect of the present invention provides the use of the above-described recombinant type 1 herpes simplex virus in the preparation of an oncolytic virus drug for oncolytic therapy.

[0034] In another aspect, the present invention provides a method for anterograde synaptic labeling and tracing of neural circuits across multiple levels, the method comprising injecting the aforementioned recombinant herpes simplex virus type 1 into a target region.

[0035] Furthermore, the target region is selected from the brain regions of the subject. The subject is selected from any target brain region of various experimental animals, such as rats, mice, rabbits, tree shrews, guinea pigs, and non-human primates such as monkeys.

[0036] Another aspect of the present invention provides a method for preparing the above-mentioned transsynaptic recombinant type 1 herpes simplex virus, the method comprising the following steps:

[0037] S1) Prepare type 1 herpes simplex virus with two copies of the gene encoding the neurovirulence factor γ34.5 knocked out;

[0038] S2) Prepare a targeting vector for the exogenous gene expression cassette used to recombinantly complement the γ34.5 gene with the HSV gene;

[0039] S3) The target vector obtained in step S2) and the type 1 herpes simplex virus with two copies of the neurotoxicity factor encoding gene γ34.5 knocked out and prepared in step S1) were recombined after being transfected into cells. The above-mentioned transsynaptic recombinant type 1 herpes simplex virus was obtained by spot purification.

[0040] In step S2), the exogenous gene expression cassette in the targeting vector contains a controllable expression γ34.5 self-degrading recombinant gene, which contains a γ34.5 gene with its functional domain involved in the autophagy process knocked out and the degradation sequence PEST.

[0041] Furthermore, the γ34.5 gene sequence, which contains the functional domain involved in autophagy, was knocked out, as shown in SEQ ID NO.2.

[0042] Furthermore, the sequence of the degradation sequence PEST is shown in SEQ ID NO.4.

[0043] Furthermore, the γ34.5 gene, which is involved in the autophagy process, and the degradation sequence PEST are connected by a flexible chain, preferably selected from the one shown in SEQ ID NO.3.

[0044] Furthermore, a tobacco mosaic virus-specific cleavage site, TEV site, is also included between the flexible chain and the degradation sequence PEST, the sequence of which is shown in SEQ ID NO.5.

[0045] Furthermore, the 3' end of the controllable expression γ34.5 gene also contains a 3' non-coding sequence of the γ34.5 gene, the sequence of which is shown in SEQ ID NO.6.

[0046] Furthermore, the sequence of the controllable expression of the γ34.5 self-degradation recombinant gene is shown in SEQ ID NO.7.

[0047] Furthermore, to facilitate screening during recombination, the controllable expression of the γ34.5 self-degrading recombinant gene also includes a gene encoding a reporter protein.

[0048] Furthermore, the reporter protein is selected from fluorescent proteins and luminescent proteins.

[0049] Furthermore, the fluorescent protein is selected from GFP, EGFP, Emerald, Citrine, Venus, mOrange, mCherry, TagBFP, mTurquoise, Cerulean, UnaG, dsRed, eqFP611, Dronpa, RFP, TagRFP, TdTomato, KFP, EosFP, Dendra, IrisFP, iRFP, and smURFP. Luminescent proteins include luciferase.

[0050] Furthermore, the exogenous gene expression cassette also includes an internal ribosome entry site.

[0051] Furthermore, the complete exogenous gene expression cassette (EGFP-IRES-γ34.5d20-TEVsite-PEST) containing the complemented γ34.5 self-degrading chimeric gene is shown in SEQ ID NO.8.

[0052] In another aspect, the present invention provides a transsynaptic neural tracer reagent comprising a transsynaptic recombinant herpes simplex virus type 1.

[0053] As described above, a chimeric gene with controllable expression of γ34.5 self-degradation was designed and reintroduced into the original genomic locus. By introducing the eukaryotic cell degradation sequence PEST, the expressed ICP34.5 protein was self-degraded, thereby keeping ICP34.5 at a low expression level, limiting the viral replication rate, and ensuring a significant reduction in viral virulence, thus realizing the construction of a new attenuated anterograde HSV tracing system.

[0054] Beneficial effects

[0055] This invention discloses a recombinant low-virulence, replication-controllable herpes simplex virus system derived from the clinical strain of herpes simplex virus type 1 (HSV-1) H129, its construction method, and its applications. The recombinant virus constructed using the targeting vector of this invention is a significantly attenuated H129 recombinant virus with very high exogenous gene expression abundance. Whether in vitro or in vivo animal tests, this novel attenuated herpes simplex virus exhibits low virulence and long-term high expression characteristics. It does not cause disease in centrally infected animals and has a long survival time. The low-virulence herpes simplex virus provided by this invention is highly suitable as a gene transduction vector for long-term high expression of target genes, enabling long-term, anterograde synaptic tracing of neural circuits. Due to its low virulence, it is also suitable for functional neural circuit analysis. Furthermore, the low-virulence HSV has broad application value in targeted gene therapy of the nervous system, analysis of viral replication and pathogenesis mechanisms, establishment of animal infection models, screening of antiviral drugs, and oncolytic therapy. Attached Figure Description

[0056] Figure 1 Recombination and purification of H129Δγ34.5-hUbC-tdTomato-WPRE virus with double copy knockout of HSVγ34.5 gene;

[0057] Figure 2 Genome molecular identification diagram of H129Δγ34.5-hUbC-tdTomato-WPRE;

[0058] Figure 3 A schematic diagram of the controllable expression encoding frame design for γ34.5d20-6GGGGS-TEVsite-PEST-3'UTR;

[0059] Figure 4 A schematic diagram of the genome structure of the attenuated H129Δγ34.5-EGFP-IRES-γ34.5d20-TEVsite-PEST-3'UTR recombinant virus;

[0060] Figure 5 The image shows the recombination and purification of the attenuated H129Δγ34.5-EGFP-IRES-γ34.5d20-TEVsite-PEST virus.

