A method for controlling citrus fruit fly

Abstract

The present application relates to a method for controlling the fruit fly. The present application confirms that pyrazine substances have the effect of attracting and killing male fruit flies. By regulating the wing flapping, the mating of male and female fruit flies can be effectively interfered with, which has a positive effect on pest control.

Description

Technical Field

[0001] The present application relates to a method for controlling citrus fruit fly, and belongs to the field of biotechnology. Background Art

[0002] Bactrocera dorsalis, also known as oriental fruit fly, yellow fly, fruit maggot, belongs to the order Diptera, family Tephritedae, genus Bactrocera Macquar. It is a dangerous quarantine pest with a wide diet, serious overlapping generations, strong reproductive capacity, rapid spread, serious damage, and difficult to control. Hosts include bananas, citrus, tomatoes, eggplants, peppers and other fruit and vegetable crops. The insect mainly harms with larvae. Adults lay eggs under the peel. After hatching, the larvae develop by feeding on the flesh, causing the fruit to rot and fall off, seriously affecting the quality and yield of the fruit. Its larvae and eggs can hide in the host fruit, and its adults have a strong ability to migrate and spread.

[0003] Among fruit flies, females and males have different chemotactic responses to attractants. Some attractants can only attract females, some attractants can only attract males, and some attractants can attract both females and males. Methyl eugenol is a natural plant-derived attractant of the family Tephritidae, which has an attracting effect on both female and male fruit flies. However, methyl eugenol itself does not have insecticidal ability, and even has a certain promoting effect on the mating of fruit flies. Therefore, when using methyl eugenol, it needs to be compounded with other insecticides to achieve the effect of attracting and killing at the same time. At present, there is an urgent need for a substance that has both an attracting and killing effect on male fruit flies, so as to replace methyl eugenol and obtain the effect of using a single attractant to attract and kill male fruit flies.

[0004] Bactrocera and Drosophila are completely different genera, but they are often confused because of their similar Chinese names. The courtship methods of fruit flies and fruit flies are very different: male fruit flies chase females through vision, and females are the main source of attraction during courtship and mating; while male fruit flies gather together and emit pheromones to attract females. Therefore, the method of suppressing the courtship and mating of fruit flies through visual interference (such as mutation of the white eye gene) may not necessarily affect the courtship and mating of fruit flies. It is worth noting that "suppression" and "delay" are different concepts. The former means to weaken or eliminate, while the latter means only a delay or postponement in time, which may not be weakened or eliminated.

[0005] The white eye gene (white gene) belongs to the ATP-binding cassette (ABC) transporter gene family. The transporter protein it encodes is located on the pigment granule membrane and can transport pigment precursors in the cytoplasm into the pigment granules. The white eye mutation of fruit flies is easy to identify and is therefore often used as a marker for molecular manipulation. At the same time, the Orco gene plays a key role in the olfactory recognition process of insects. Therefore, researchers hope to explore the effects of the white gene or the Orco gene on fruit flies, especially on their wing-flapping courtship or mating behaviors, so as to provide support and reference for controlling the reproduction of fruit fly populations. Summary of the invention

[0006] In order to solve the above technical problems, the first purpose of this application is to provide a method for simultaneously attracting and killing male fruit flies, the second purpose is to provide a method for regulating the reproduction of fruit flies using eye color genes, and the third purpose is to provide a method for using light intensity to assist in interfering with the wing flapping and mating of male fruit flies. Specifically:

[0007] The present application provides a method for inhibiting or delaying the wing flapping of fruit flies, comprising the following steps:

[0008] ① Knockout of the fruit fly white eye gene; and / or

[0009] ② Knockout of the fruit fly Orco gene; and / or

[0010] ③Use medium-intensity light or strong light.

[0011] The present application also provides a method for inhibiting or delaying fruit fly mating, comprising the following steps:

[0012] ① Knockout of the fruit fly white eye gene; and / or

[0013] ② Knockout of the fruit fly Orco gene; and / or

[0014] ③Use medium-intensity light or strong light.

[0015] The present application also provides a method for inhibiting fruit fly chemotaxis, comprising the following steps:

[0016] ① Knockout of the fruit fly white eye gene; and / or

[0017] ② Knockout of the fruit fly Orco gene; and / or

[0018] ③Use medium-intensity light or strong light.

[0019] In some embodiments, moderate intensity light or intense light is light with an intensity greater than 2000 lux.

