A β-1,3-glucanase, its preparation method and application
By modifying the endo-β-1,3-glucanase CcGluE-CDMΔH1 of fibrotic strains, the problems of high cost and low product DP in the preparation of β-1,3-glucan oligosaccharides in the existing technology have been solved, realizing the efficient and environmentally friendly production of high-DP oligosaccharides and expanding the application fields.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-12-13
- Publication Date
- 2026-03-10
AI Technical Summary
In existing technologies, chemical methods for preparing β-1,3-glucosinolates are costly, require sophisticated equipment, and cause significant environmental damage, while enzymatic methods produce β-1,3-glucosinolate products with low DP (potentially soluble solids) and low activity to branched substrates, making it difficult to meet industrial demands.
This invention provides a gene encoding β-1,3-glucanase CcGluE-CDMΔH1 and its recombinant expression method. By modifying the endogenous β-1,3-glucanase gluE of fibrotic fibrous strains, cloning it into a recombinant expression vector, and expressing it in host cells, the invention achieves efficient hydrolysis of cytosine and generates high-DP oligosaccharides.
This technology enables efficient hydrolysis of cytosine to produce high-DP oligosaccharides, reducing production costs and expanding its application range to include agriculture, food, feed additives, and pharmaceuticals.
Smart Images

Figure CN116262925B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology, and particularly relates to an endo-beta-1,3-glucanase as well as a preparation method and application thereof; the present application provides a recombinant plasmid and a recombinant genetically engineered strain of the endo-beta-1,3-glucanase and application thereof in polysaccharide degradation and oligosaccharide preparation; the endo-beta-1,3-glucanase provided by the present application can be widely applied in the fields of agriculture, food, feed additive, medicine and oligosaccharide preparation. BACKGROUND
[0002] Beta-glucan is a common polysaccharide in nature, and is widely distributed in animals, plants, fungi and bacteria. Common beta-1,3-glucans include zymosan, laminarin, curdlan, lentinan and schizophyllan. Laminarin and curdlan are two common types. Curdlan is a linear monosaccharide connected by beta-1,3, and is insoluble in water, and is a good food additive and gelling agent. Laminarin is connected by beta-1,3 and a small amount of beta-1,6 branched chains, and is an energy storage material of seaweed, and the beta-1,6 branched chains improve the solubility of beta-glucan.
[0003] In recent years, the biological activity of beta-1,3-glucan has attracted much attention. As of 2021, there were 11834 articles published on Scopus (http: / / www.scopus.com) with "beta-glucan" in the title, abstract and keywords. Studies have shown that the degree of polymerization, branching degree and other properties of beta-glucan can affect the way in which the sugar interacts with its receptors (especially Dectin-1). Adams et al. studied the effect of molecular weight and branching degree on the binding of glucan to Dectin-1, and found that the presence of 1,6 branched chains significantly improved its affinity to the receptor. In terms of molecular weight, Elizabeth et al. found that heptose is the smallest recognition unit of human glucan pattern recognition receptors, and the addition of pentose and hexose does not compete for binding. Li et al. verified that high-polymerization-degree curdlan oligosaccharide induced stronger plant immunity than low-polymerization-degree curdlan, and even a change of 1 in DP had a significant impact on the activity.
[0004] In summary, branched β-1,3-glucan with high DP has better biological activity. There are two main ways to obtain β-1,3-glucan at present, chemical method and enzymatic method. Currently, the commercial glucan is mainly degraded by chemical method, and then separated by HPAEC-PAD. High temperature, high pressure, strong acid and strong alkali are required for the equipment, which is harmful to the environment, and the yield is not high, the steps are complex, so the unit price is very expensive, usually sold in mg. Taking 1,3 glucan as an example, its market price is as high as 2065.5 yuan / 50mg, equivalent to 41.31 yuan per milligram. The oligosaccharide with high DP is difficult to find in the market because of its lower yield, stronger activity and lower purification efficiency. The product with DP of octasaccharide and above is few, and the domestic fiber octasaccharide even reaches 5088 yuan / 5mg. Enzymatic preparation of β-1,3-glucan is a relatively mild and environmentally friendly method, but the commercial enzyme has the disadvantages of low degradation product DP and low activity on branched substrate. SUMMARY
[0005] To solve the technical problems described in the background art, the purpose of the present application is to provide a β-1,3-glucanase and its preparation method and application.