[0061] Figure 6 This figure shows the in vivo multi-synaptic tracing verification results of the attenuated H129Δγ34.5-EGFP-IRES-γ34.5d20-TEVsite-PEST virus. Detailed Implementation

[0062] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below, but should not be construed as limiting the scope of the present invention.

[0063] This invention discloses a recombinant low-virulence herpes simplex virus system derived from the clinical strain of herpes simplex virus type 1 (HSV-1) H129, its construction method, and its applications. Specifically, it is obtained through the following method:

[0064] (1) Construction of homologous arm clones

[0065] The double-copy γ34.5 gene was knocked out. Using the HSV-1H129 genome sequence as a template, primers were designed to clone the upstream homologous arm (UHA, 527 bp, GC content 80%) and the downstream homologous arm (DHA, 547 bp, GC content 66%) of the γ34.5 gene. The cloned upstream and downstream homologous arm fragments were digested with Hind III and BamHI, BamHI and XbaI, respectively, and then ligated into the pcDNA3.1+ vector, named pH129Δγ34.5. This vector introduced a multiple cloning site adapter between the cloned upstream and downstream homologous arms. The six introduced endonucleases are -AgeI-ClaI-HpaI-BamHI-EcoRI-SwaI-PacI-SbfI-, which facilitates the subsequent cloning of exogenous genes or expression control elements for insertion into the targeting vector.

[0066] (2) Construction of exogenous gene expression cassette plasmids

[0067] Using the FUGW plasmid as a template, the hUbC promoter and WPRE fragment were cloned, and then ligated into the pcDNA3.1(+) vector to obtain the pcDNA3.1-hUbC-WPRE vector. The red fluorescent gene (tdTomato) was cloned and ligated into the middle of hUbC and WPRE in the pcDNA3.1-hUbC-WPRE vector through KpnI and XbaI restriction sites to obtain the exogenous gene expression cassette plasmid.

[0068] (3) Construction of recombinant targeting vectors carrying fluorescent gene expression cassettes

[0069] Primers were designed to PCR clone the entire expression cassette DNA of hUbC-tdTomato-WPRE-PA or hUbC-EGFP-WPRE-PA from the fluorescent gene expression cassette plasmid. After double digestion with EcoRI and SbfI, the DNA was ligated into pH129Δγ34.5 to construct the recombinant targeting vector pH129Δγ34.5-hUbC-tdTomato-WPRE-PA.

[0070] (4) Expression of the controllable weakening of the γ34.5 self-degrading chimeric gene to supplement the HSV genome

[0071] Complete knockout of the double-copy ICP34.5 gene in the HSV genome significantly reduces viral virulence. However, HSV Δγ34.5 infection of mouse brain neurons results in a replication-deficient genotype, lacking transsynaptic propagation ability, making it unsuitable for transsynaptic tracing of the output loop. Therefore, a novel attenuated anterograde HSV tracing system was designed to reintroduce a controllable expression γ34.5 gene to its original genomic locus. By introducing the eukaryotic degradation sequence PEST, the expressed ICP34.5 protein was self-degraded, thus maintaining ICP34.5 at a consistently low expression level. This limited viral replication rate while ensuring a significant reduction in viral virulence, thereby constructing a novel attenuated anterograde HSV tracing system.

[0072] The specific construction process is as follows: First, the functional domain involved in autophagy in the γ34.5 gene (γ34.5d20, sequence as shown in SEQ ID NO.2) is knocked out. Then, a highly efficient degradation sequence specific to eukaryotic cells, PEST (sequence as shown in SEQ ID NO.4), is introduced after the γ34.5d20 gene via a flexible strand (6GGGGS, sequence as shown in SEQ ID NO.3). To controllably knock out the degradation PEST gene sequence, a tobacco mosaic virus-specific splicing site, TEV site (sequence as shown in SEQ ID NO.5), is designed to be introduced between the flexible strand and PEST. At the same time, to stabilize gene expression, a 3' non-coding sequence of the γ34.5 gene (γ34.5-3'UTR, sequence as shown in SEQ ID NO.6) is inserted at the 3' end. Thus, the overall complemented expression of the controllably weakened γ34.5 gene is γ34.5d20-6GGGGS-TEVsite-PEST-3'UTR, and the complete sequence is shown in SEQ ID NO.7.

[0073] In the viral recombination process of this invention, to facilitate HSV virus recombination spot picking, firstly, a recombinant HSV H129Δγ34.5-hUbC-tdTomato-WPRE expressing red fluorescent protein is constructed and purified by spot picking; secondly, a long coding frame (EGFP-IRES-γ34.5d20-TEVsite-PEST, sequence shown in SEQ ID NO.8) is constructed, linking the green fluorescent protein gene with the IRES sequence and the γ34.5 recombinant chimeric gene (γ34.5d20-TEVsite-PEST); through homologous recombination, the long coding frame (EGFP-IRES-γ34.5d20-TEVsite-PEST) replaces the red fluorescent protein gene expression frame (hUbC-tdTomato-WPRE) from the previous step. Thus, green fluorescent viral spots are picked against a red fluorescent cell background. After 5 rounds of spot picking, a purified recombinant virus carrying the controllable expression of the γ34.5 chimeric gene and the green fluorescent protein reporter gene is obtained.