[0020] The present application also provides a method for attracting and / or killing fruit flies, using an effective amount of pyrazine substances as attractants or insecticides.

[0021] The present application provides the use of pyrazine substances as pesticides or insecticides, and the pesticides or insecticides are used for preventing and controlling fruit flies.

[0022] In some embodiments, the pyrazine substance includes trimethylpyrazine and / or tetramethylpyrazine and / or a mixture thereof.

[0023] In some embodiments, the method further comprises the combined use of other attractants or insecticides, such as methyl eugenol.

[0024] In some embodiments, the fruit fly is an insect of the genus Bactrocera; preferably, the fruit fly is Bactrocera dorsalis.

[0025] In some embodiments, the fruit fly is a female or a male.

[0026] Positive effects of this application:

[0027] (1) It was confirmed that pyrazines not only attract male fruit flies, but also kill them, that is, pyrazines themselves can be used as a pesticide or insecticide. Therefore, using pyrazines to replace methyl eugenol can overcome the defect that methyl eugenol needs to be combined with other insecticides to work.

[0028] (2) Knocking out the Orco gene or the white gene can prevent pyrazine from attracting males and delaying their wing flapping. Male fruit flies attract females by flapping their wings at high frequencies. Wing flapping is a necessary condition for the mating behavior of fruit flies. Interfering with it can effectively inhibit the reproduction of pest populations. Moreover, this interference only targets males, which can greatly save costs.

[0029] (3) It was confirmed that the mating of male fruit flies lacking the white eye gene was reduced and delayed. The mating of fruit flies mostly occurs during the twilight period, which is a relatively short time window. Delaying mating will make the means of controlling population reproduction not rely on the short twilight window but can work over a longer period of time, increasing the opportunity for humans to regulate their behavior. This has important theoretical and application value.

[0030] (4) Strong light can inhibit or delay the wing flapping and mating of male fruit flies. In the process of regulating fruit fly reproduction, people can use different lighting conditions to flexibly meet various prevention and control needs. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The results show that pyrazine has an attractive effect on male Bactrocera dorsalis.

[0032] Figure 2 The results show the killing effect of pyrazine on male Bactrocera dorsalis.

[0033] Figure 3 It shows that pyrazine has an attractant effect on both female and male citrus fruit flies.

[0034] Figure 4 Shows the attractant effect of pyrazine and methyl eugenol when mixed.

[0035] Figure 5 It was shown that knocking out the Orco gene blocked the attraction of male insects to pyrazine and delayed wing flapping.

[0036] Figure 6 Showing the effects of different light intensities on the mating of the citrus fruit fly.

[0037] Figure 7 Shows the effect of different light intensities on the wing flap of male Bactrocera dorsalis.

[0038] Figure 8 A graph showing the results of gel electrophoresis detection of amplified target genes.

[0039] Fig. 9 A graph showing the results of synthesizing 4 gRNAs.

[0040] Fig.10 Partial nucleic acid fragments of mutant strains are shown.

[0041] Fig.11 Diagram showing the design of the experiment on group mating behavior of white-eyed mutants.

[0042] Fig.12 A diagram showing the results of an experimental study on the group mating behavior of white-eyed mutants.

[0043] Fig.13 A graph showing the effect of light intensity on mating in the white-eyed mutant of the oriental fruit fly.

[0044] Fig.14 A diagram showing the wing-flapping behavior of the white-eye mutant of Bactrocera dorsalis.

[0045] Fig.15 A graph showing the effects of pyrazine on the wing-flapping behavior of white-eye mutants.

[0046] Fig.16 Showing the effect of light on the tendency of female Bactrocera dorsalis to pyrazine. DETAILED DESCRIPTION

[0047] In order to specifically illustrate the universal design concept of the present application, specific experimental parameters are used as an example below, but this should not be used as a reason to limit the scope of protection of the present application.

[0048] In some embodiments, pyrazines and methyl eugenol are used in combination, preferably, the ratio of pyrazines to methyl eugenol is 10:1.

[0049] In some embodiments, the pyrazine is administered between 17:30 and 21:30.

[0050] In some embodiments, the pyrazine is administered while irradiating light at an intensity of 50 lux.

[0051] In some embodiments, the pyrazine substance is trimethylpyrazine; the preferred dosage is 10 mg.

[0052] In some embodiments, the Bactrocera dorsalis is exposed to light with an intensity of 2000-10000 lux.