[0006] The purpose of the present application is achieved by the following means:
[0007] The first purpose of the present application is to provide a β-1,3-glucanase CcGluE-CDMΔH1 coding gene, which has one of the following characteristics:
[0008] 1) The deoxyribonucleic acid (DNA) sequence shown in SEQ ID NO. 1 in the sequence listing;
[0009] 2) The deoxyribonucleic acid (DNA) sequence encoding the amino acid sequence of SEQ ID NO. 2 in the sequence listing;
[0010] 3) The deoxyribonucleic acid (DNA) sequence with homology of more than 80% to the deoxyribonucleic acid (DNA) sequence defined by SEQ ID NO. 1, and capable of encoding a protein with endo-β-1,3-glucanase activity;
[0011] 4) The deoxyribonucleic acid (DNA) sequence obtained by one or more than two nucleotide substitutions, deletions or additions to the deoxyribonucleic acid (DNA) sequence of SEQ ID NO. 1 in the sequence listing, which is capable of encoding a protein with endo-β-1,3-glucanase activity.
[0012] The second purpose of the present application is to provide a β-1,3-glucanase GluE-CDMΔH1, which has one of the following characteristics:
[0013] 1) the amino acid sequence shown as SEQ ID NO. 2 in the sequence listing;
[0014] 2) an amino acid sequence having endo-beta-1,3-glucanase activity formed by one or more than two amino acid substitutions, deletions or additions to the amino acid sequence shown as SEQ ID NO. 2 in the sequence listing.
[0015] A third object of the present application is to provide a method for preparing the above-mentioned β-1,3-glucanase GluE-CDMΔH1, which comprises cloning the gene GluE-CDMΔH1 into a recombinant expression vector, introducing the vector into a host cell, and obtaining the recombinantly expressed endo-beta-1,3-glucanase.
[0016] Further, the recombinant expression vector is selected from the group consisting of an E. coli expression vector, a yeast expression vector, a B. subtilis expression vector, a lactic acid bacteria expression vector, a Streptomyces expression vector, a phage vector, a filamentous fungus expression vector, a plant expression vector, an insect expression vector, or a mammalian cell expression vector.
[0017] Further, the host cell is a recombinant bacterium and a transgenic cell line, including an E. coli host cell, a yeast host cell, a B. subtilis host cell, a lactic acid bacteria host cell, an actinomycete host cell, a filamentous fungus host cell, an insect cell, or a mammalian cell.
[0018] Further, the host cell is selected from the group consisting of Escherichia coli BL21, Escherichia coli JM109, Escherichia coli DH5α, Saccharomyces cerevisiae, Pichia pastoris, Kluyveromyces lactis, Bacillus subtilis R25, Bacillus subtilis 9920, Lactic acid bacteria COCC101, Streptomyces spp., Trichoderma viride, Trichoderma reesei, Aspergillus niger, Aspergillus nidulans, Bombyx mori, Antharaea eucalypti, Chinese hamster ovary cell CHO, baby hamster kidney cell BHK, and Chinese hamster lung cell CHL.
[0019] The present application also provides the use of the above-mentioned β-1,3-glucanase CcGluE-CDMΔH1 in polysaccharide degradation and oligosaccharide preparation.
[0020] Further, the polysaccharide includes Codium fragile polysaccharide and laminarin.
[0021] Further, the degree of polymerization of the product is regulated by changing the pH of the reaction system to produce oligosaccharide products with different activities.