[0074] Applications of attenuated herpes simplex virus tracing systems include: anterograde multi-level synaptic labeling tracing of neural circuits, large-capacity gene transduction vectors, targeted gene therapy of the nervous system, analysis of viral replication and pathogenesis mechanisms, establishment of animal infection models, screening of antiviral drugs, and oncolytic therapy.

[0075] Example 1: The molecular construction process includes:

[0076] (1) Homologous arm cloning

[0077] The complete genome sequence of HSV-1H129 (GenBank: GU734772.1) was retrieved from the NCBI GenBank database to analyze the neurotoxicity gene γ34.5 and its flanking DNA sequences. The γ34.5 gene has two copies in the HSV genome, located in the terminal repeat sequences TRL and IRL of the ML long fragment, respectively. The full-length gene is 1007 bp, and the coding frame ORF is 747 bp long, as shown in SEQ ID NO.1, with a GC content as high as 80%. The two copies of the γ34.5 gene are transcribed in opposite directions, see [link to SEQ ID NO.1]. Figure 1The middle arrow indicates that the present invention designed to knock out the full-length γ34.5 gene (1007 bp), extracted and purified HSV-1H129 viral genomic DNA, and used it as a template to design primers to clone the upstream homologous arm of the γ34.5 gene (UHA, 527 bp long, GC content 80%). The primer sequences used are UHA-F: 5'CCCAAGCTTAGCCCGGGCCCCCCGCGGGC 3' (SEQ ID NO. 9); UHA-R: 5'CGGGATCCGTTAACCCATCGATGGACCGGTGGAGACAGAGAGCGTGCCGG 3' (SEQ ID NO. 10); and the downstream homologous arm (DHA, 547 bp long, GC content 66%). The primer sequence used for PCR is DHA-F: 5'CCGGAATTCATTTAAATCCTTAATTAAGGCCTGCAGGAACTTGCAAGAGGCCTTGTTC 3' (SEQ ID NO. 10). NO.11); DHA-R: 5'GCTCTAGAACCCCACGCCTTTCCCCTCC 3' (SEQ ID NO.12).

[0078] The PCR reaction volume was 50 μL, containing 50-100 ng of template DNA, 10 μL of 5×PrimeStar HS buffer, 0.7 μL each of primer 1 and primer 2 (20 μM / μL), 5 μL of dNTPs, 0.6 μL of PrimeStar HS high-fidelity enzyme, and sterile water to a final volume of 50 μL. The PCR amplification conditions were: 98℃ for 5 min, followed by 32 cycles of (98℃ for 30 s, 60℃ for 30 s, 72℃ for 1 min / kb), an extension at 72℃ for 10 min, and a final extension at 16℃ for 30 min. The cloned upstream and downstream homologous arm fragments were digested with Hind III and BamHI, and BamHI and XbaI, respectively, and then ligated into the pcDNA3.1+ vector, named pH129Δγ34.5.

[0079] (2) Construction of exogenous gene expression cassette plasmids

[0080] Using the FUGW plasmid as a template, the hUbC promoter and WPRE fragment were cloned. The cloned ubiquitin promoter fragment with NheI and KpnI restriction sites and the transcriptional enhancement element WPRE with XbaI and ApaI restriction sites were digested and ligated into the pcDNA3.1(+) vector to obtain the pcDNA3.1-hUbC-WPRE vector. The red fluorescent gene (tdTomato) fragment was cloned and ligated into the middle of hUbC and WPRE in the pcDNA3.1-hUbC-WPRE vector via KpnI and XbaI restriction sites to obtain the exogenous gene expression cassette plasmid. Restriction digestion and sequencing confirmed the correct construction. The primers and sequences used in this construction are shown in the table below.

[0081]

[0082] (3) Construction of recombinant targeting vectors carrying fluorescent gene expression cassettes

[0083] Primers were designed to PCR clone the entire expression cassette hUbC-tdTomato-WPRE-PA from the fluorescent gene expression cassette plasmid. The primers used were UT / GWPA-F: 5'AGTCCAGTGTGGTGGAATTCGCGCCGGGTTTTGGCGCCTC 3' (SEQ ID NO. 21) and UT / GWPA-R: 5'CTCTTGCAAGTTCCTGCAGGCCATAGAGCCCACCGCATCC 3' (SEQ ID NO. 22). The large fragment of the fluorescent gene expression cassette was purified by gel extraction, digested with EcoRI and SbfI, and ligated into the previously constructed targeting vector pH129Δγ34.5, which knocks out the full-length γ34.5 gene. Enzyme digestion and sequencing confirmed the successful construction of the targeting vector carrying the fluorescent gene, resulting in the recombinant targeting vector pH129Δγ34.5-hUbC-tdTomato-WPRE-PA.

[0084] (4) Expression of the controllable weakening of the γ34.5 self-degrading chimeric gene to supplement the HSV genome

[0085] Complete knockout of the double-copy ICP34.5 gene in the HSV genome significantly reduces viral virulence. However, HSV Δγ34.5 infection of mouse brain neurons results in a replication-deficient genotype, lacking transsynaptic propagation ability, making it unsuitable for transsynaptic tracing of the output loop. Therefore, a novel attenuated anterograde HSV tracing system was designed to reintroduce a controllable expression γ34.5 gene to its original genomic locus. By introducing the eukaryotic degradation sequence PEST, the expressed ICP34.5 protein was self-degraded, thus maintaining ICP34.5 at a consistently low expression level. This limited viral replication rate while ensuring a significant reduction in viral virulence, thereby constructing a novel attenuated anterograde HSV tracing system.