[0053] In some embodiments, the Bactrocera dorsalis white eye gene or the Orco gene is knocked out by CRISPR / Cas9.

[0054] "Light intensity (light intensity)" includes weak light (50-1000 lux), medium light (1,500-5,000 lux), and strong light (10,000-30,000 lux and above). Generally, medium-strong light is above 2,000 lux, such as 2,000-5,000 lux, or 5,000-10,000 lux.

[0055] "Effective amount" refers to a dose that can produce the desired effect, such as 10 mg, 1 mg, or 0.1 mg.

[0056] "Attractant" refers to an active substance produced by plants or artificially synthesized that has a behavioral attractant effect on specific insects. Attractants have the effects of attracting and inducing, but not necessarily killing or damaging effects.

[0057] "Pesticide" is a drug or pesticide that kills pests.

[0058] "Chemotaxis" refers to the tactic response of organisms to chemical stimulation in the external environment, such as the tactic response to pyrazines.

[0059] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0060] Before mating, male fruit flies gather together and make a typical high-frequency wing-flapping sound, while scraping their abdomens alternately with their hind legs, which can send out sound and odor signals, which enable females to locate the males and rush over to mate. Therefore, the behavior of swarming wing-flapping is a unique male courtship behavior in fruit flies.

[0061] Example 1 The attraction and insecticidal effect of pyrazine on male Bactrocera dorsalis

[0062] 1.1 The attraction of pyrazine to male Bactrocera dorsalis

[0063] The experimental method of measuring the tendency behavior of fruit flies to specific chemical substances was used to determine the attracting effect of pyrazines on male fruit flies. The experimental method is to use an acrylic transparent insect cage, and place a conical bottle inside as an insect trap. The conical bottle stopper is made of silicone and has a circular through opening on it. A 1000μl pipette tip is used as the adult entry channel, and the tip of the pipette tip is cut off. One of the two conical bottle traps is placed in the odor to be tested, and the other is placed in the control solvent. The odor to be tested is dissolved in paraffin oil and can be diluted step by step to the concentration required.

[0064] Results: Pyrazines (such as trimethylpyrazine or tetramethylpyrazine) all had an attracting effect on male Bactrocera dorsalis. The attracting effect was the best when the concentration was 10 mg. Trimethylpyrazine had the best effect and showed obvious dose-dependent performance ( Figure 1 ).

[0065] 1.2 The killing effect of pyrazine on male Bactrocera dorsalis

[0066] Procedure: The effect of high-dose 10 mg trimethylpyrazine on the lethality of male Bactrocera dorsalis was determined by the experimental method of determining the lethality of male Bactrocera dorsalis with high doses of 10 mg trimethylpyrazine. The experimental method is to use an acrylic transparent insect cage (18 cm × 25 cm × 14 cm) with a conical bottle placed inside as an insect trap. The conical bottle stopper is made of silicone and has a circular through opening on it. A 1000 μl pipette tip is used as the adult entry channel, and the tip of the pipette tip is cut off. Four conical bottles are placed in one trap with 10 mg trimethylpyrazine, one trap with 1 mg trimethylpyrazine, one trap with 0.1 mg trimethylpyrazine, and one trap with 0.01 mg trimethylpyrazine. 10 male Bactrocera dorsalis were placed in each trap bottle, and a small amount of cotton was stuffed into the upper opening of each trap bottle to ensure that the trap bottle is breathable, which is an experiment to simulate male insects falling into the trap bottle. Experimental time: 17:00-9:00, lighting conditions: 50lux.

[0067] Results: The mortality rate of male insects increased with the increase of trimethylpyrazine dosage. The mortality rate of 10 mg trimethylpyrazine on male insects was close to 100% ( Figure 2 ). That is to say, using 10 mg of trimethylpyrazine can best attract male insects and kill them most efficiently.

[0068] Example 2 Pyrazine has an attractant effect on both female and male Bactrocera dorsalis

[0069] The experimental method of measuring the tendency behavior of fruit flies to specific chemical substances was used to determine the attracting effect of trimethylpyrazine on male and female fruit flies during the period of 8:00-22:00. The experimental method is to use an acrylic transparent insect cage, and place a conical bottle inside as an insect trap. The conical bottle stopper is made of silicone and has a circular through opening on it. A 1000μl pipette tip is used as the adult entry channel, and the tip of the pipette tip is cut off. Two conical bottle traps are placed in one with 10mg paraffin oil and the other with 10mg trimethylpyrazine.