[0022] Further, the oligosaccharide includes disaccharide, trisaccharide, tetrasaccharide, pentasaccharide and hexasaccharide.
[0023] The present application has the following beneficial effects relative to the prior art:
[0024] 1. Most of the currently reported β-1, 3-glucanases have hydrolysis activity on laminarin, but have weak hydrolysis ability on Codium fragile polysaccharide. The endo-β-1, 3-glucanase CcGluE-CDMΔH1 provided in the present application has significantly higher hydrolysis ability on Codium fragile polysaccharide than on laminarin, and solves the problem of high production cost of existing β-1, 3-glucanase, and has important practical value and can be applied to large-scale industrial production.
[0025] 2. The endo-β-1, 3-glucanase CcGluE-CDMΔH1 provided in the present application produces products with different degrees of polymerization at different pH when degrading Codium fragile polysaccharide, but the degree of polymerization of the products is higher than that of the wild enzyme.
[0026] 3. The endo-β-1, 3-glucanase CcGluE-CDMΔH1 of the present application can be widely applied in the fields of agriculture, food, feed additive, medicine and preparation of glucosan. BRIEF DESCRIPTION OF DRAWINGS
[0027] In order to more clearly illustrate the embodiments of the present application, the drawings involved in the embodiments will be briefly introduced below.
[0028] Figure 1 : Agarose gel electrophoresis detection of endo-β-1, 3-glucanase gene CcGluE-CDMΔH1
[0029] Figure 2: SDS-PAGE of CcGluE-CDMΔH1(A) and gluE(B) expression and purification; A: each lane of sample added is: lane 6 - E. coli BL21(DE3) / pET28a-GluE-CDMΔH1 induced bacterial supernatant; lane 5 - flow-through during purification; lane 4 - GluE-CDMΔH1 20mM imidazole elution, lane 3 - GluE-CDMΔH1 40mM imidazole elution, lane 2 - GluE-CDMΔH1 200mM imidazole elution, i.e. purified protein, lane 1 - pre-stained protein molecular weight marker; B: each lane of sample added is: lane 1 - E. coli BL21(DE3) / pET28a-gluE uninduced bacterial pellet; lane 2 - E. coli BL21(DE3) / pET28a-gluE induced bacterial pellet; lane 3 - pre-stained protein molecular weight marker; lane 4 - gluE purified protein.
[0030] Figure 3 : Effect curve of pH value on endo-β-1, 3-glucanase CcGluE-CDMΔH1.
[0031] Figure 4 : Effect curve of temperature on endo-β-1, 3-glucanase CcGluE-CDMΔH1.
[0032] Figure 5 : CcGluE-CDMΔH1 degradation Curdlan product difference under different pH conditions.
[0033] Figure 6 : CcGluE-CDMΔH1 degradation laminarhexose product diagram.
[0034] Figure 7 : CcGluE-CDMΔH1 Tm under different pH. DETAILED DESCRIPTION
[0035] The application will be described in detail below with reference to the embodiments. However, the embodiments of the application are not limited thereto, and it is obvious that the embodiments described below are only part of the embodiments of the application, and other similar embodiments obtained by those skilled in the art without creative labor fall within the protection scope of the application.
[0036] Example 1 Cloning of endo-β-1, 3-glucanase full-length gene
[0037] The gene sequence of the endo-beta-1,3-glucanase CcGluE-CDMΔH1 of the present application is obtained by PCR technique from the endo-beta-1,3-glucanase gluE encoding gene (named as gluE) in Cellulosimicrobium cellulans, and then the carbohydrate binding domain and Ser144-Ser147 are removed by RF cloning. The coding region of the gene is 726 bp, belonging to polysaccharide lyase family 16.