[0086] The specific construction process is as follows: First, the functional domain involved in autophagy in the γ34.5 gene (γ34.5d20, sequence shown in SEQ ID NO.2) was knocked out. Then, a highly efficient degradation sequence specific to eukaryotic cells, PEST (sequence shown in SEQ ID NO.4), was introduced after the γ34.5d20 gene via a flexible strand (6GGGGS, sequence shown in SEQ ID NO.3). To controllably knock out the degradation PEST gene sequence, a tobacco mosaic virus-specific cleavage site, TEV site (derived from the 7-amino acid cleavage sequence Glu-Asn-Leu-Tyr-Phe-Gln-Gly of tobacco mosaic virus, which can be specifically recognized by TEV protease and cleaved into the fusion protein (Gln-Gly is the cleavage site), sequence shown in SEQ ID NO.5), was designed to be inserted at the 3' end of the γ34.5 gene (γ34.5-3'UTR, sequence shown in SEQ ID NO.4). As shown in NO.6, the overall complemented expression of the γ34.5 gene is controlled and weakened as γ34.5d20-6GGGGS-TEVsite-PEST-3'UTR, and the complete sequence is shown in SEQ ID NO.7.

[0087] To achieve the purposes of tracing and screening, the complemented genome also contains fluorescent proteins and internal ribosome entry sites. In this invention, to facilitate HSV virus recombination spot picking, firstly, a recombinant HSV H129Δγ34.5-hUbC-tdTomato-WPRE expressing red fluorescent protein is constructed and purified by spot picking; secondly, a long coding frame (EGFP-IRES-γ34.5d20-TEVsite-PEST, sequence shown in SEQ ID NO.8) is constructed, linking the green fluorescent protein gene with the IRES sequence and the γ34.5 recombinant chimeric gene (γ34.5d20-TEVsite-PEST); through homologous recombination, the long coding frame (EGFP-IRES-γ34.5d20-TEVsite-PEST) replaces the red fluorescent protein gene expression frame (hUbC-tdTomato-WPRE) from the previous step. Thus, green fluorescent viral spots are picked against a red fluorescent cell background. After 5 rounds of spot picking, a purified recombinant virus carrying the controllable expression of the γ34.5 chimeric gene and the green fluorescent protein reporter gene is obtained. The gene with added fluorescent protein is EGFP-IRES-34.5d20-6GGGGS-TEVsite-PEST-3'UTR, and its sequence is shown in SEQ ID NO.8.

[0088] Example 2: Preparation of low-virulence herpes simplex virus by recombination, spot purification and amplification

[0089] ① Viral recombination: The targeting vector pH129Δγ34.5-hUbC-tdTomato-WPRE was extracted and transfected into 293T cells using liposome transfection. Six hours later, the maintenance medium containing 2% FBS was replaced and herpes simplex virus strain H129 was added for infection. The expression of fluorescence and cytopathic effects were observed at different time points. After all cells showed cytopathic effects, the cell culture supernatant was collected and stored at -80°C.

[0090] ② Virus purification: The collected viral supernatant was subjected to three freeze-thaw cycles and centrifuged at 6500g for 10 minutes to remove cell debris. 10 μL of the viral supernatant was used to infect Vero cells. One day later, the presence of fluorescent expression in the infected cells was observed to determine if the novel virus recombination was successful. Later, the recombinant viral supernatant was serially diluted 10-fold and used to infect Vero cells. After adsorption for 1 hour, the cells were plated on agar (a 1:1 mixture of DMEM medium containing 5% fetal bovine serum and 2% agar). After 48-72 hours, once viral plaques formed, they were picked under an inverted fluorescence microscope. The novel recombinant virus underwent approximately six rounds of plaque-picking purification to remove the wild-type virus, yielding the purified novel recombinant virus H129Δγ34.5-hUbC-tdTomato-WPRE. The recombination, plaque-picking purification, and fluorescent expression of the low-virulence herpes simplex virus are shown in [the original text]. Figure 1 As can be seen, cells infected with low-toxicity HSVLT showed very bright fluorescence expression.

[0091] Example 3: Molecular identification of attenuated herpes simplex virus genome

[0092] Concentrated and purified wild-type H129 and low-virulence HSV (H129Δγ34.5-hUbC-tdTomato-WPRE) virus were inactivated at 100℃ for 10 minutes for subsequent molecular identification of the γ34.5 gene. Primers were designed using the 747bp ORF fragment of γ34.5. The primers and sequences used for identification were γ34.5-F: 5'ATGGCCCGCCGCCGCCGCCGCCATCGCGGCCCCCGCCGCCCCCGG 3' (SEQ ID NO.23); γ34.5-R: 5'TTAGACCGAGTTCGCCGGGCCGGCTCCGCGGGCCAGGGCCCGGGC 3' (SEQ ID NO.24). Because the GC content of the γ34.5 gene is as high as 82%, a high GC buffer system was selected to amplify the γ34.5 ORF: The PCR reaction volume was 50 μL, including 1-5 μL of inactivated HSV virus sample, 25 μL of 2×PrimeStar high-GC buffer, 0.7 μL each of 20 μM / μL primer 1 and primer 2, 5 μL of dNTPs, 0.6 μL of Prime Star HS high-fidelity enzyme, and sterile water to a final volume of 50 μL. The PCR amplification conditions were: 98℃ for 5 min, (98℃ for 30 s, 60℃ for 30 s, 72℃ for 1 min) for 32 cycles, followed by an extension at 72℃ for 10 min and then at 16℃ for 30 min. Molecular identification results are as follows. Figure 3 As shown, the negative control showed no band; the concentrated wild-type H129 virus amplified a target band of about 700 bp by PCR; while the low-virulence HSV (H129Δγ34.5-hUbC-tdTomato-WPRE) failed to amplify a target band of about 700 bp in repeated experiments regardless of whether 1 μL, 3 μL, or 5 μL of concentrated virus was used for PCR. The results indicate that the double copy of the γ34.5 gene in the genome of low-virulence H129Δγ34.5-hUbC-tdTomato-WPRE has been completely knocked out.