[0038] The obtained π-helix rear part gene of ccgluE is used as a template, 246th amino acid is mutated into a stop codon, F: GTCTACGACAACGGCTCGGGCTCGTCG TAACCGGGGAACC and R: GGGCAGGCCGGTGCCGGGGTTCCCCGGTTACG ACGAGCCC are used as primers for RF cloning, and the PCR reaction system is as follows: 10 x PCR, Buffer 5 μL, 25 mM MgSO4 3 μL, dNTP 5 μL, 10 μmol / L of forward primer and reverse primer 1.5 μL each, template DNA 1 μL, KOD 1 μL, H2O 32 μL.
[0039] The PCR reaction conditions are as follows: ① denaturation temperature 98℃ for 2 min, cycle 1 time; ② denaturation temperature 98℃ for 10 s, annealing temperature 55℃ for 30 s, extension temperature 72℃ for 35 s, cycle 30 times; ③ extension temperature 72℃ for 2 min, cycle 1 time.
[0040] The product is detected by agarose gel electrophoresis. The obtained PCR product is used as a template, F: GGGAATTC CATATG GCGCCGGGCGACCTC and R: GCGC CTCGAGTCAGAGGGTCCACTG are used as primers for PCR.
[0041] The PCR reaction system (50 μL) is as follows: template DNA 2 μL (1 μL of the above-mentioned PCR product each), Phusion mix 25 μL, 10 μmol / L of forward primer and reverse primer 2.5 μL each, H2O 18 μL.
[0042] The PCR reaction conditions are as follows: ① denaturation temperature 98℃ for 2 min, cycle 1 time; ② denaturation temperature 98℃ for 30 s, annealing temperature 55℃ for 30 s, extension temperature 72℃ for 60 s, cycle 30 times; ③ extension temperature 72℃ for 2 min, cycle 1 time.
[0043] PCR amplification product is the full-length target gene, which is detected by agarose gel electrophoresis and recovered by DNA gel recovery kit. After gel recovery, the product is digested with Nde I and Xho I at 37℃ for 6h, and then ligated with pET28a digested with the same enzymes at room temperature for 12h. The ligated product is transformed into E. coli TOP 10 competent cells, which are grown on a plate containing kanamycin at 37℃ overnight. After colony PCR verification with universal primers 5'-TAATACGACTCACTATAGG and 3'-GCTAGTTATTGCTCAGCGG, the plasmid is sequenced by Huada Gene (Beijing), and the plasmid with correct sequence is named as pET28a-CcGluECDMΔH1.
[0044] Example 2 Recombinant expression and purification of CcGluECDMΔH1 and gluE gene in E. coli
[0045] pET28a-gluE and pET28a-CcGluECDMΔH1 are transformed into E. coli BL21(DE3), respectively, and then induced for expression and purification. The expression and purification of endo-β-1,3-glucanase CcGluECDMΔH1 are detected by polyacrylamide gel electrophoresis, and the results are shown in Figure 2 The purified endo-β-1,3-glucanase CcGluECDMΔH1 shows a single band on the electrophoresis gel, and the position is consistent with the predicted molecular weight.
[0046] The expression amount of gluE before modification is about 2mg / L of culture medium, and the expression amount is greatly improved to 100mg / L of culture medium after modification, which is increased by nearly 50 times.
[0047] Example 3 Enzymatic property analysis of endo-β-1,3-glucanase CcGluECDMΔH1
[0048] (1) Determination of activity of endo-β-1,3-glucanase CcGluECDMΔH1
[0049] A 0.5% Kudzu / Laminarin substrate solution is prepared with a buffer (40mM pH 6 acetic acid / sodium acetate buffer), and 4μg of enzyme is mixed with 1000μL of substrate. After 5min of reaction at 60℃, 128μL is added to 96μL of DNS to terminate the reaction, and boiled for 10min. Finally, 1376μL of ddH2O is added, and the OD value is determined at 540nm. The glucose production is used to represent the enzyme activity, and the control group is added with inactivated enzyme solution, and the rest of the operation is the same as the experimental group. The enzyme activity (U) unit is defined as follows: the amount of enzyme required to release 1μmol of glucose per minute is defined as one enzyme activity unit.
[0050] (2) Effect of pH on recombinant enzyme CcGluECDMΔH1
[0051] The activity of the enzyme was determined according to the standard method at 60°C using 0.5% curdlan as the substrate, 40mM citric acid / sodium citrate pH 3-5, 40mM Na2HPO3 / NaH2PO3 pH 6-8, respectively. The optimum pH of the enzyme was determined by plotting the relative activity of the enzyme at different pH. The relative activity of the enzyme at each pH was determined using the inactivated enzyme as the control and the highest value of the activity as 100%. The results are shown in Table 1. Figure 3 As shown in Table 1, the optimum pH of CcGluECDMΔHl was 6-7. The activity of CcGluECDMΔHl decreased as the pH increased or decreased.
[0052] (3) Effect of temperature on the recombinant enzyme CcGluECDMΔHl
[0053] The activity of the enzyme was determined according to the standard method at 60°C using 0.5% curdlan as the substrate, 40mM citric acid / sodium citrate pH 3-5, 40mM Na2HPO3 / NaH2PO3 pH 6-8, respectively. The optimum pH of the enzyme was determined by plotting the relative activity of the enzyme at different pH. The relative activity of the enzyme at each pH was determined using the inactivated enzyme as the control and the highest value of the activity as 100%. The results are shown in Table 1. Figure 4 As shown in Table 1, the optimum pH of CcGluECDMΔHl was 6-7. The activity of CcGluECDMΔHl decreased as the pH increased or decreased.
[0054] Example 4 Effect of pH on the degradation products of CcGluECDMΔHl
[0055] The activity was determined according to the standard assay method at 60°C with 0.5%, 40 mM citric acid / sodium citrate pH 3-5, 40 mM Na2HPO3 / NaH2PO3pH 6-8 as substrate. The degradation products were boiled and centrifuged at 12000 rpm for 5 min, filtered through a 0.22 μm filter and 10 μL of sample was injected into a PA-100 analytical column at a flow rate of 1 mL / min at 30°C. The gradient elution program was as follows: mobile phase A was 100 mmol / L NaOH and mobile phase B was 100 mmol / L NaOH and 500 mmol / L CH3COONa, the elution gradient was as follows: 1-30 min, A / B, 100 / 0 (v / v) to 40 / 60 (v / v); 30-35 min, A / B, 40 / 60 (v / v) to 0 / 100 (v / v); 35-50 min, A / B, 100 / 0 (v / v). The pulse potentials and durations of the electrodes were as follows: E1 = +200 mV (t1 = 300 ms); E2 = +700 mV (t2 = 100 ms); E3 = -900 mV (t3 = 100 ms), and the data were analyzed by Coul Array software.
[0056] The results are shown in Table 1. At pH 6, the degree of polymerization of the products was high, and the content of hexa-saccharide was more than 20%, and di-saccharide and tri-saccharide were the main products. At pH 8, the content of di-saccharide was more than 50%, and the content of hexa-saccharide was less than 10%, and pH affected the distribution of the degree of polymerization of the products. Figure 5
[0057] Example 5 Analysis of the degradation products of the enzyme CcGluECDMΔH1
[0058] 1 ml of 0.5% laminarin was mixed with purified CcGluECDMΔH1 enzyme solution (4 μg) at a ratio of 1:1, and then reacted at 60°C for 0.5, 10 min, and the protein was removed by Sevage method, and the products were detected by liquid chromatography. As shown in Table 2, CcGluECDMΔH1 can degrade laminarin to produce oligosaccharides of various degrees of polymerization, and the main products are tri-saccharide and tetra-saccharide, and the content of tetra-saccharide is the highest. Figure 6
[0059] Example 6 Tm study of CcGluE-CDMΔH1 at different pH
[0060] The purified CcGluE-CDMΔH1 at different pH was diluted to 0.1 mg / ml, and replaced with 40 mM citric acid / sodium citrate pH 4-5, 40 mM Na2HPO3 / NaH2PO3 pH 6-8, respectively, for DSC measurement. The temperature range was 20-80℃, and the heating rate was 1℃ / min. It was found that the Tm of CcGluE-CDMΔH1 changed by 16.3℃ at pH 4-6, indicating that the conformation of CcGluE-CDMΔH1 changed at different pH.