[0093] However, based on the inventors' previous research results, the attenuated herpes simplex virus after knocking out the double-copy γ34.5 gene is a replication defective type and lacks the ability to spread across synapses, so it cannot be used for cross-synaptic tracing of the output loop.

[0094] Example 4: Recombinant and Spot-picked Purification of Attenuated Herpes Simplex Virus with γ34.5 Self-Degrading Chimeric Gene Replacement

[0095] ① Viral recombination: The targeting vector pH129Δγ34.5-EGFP-IRES-γ34.5d20-TEVsite-PEST-3'UTR plasmid was extracted and transfected into 293T cells using liposome transfection. Six hours later, the medium was replaced with maintenance medium containing 2% FBS and herpes simplex virus H129Δγ34.5-hUbC-tdTomato-WPRE virus was added for infection. Fluorescence expression and cytopathic effects were observed at different time points. After all cells showed cytopathic effects, the cell culture supernatant was collected and stored at -80℃.

[0096] ② Virus purification: The collected viral supernatant was subjected to three freeze-thaw cycles and centrifuged at 6500g for 10 minutes to remove cell debris. 10 μL of the viral supernatant was used to infect Vero cells. One day later, the presence of green fluorescence against a red fluorescent background was observed to determine whether the novel virus had successfully recombined. Later, the supernatant of the successfully recombined virus was serially diluted 10-fold and used to infect Vero cells. After adsorption for 1 hour, the cells were plated on agar (a 1:1 mixture of DMEM medium containing 5% fetal bovine serum and 2% agar). After 48-72 hours, once viral plaques formed, they were picked under an inverted fluorescence microscope. The novel recombinant virus underwent five rounds of plaque picking purification to remove the parent virus, yielding the purified novel recombinant virus H129Δγ34.5-EGFP-IRES-γ34.5d20-TEVsite-PEST-3'UTR.

[0097] Example 5: Amplification and preparation of novel attenuated, replicating HSV recombinant virus

[0098] The purified H129Δγ34.5-EGFP-IRES-γ34.5d20-TEVsite-PEST-3'UTR recombinant oncolytic virus was mass-produced and purified by infecting Vero cells grown on 10cm plates. Recombinant virus was used to infect Vero cells at an MOI of 0.01. After the cells developed obvious rounding lesions (approximately 3 days), the supernatant containing the recombinant virus was collected into 50 mL centrifuge tubes. Cell debris was removed by centrifugation (6400 rpm, 10 min). The supernatant was filtered through a 0.22 μm filter and then concentrated using a Beckman centrifuge (30000 rpm, 3 h). The concentrated recombinant virus pellet was resuspended in a small amount of PBS (pH = 7.4) and incubated overnight at 4°C with constant shaking. On the second day, the virus solution was mixed, and the resuspended recombinant virus solution was added to the supernatant of 20% sucrose solution and ultracentrifuged (30000 rpm, 3 h) for concentration and purification. Finally, the dissolved virus was aliquoted and stored at -80°C. The titer of the concentrated HSV recombinant virus was determined using a standard plaque assay with Vero cells, expressed as plaque-forming units per milliliter (PFU / mL). The titer of the concentrated recombinant virus H129Δγ34.5-EGFP-IRES-γ34.5d20-TEVsite-PEST-3'UTR was determined to be approximately 2 × 10⁻⁶. 9 PFU / mL.

[0099] Example 6: Effective tracing of attenuated, replicating herpes simplex virus using a motor cortex (M1) output neural network

[0100] The prepared low-virulence, replicating HSV tool virus H129Δγ34.5-EGFP-IRES-γ34.5d20-TEVsite-PEST-3'UTR expressing green fluorescence was used for in vivo animal testing. 200 nmol of the prepared H129Δγ34.5-EGFP-IRES-γ34.5d20-TEVsite-PEST-3'UTR (virus titer 2 × 10⁻⁶) was accurately measured. 9 PFU / mL was stereotactically injected into the primary motor cortex (M1) of C57BL / 6 mice. Mice were observed daily until infection symptoms were observed. After 14 days of infection, the animals were anesthetized and perfused with 0.9% (v / v) physiological saline, followed by perfusion with 4% (v / v) paraformaldehyde. Brain tissue was removed and immersed in 4% (v / v) paraformaldehyde solution, then placed in 20% (v / v) sucrose solution for 1 day, followed by 30% (v / v) sucrose solution for 2 days. Before sectioning, the bottom of the brain tissue was cut flat, embedded in a base, frozen for 1 hour, and then sectioned. Brain slices were observed under a fluorescence microscope.