[0061] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, and are not limited thereto; although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or make equivalent replacements for part or all of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present application. SEQUENCE LISTING <110> Dalian Institute of Chemical Physics, Chinese Academy of Sciences <120> A beta-1,3-glucanase and a preparation method and application thereof <130> 20211207 <160> 2 <170> PatentIn version 3.5 <210> 1 <211> 723 <212> DNA <213> Artificial Sequence <400> 1 atggcgccgg gcgacctcct gtggtccgac gagttcgacg gcgcggcggg ctcggcgccg 60 aacccggccg tctggaacca cgagaccggc gcgcacgggt gggcaacgc cgagctccag 120 aactacacgg cctcgcgcgc caactccgcg ctcgacggcc agggcaacct cgtcatcacc 180 gcgcgtcgcg agggcgacgg gtcgtacacg tcggcccgca tgacgaccca gggcaagtac 240 CAGCCGCAGT AC GGGGCAT CGAGGC GC GC ATCC AGATCCC GC GCGCC AGGGGATCTGG 300 CCGGC GTTC TGGATGC TC GGC GGGAGCTTCC CCGGGACGC C GTGGCC GTC GTC GGC GAG 360 ATCGACATC ATGGAGAACGTCGGGTTCGAGCCGCACC GCGT GCACGGCAC GGTGCACGGC 420 CCGGGGTACTCCGGCGGCTCCGGCATCACGGGCATGTAC CAGCACCCGC AGGGCTG GTCG 480 TTCGC GGA C GTTCCACAC G TTC GC GGT C GACTGG AAGCC GGGGGAGAT CACGTGGTT C 540 GTCGACGGCC AGCAGTTCCACC GC GTCAC GC GC GC AGC GCTGC GC GC AC C C TGGGTG 600 TTCGACCAGCCGTTCTTCCTCATCCTC AAC GTC GC GGT C GGC GGC AGT GGC CC GGC TAC 660 CCC GACGGCAC GACCC AGCTCCC GC AGC AGATGAAGGTC GACTACGTGC GC GTCTACGAC 720 AAC 723 <210> 2 <211> 242 <212> PRT <213> Artificial Sequence <400> 2 Met Ala Pro Gly Asp Leu Leu Trp Ser Asp Glu Phe Asp Gly Ala Ala 1 5 10 15 Gly Ser Ala Pro Asn Pro Ala Val Trp Asn His Glu Thr Gly Ala His 20 25 30 Gly Trp Gly Asn Ala Glu Leu Gin Asn Tyr Thr Ala Ser Arg Ala Asn 35 40 45 Ser Ala Leu Asp Gly Gin Gly Asn Leu Val He Thr Ala Arg Arg Glu 50 55 60 Gly Asp Gly Ser Tyr Thr Ser Ala Arg Met Thr Thr Gin Gly Lys Tyr 65 70 75 80 Gln Pro Gin Tyr Gly Arg He Glu Ala Arg He Gin He Pro Arg Gly 85 90 95 Gln Gly He Trp Pro Ala Phe Trp Met Leu Gly Gly Ser Phe Pro Gly 100 105 110 Thr Pro Trp Pro Ser Ser Gly Glu He Asp He Met Glu Asn Val Gly 115 120 125 Phe Glu Pro His Arg Val His Gly Thr Val His Gly Pro Gly Tyr Gly 130 135 140 He Thr Gly Met Tyr Gin His Pro Gin Gly Trp Ser Phe Ala Asp Thr 145 150 155 160 Phe His Thr Phe Ala Val Asp Trp Lys Pro Gly Glu He Thr Trp Phe 165 170 175 Val Asp Gly Gin Gin Phe His Arg Val Thr Arg Ala Ser Val Gly Ala 180 185 190 Asn Ala Trp Val Phe Asp Gin Pro Phe Phe Leu lie Leu Asn Val Ala 195 200 205 Val Gly Gly Gin Trp Pro Gly Tyr Pro Asp Gly Thr Thr Gin Leu Pro 210 215 220 Gln Gin Met Lys Val Asp Tyr Val Arg Val Tyr Asp Asn Gly Ser Gly 225 230 235 240 Ser Ser
Claims
1. A coding gene of β-1, 3-glucanase CcGluE-CDMΔH1, characterized in that, The nucleotide sequence of the coding gene is a deoxyribonucleic acid (DNA) sequence encoding the amino acid sequence shown in SEQ ID NO. 2 in the sequence listing.
2. The beta-1,3-glucanase GluE-CDMΔH1 encoded by the gene according to claim 1, characterized in that, The amino acid sequence of the beta-1, 3-glucanase GluE-CDMΔH1 is the amino acid sequence shown in SEQ ID NO. 2 in the sequence listing.
3. A process for the preparation of the β-1,3-glucanase GluE-CDMΔH1 according to claim 2, characterized in that, The coding gene of the beta-1, 3-glucanase CcGluE-CDMΔH1 as claimed in claim 1 is cloned into a recombinant expression vector, introduced into a host cell, and a recombinant expressed beta-1, 3-glucanase is obtained.
4. The production method according to claim 3, characterized by, The recombinant expression vector is selected from the group consisting of an Escherichia coli expression vector, a yeast expression vector, a Bacillus subtilis expression vector, a lactic acid bacteria expression vector, a Streptomyces expression vector, a bacteriophage vector, a filamentous fungus expression vector, a plant expression vector, an insect expression vector, or a mammalian cell expression vector.
5. The preparation method according to claim 3, characterized in that, The host cell is a recombinant bacterium or a transgenic cell line, including an Escherichia coli host cell, a yeast host cell, a Bacillus subtilis host cell, a lactic acid bacteria host cell, an actinomycete host cell, a filamentous fungus host cell, an insect cell, or a mammalian cell.
6. The production method according to claim 5, characterized by The host cell is selected from the group consisting of Escherichia coli BL21 , Escherichia coli JM109 , Escherichia coli DH5a , Saccharomyces cerevisiae , Pichia pastoris , Kluyveromyces lactis, Bacillus subtilis R25, Bacillus subtilis 9920 , Lactic acid bacteria COCC101 , Streptomyces spp. 、 Trichoderma viride, Trichoderma reesei, Aspergillus niger, Aspergillus nidulans, Bombyxmori, Antharaea eucalypti, Chinese hamster ovary cells CHO, baby hamster kidney cells BHK or Chinese hamster lung cells CHL.
7. Use of the β-1,3-glucanase CcGluE-CDMΔH1 according to claim 2 for the degradation of polysaccharides and the production of oligosaccharides, characterized in that, The polysaccharide is Codium polysaccharide or laminarin.
8. Use according to claim 7, characterized in that, The degree of polymerization of the product is regulated by changing the pH of the reaction system to produce oligosaccharide products with different activities.
9. Use according to claim 7, characterized in that, The oligosaccharide includes disaccharide, trisaccharide, tetrasaccharide, pentasaccharide, and hexasaccharide.
Citation Information
Patent Citations
Incision beta-1,3-glucanase coding gene, as well as enzyme, preparation method and application thereof
CN106755012A
Compositions for treating citrus disease and promoting yield increase in row crops
CN113395898A