[0101] Mice infected with wild-type H129 showed symptoms on the second day and generally died within 5 days; while mice infected with attenuated, replicating herpes simplex virus showed no obvious symptoms and remained in good condition. After 14 days, mouse sections were perfused and imaged using a slide scanner. Results were as follows... Figure 6 As shown, the attenuated, replicating HSV H129 tool virus exhibited good labeling effects. Green fluorescently labeled neurons were observed at the cortical injection site, the contralateral M1 brain region, and multiple downstream output brain regions (ipsilateral thalamic VPM, contralateral thalamic VPM, etc.), with clearly visible neuronal cell bodies and fibers. These experimental results differ from previous results using the H129Δγ34.5-hUbC-tdTomato-WPRE virus. Our previous study found that the attenuated strain with complete knockout of the γ34.5 double-copy gene (H129Δγ34.5-hUbC-tdTomato-WPRE) infected mouse brain neurons were replication-deficient, did not spread across synapses, and only infected and retrolabeled upstream brain regions through axonal uptake, while no fluorescent labeling was observed in the downstream output brain regions. In this invention, the attenuated and controllable replication H129Δγ34.5-EGFP-IRES-γ34.5d20-TEVsite-PEST-3'UTR is labeled into different brain regions, and the downstream brain regions projected by M1 are effectively fluorescently labeled. Therefore, the recombinant HSV virus constructed in this invention is a controllable replication attenuated virus, suitable for long-term, anterograde neural circuit tracing across multiple synapses. At the same time, it can also serve as a gene transduction vector for long-term high expression of target genes, and has broad application value in targeted gene therapy of the nervous system, oncolytic virus vectors, analysis of viral replication and pathogenesis mechanisms, and establishment of animal infection models. SEQUENCE LISTING <110> Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences <120> A forward-biased HSV tracer system with attenuation and controllable replication, its construction method, and its application. <130> CP121011354C <160> twenty four <170> PatentIn version 3.3 <210> 1 <211> 747 <212> DNA <213> Artificial sequence <400> 1 atggcccgcc gccgccgcca tcgcggcccc cgccgccccc ggccgcccgg gcccacgggc 60 gccgtcccaa ccgcacagtc ccaggtaacc tccacgccca actcggaacc cgcggtcagg 120 agcgcgcccg cggccgcccc gccgccgccc cccgccggtg ggcccccgcc ttcttgttcg 180 ctgctgctgc gccagtggct ccacgttccc gagtccgcgt ccgacgacga cgatgacgac 240 gactggccgg acagcccccc gcccgagccg gcgccagagg cccggcccac cgccgccgcc 300 ccccggcccc ggcccccacc gcccggcgtg ggcccggggg gcggggctga cccctcccac 360 cccccctcgc gccccttccg ccttccgccg cgcctcgccc tccgcctgcg cgtcaccgcg 420 gagcacctgg cgcgcctgcg cctgcgacgc gcgggcgggg agggggcgcc ggagcccccc 480 gcgacccccg cgacccccgc gacccccgcg acccccgcga cccccgcgcg ggtgcgcttc 540 tcgccccacg tccgggtgcg ccacctggtg gtctgggcct cggccgcccg cctggcgcgc 600 cgcggctcgt gggcccgcga gcgggccgac cgggctcggt tccggcgccg ggtggcggag 660 gccgaggcgg tcatcgggcc gtgcctgggg cccgaggccc gtgcccgggc cctggcccgc 720 ggagccggcc cggcgaactc ggtctaa 747 <210> 2 <211> 663 <212> DNA <213> Artificial Sequence <400> 2 atggcccgcc gccgccgccg ccatcgcggc ccccgccgcc cccggccgcc cgggcccacg 60 ggcgcggtcc caaccgcaca gtcccaggta acctccacgc ccaactcgga acccgtggtc 120 aggagcgcgc ccgcggccgc cccgccgccg ccccccgccg gtgggccccc gccttcttgt 180 tcgctgctgc tgcgccagtg gctccccgag ccggcgccag acgcccggcc caccgccgcc 240 gccccccgcc cccggtcccc accgcccggc gcgggcccgg ggggcggggc taacccctcc 300 caccccccct cacgcccctt ccgccttccg ccgcgcctcg ccctccgcct gcgcgtcacc 360 gcagagcacc tggcgcgcct gcgacgcgcg ggcggggagg gggcgccgga gccccccgcg 420 acccccgcga cccccgcgac ccccgcgcgg gtgcgcttct cgccccacgt ccgggtgcgc 480 cacctggtgg tctgggcctc ggccgcccgc ctggcgcgcc gcggctcgtg ggcccgcgag 540 cgggccgacc gggctcggtt ccggcgccgg gtggcggagg ccgaggcggt catcgggccg 600 tgcctggggc ccgaggcccg tgcccgggcc ctggcccgcg gagccggccc ggcgaactcg 660 gtc 663 <210> 3 <211> 45 <212> DNA <213> The snowstorm <400> 3 ggtggcggtg gctcggggcgg tggtggggtcg ggtggcggcg gatct <210> 4 <211> 132 <212> DNA <213> The snowstorm <400> 4 ggatccggta gccatggctt cccgccggag gtggaggagc aggatgg cacgctgccc 60 atgtcttgtg cccaggagag cgggatggac cgtcaccctg cagcctgtgc ttctgctagg 120 atcaatgtgt aa <210> 5 <211> 21 <212> DNA <213> The snowstorm <400> 5 gagaacctct acttccaatc g <210> 6 <211> 289 <212> DNA <213> The snowstorm <400> 6 cgttacaccc gaggcggcct gggtcttccg cggagctccc gggagctccg caccaagccg ctctccggag agacgatggc aggagccgcg catatatacg ctggggagccg gcccgccccc 120 aaggcgggcc cgccctcgga gggcgggact ggccaatcgg cggccgccag cgcggcgggg 180 cccggccaac cagcgtttgc cgagtcttcg gggcccggcc cactgggcgg taactcccgc 240 ccagtgggcc gggccgccca cttcccggta tggtaattaa acctgcagg 289 <210> 7 <211> 1168 <212> DNA <213> Artificial Sequence <400> 7 atggccacaa ccatggcccg ccgccgccgc cgccatcgcg gcccccgccg cccccggccg 60 cccgggccca cgggcgcggt cccaaccgca cagtcccagg taacctccac gcccaactcg 120 gaacccgtgg tcaggagcgc gcccgcggcc gccccgccgc cgccccccgc cggtgggccc 180 ccgccttctt gttcgctgct gctgcgccag tggctccccg agccggcgcc agacgcccgg 240 cccaccgccg ccgccccccg cccccggtcc ccaccgcccg gcgcgggccc ggggggcggg 300 gctaacccct cccacccccc ctcacgcccc ttccgccttc cgccgcgcct cgccctccgc 360 ctgcgcgtca ccgcagagca cctggcgcgc ctgcgacgcg cgggcgggga gggggcgccg 420 gagccccccg cgacccccgc gacccccgcg acccccgcgc gggtgcgctt ctcgccccac 480 gtccgggtgc gccacctggt ggtctgggcc tcggccgccc gcctggcgcg ccgcggctcg 540 tgggcccgcg agcggccga ccggggctcgg ttccggcgcc gggtggcgga ggccgaggcg 600 gtcatcgggc cgtgcctggg gcccgaggcc cgtgcccggg ccctggcccg cggagccggc 660 ccggcgaact cggtcggtgg cggtggctcg ggcggtggtg ggcgggtgg cggcggatct 720 gaattcgaga acctctactt ccaatcgggga tccggtagcc atggcttccc gccggaggtg 780 gaggagcagg atgatggcac gctgcccatg tcttgtgccc gaggagcgg gatggaccgt 840 caccctgcag cctgtgcttc tgctaggatc aatgtgtac gttacacccg aggcggcctg 900. ggtcttccgc ggagctccgc ggagctccgc accaagccgc tctccggaga gacgatggca 960 ggagccgcgc fathercgc tgggagccgg cccgccccca aggcggccc gccctcggag 1020 ggcgggactg gccaatcggc ggccgccagc gcggcggggc ccggccaacc agcgtttgcc 1080 gagtcttcgg ggcccggccc actgggcggt aactcccgcc cagtggggccg ggccgcccac 1140 ttcccggtat ggtaattaa cctgcagg <210> 8 <211> 2446 <212> DNA <213> The snowstorm <400> 8 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60 ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120 ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180 ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240 cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300 ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360 gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420 aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480 ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540 gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600 tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660 ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa 720 atcgatacgt tactggccga agccgcttgg aataaggccg gtgtgcgttt gtctatatgt 780 tattttccac catattgccg tcttttggca atgtgagggc ccggaaacct ggccctgtct 840 tcttgacgag cattcctagg ggtctttccc ctctcgccaa aggaatgcaa ggtctgttga 900 atgtcgtgaa ggaagcagtt cctctggaag cttcttgaag acaaacaacg tctgtagcga 960 ccctttgcag gcagcggaac ccccacctg gcgacaggtg cctctgcggc caaaagccac 1020 gtgtataaga tacacctgca aaggcggcac aaccccagtg ccacgttgtg agttggatag 1080 ttgtggaaag agtcaaatgg ctctcctcaa gcgtattcaa caagggggct aggatgccc 1140 agaaggtacc ccattgtatg ggatctgatc tggggcctcg gtgcacatgc tttacatgtg 1200 tttagtcgag gttaaaaaaa cgtcttaggcc ccccgaacca cggggacgtg gttttccttt 1260 gaaaaaacg atgataatat ggccacaacc atggcccgcc gccgccgccg ccatcgcggc 1320 ccccgccgcc cccggccgcc cgggcccacg ggcgcggtcc caaccgcaca gtcccaggta 1380 acctccacgc ccaactcgga acccgtggtc aggagcgcgc ccgcggccgc cccgccgccg 1440 ccccccgccg gtgggccccc gccttcttgt tcgctgctgc tgcgccagtg gctccccgag 1500 ccggcgccag acgcccggcc caccgccgcc gccccccgcc cccggtcccc accgcccggc 1560 gcgggcccgg ggggcggggc taacccctcc caccccccct cacgcccctt ccgccttccg 1620 ccgcgcctcg ccctccgcct gcgcgtcacc gcagagcacc tggcgcgcct gcgacgcgcg 1680 ggcggggagg gggcgccgga gccccccgcg acccccgcga cccccgcgac ccccgcgcgg 1740 gtgcgcttct cgccccacgt ccgggtgcgc cacctggtgg tctgggcctc ggccgcccgc 1800 ctggcgcgcc gcggctcgtg ggcccgcgag cgggccgacc gggctcggtt ccggcgccgg 1860 gtggcggagg ccgaggcggt catcgggccg tgcctggggc ccgaggcccg tgcccgggcc 1920 ctggcccgcg gagccggccc ggcgaactcg gtcggtggcg gtggctcggg cggtggtggg 1980 tcgggtggcg gcggatctga attcgagaac ctctacttcc aatcgggatc cggtagccat 2040 ggcttcccgc cggaggtgga ggagcaggat gatggcacgc tgcccatgtc ttgtgcccag 2100 gagagcggga tggaccgtca ccctgcagcc tgtgcttctg ctaggatcaa tgtgtaacgt 2160 tacacccgag gcggcctggg tcttccgcgg agctcccggg agctccgcac caagccgctc 2220 tccggagaga cgatggcagg agccgcgcat atatacgctg ggagccggcc cgcccccaag 2280 gcgggcccgc cctcggaggg cgggactggc caatcggcgg ccgccagcgc ggcggggccc 2340 ggccaaccag cgtttgccga gtcttcgggg cccggcccac tgggcggtaa ctcccgccca 2400 gtgggccggg ccgcccactt cccggtatgg taattaaacc tgcagg 2446 <210> 9 <211> 29 <212> DNA <213> Artificial sequence <400> 9 cccaagctta gcccgggccc cccgcgggc 29 <210> 10 <211> 50 <212> DNA <213> Artificial sequence <400> 10 cgggatccgt taacccatcg atggaccggt ggagacagag agcgtgccgg 50 <210> 11 <211> 58 <212> DNA <213> Artificial sequence <400> 11 ccggaattca tttaaatcct taattaaggc ctgcaggaac ttgcaagagg ccttgttc 58 <210> 12 <211> 28 <212> DNA <213> Artificial sequence <400> 12 gctctagaac cccacgcctt tcccctcc 28 <210> 13 <211> 34 <212> DNA <213> Artificial sequence <400> 13 ctagctagcg cgccgggttt tggcgcctcc cgcg 34 <210> 14 <211> 34 <212> DNA <213> Artificial sequence <400> 14 cggggtaccg tctaacaaaa aagccaaaaa cggc 34 <210> 15 <211> 35 <212> DNA <213> Artificial sequence <400> 15 tgctctagaa atcaacctct ggattacaaa atttg 35 <210> 16 <211> 36 <212> DNA <213> Artificial sequence <400> 16 aaagggccct gcggggaggc ggcccaaagg gagatc 36 <210> 17 <211> 31 <212> DNA <213> Artificial sequence <400> 17 ataggtacca tggtgagcaa gggcgaggag g 31 <210> 18 <211> 34 <212> DNA <213> Artificial sequence <400> 18 cgctctagat tacttgtaca gctcgtccat gccg 34 <210> 19 <211> 40 <212> DNA <213> Artificial sequence <400> 19 agtccagtgt ggtggaattc gcgccgggtt ttggcgcctc 40 <210> 20 <211> 40 <212> DNA <213> Artificial sequence <400> 20 ctcttgcaag ttcctgcagg ccatagagcc caccgcatcc 40 <210> twenty one <211> 40 <212> DNA <213> Artificial sequence <400> twenty one agtccagtgt ggtggaattc gcgccgggtt ttggcgcctc 40 <210> twenty two <211> 40 <212> DNA <213> Artificial sequence <400> twenty two ctcttgcaag ttcctgcagg ccatagagcc caccgcatcc 40 <210> twenty three <211> 45 <212> DNA <213> Artificial sequence <400> twenty three atggcccgcc gccgccgccg ccatcgcggc ccccgccgcc cccgg 45 <210> twenty four <211> 45 <212> DNA <213> Artificial sequence <400> twenty four ttagaccgag ttcgccgggc cggctccgcg ggccagggcc cgggc 45

Claims

1. A recombinant herpes simplex virus type 1 that crosses the synapse, characterized in that, The recombinant herpes simplex virus type 1 is completely knocked out of two copies of the gene encoding the neurovirulence factor γ34.5 in the genome of the H129 strain, and then a controllable γ34.5 self-degradation recombinant gene is back-supplemented into the original gene site of γ34.

5. The sequence of the controllable γ34.5 self-degradation recombinant gene is shown in SEQ ID NO.

7.

2. The recombinant herpes simplex virus type 1 of claim 1, characterized in that, The controllable γ34.5 self-degradation recombinant gene further comprises a gene encoding a reporter protein.

3. The recombinant herpes simplex virus type 1 of claim 2, wherein, The reporter protein is selected from fluorescent proteins and luminescent proteins.

4. The recombinant herpes simplex virus type 1 of claim 3, wherein, The fluorescent protein is selected from GFP, EGFP, Emerald, Citrine, Venus, mOrange, mCherry, TagBFP, mTurquoise, Cerulean, UnaG, dsRed, eqFP611, Dronpa, RFP, TagRFP, TdTomato, KFP, EosFP, Dendra, IrisFP, iRFP, and smURFP; and the luminescent protein is selected from luciferase.

5. The recombinant herpes simplex virus type 1 of claim 1, wherein, The controllable γ34.5 self-degradation recombinant gene further comprises an internal ribosome entry site.

6. The recombinant herpes simplex virus type 1 of claim 5, characterized in that, The complete sequence of the controllable γ34.5 self-degradation recombinant gene tandem fluorescent protein reporter gene is shown in SEQ ID NO.

8.

7. Use of the recombinant herpes simplex virus type 1 according to any one of claims 1-6 in the preparation of a neurocircuit anterograde trans-multisynaptic tracer.

8. A method of anterograde trans-multisynaptic labeling of neural circuits, characterized in that, The method comprises injecting the recombinant herpes simplex virus type 1 according to any one of claims 1-6 into a target region.

9. The method of claim 8, wherein, The target region is selected from a brain region of a subject or other target tissue or organ.

10. The method of claim 9, wherein, The subject is selected from various experimental animals.

11. A method of producing a recombinant herpes simplex virus type 1 across synapses according to any one of claims 1 to 6, characterized in that, The preparation method comprises the following steps: S1) preparing a herpes simplex virus type 1 in which two copies of the gene encoding the neurovirulence factor γ34.5 are knocked out; S2) preparing a targeting vector for an exogenous gene expression cassette for back-supplementing the HSV gene with the recombinant γ34.5 gene; S3) recombining the targeting vector obtained in step S2) and the herpes simplex virus type 1 in which two copies of the gene encoding the neurovirulence factor γ34.5 are knocked out obtained in step S1) after being co-transfected into cells, and obtaining the above-mentioned trans-synaptic recombinant herpes simplex virus type 1 after purification by picking plaques; In step S2), the exogenous gene expression cassette in the targeting vector comprises the sequence of the controllable γ34.5 self-degradation recombinant gene shown in SEQ ID NO. 7.

Citation Information

Patent Citations

  • Low-toxic herpes simplex virus system and construction method and application thereof

    CN110117577A

  • Self-Inactivating Viral Vector

    US20210115472A1