[0070] Results: Through trap experiments, the trapping effect of trimethylpyrazine on female and male insects was detected in different time periods. The trapping was divided into 7 time periods from 8:00 to 22:00, and each 2 hours was a separate trapping experimental period, namely 8:00-10:00, 10:00-12:00, 12:00-14:00, 14:00-16:00, 16:00-18:00, 18:00-20:00, and 20:00-22:00. Among them, the overall trend of male insect trapping was stronger during the day and decreased with the passage of time. The trapping effect reached a peak at 10:00-12:00, and the trapping effect after 12:00 was constantly decreasing. Among the trapping in different time periods from 8:00 to 22:00, the trapping effect was the strongest at 10:00-12:00, and the weakest at 20:00-22:00. The overall trend of female insect trapping is stronger at night. With the arrival of dusk, the trapping effect is getting higher and higher. The trapping effect is weaker from 8:00 to 16:00, and the trapping effect is increasing after 16:00 ( Figure 3 ).

[0071] Example 3: Attraction ability of pyrazine and methyl eugenol mixed

[0072] The experimental method of measuring the tendency behavior of fruit flies to specific chemical substances was used to determine the attracting effect of pyrazines and methyl eugenol on male fruit flies. The experimental method is to use an acrylic transparent insect cage, and place a conical bottle inside as an insect trap. The conical bottle stopper is made of silicone and has a circular through opening on it. A 1000μl pipette tip is used as the adult entry channel, and the tip of the pipette tip is cut off. Two conical bottle traps are placed in one with 1mg methyl eugenol and the other with 1mg methyl eugenol and 10mg trimethylpyrazine.

[0073] Results: Through trap experiments, two odor sources were used for competitive trapping in the same space. When trapping was carried out at 9:00-10:00 in the morning, the trapping effect of methyl eugenol and trimethylpyrazine on male insects was significantly higher than that of methyl eugenol alone at 20 minutes, 40 minutes, and 60 minutes after setting the odor ( Figure 4Lower left). When trapping at 18:00-20:00 in the evening, the mixture of methyl eugenol and trimethylpyrazine also had a stronger trapping effect on male insects than methyl eugenol alone, and the methyl eugenol that competed with it hardly attracted any adult insects ( Figure 4 ). It can be seen that trimethylpyrazine is the main attractant for attracting male Bactrocera dorsalis, and its ability to attract male Bactrocera dorsalis is significantly stronger than methyl eugenol.

[0074] Example 4 Knocking out the Orco gene can prevent pyrazine from attracting male insects and delaying wing flapping

[0075] Procedure: The experimental method of measuring the tendency behavior of fruit flies to specific chemicals was used to determine the changes in the attraction of pyrazines to male insects after Orco gene knockout. The experimental method is to use acrylic transparent insect cages, and place conical bottles inside as insect traps. The conical bottle stoppers are made of silicone and have round through openings on them. A 1000μl pipette tip is used as the adult entry channel, and the tip of the pipette tip is cut off. Two conical bottle traps are placed in one with 10mg trimethylpyrazine and the other with paraffin oil control.

[0076] A video camera was used to observe the changes in the wing-flapping behavior of fruit flies after Orco knockout, and the number of male insects that flapped their wings within 5 minutes was recorded. For example, if 5 male insects were observed to have flapped their wings within 5 minutes, the frequency of wing-flapping during this time period was recorded as 5. The frequency of wing-flapping within 1 hour was the accumulation of the number of insects that flapped their wings at all 5-minute intervals during this time period. For example, 16:30-17:30 included 12 5-minute time periods, and the number of wing-flapping events was 9 (16:35); 10 (16:40); 11 (16:45); 10 (16:50); 11 (16:55); 11 (17:00); 11 (17:05); 9 (17:10); 9 (17:15); 9 (17:20); 9 (17:25); 10 (17:30). The final cumulative wing-flapping frequency is the total of these 10 time periods, 119 (9+10+11+20…). When calculating the change of wing-flapping frequency over time, the frequency of male wing-flapping within 5 minutes is directly used.

[0077] Group mating: 12 healthy male and female Orco mutants and wild-type control Bactrocera dorsalis adults were placed in a mating cage of 18 cm × 12.5 cm × 14 cm for mating at 12 days old. The mating cage was placed under an observation board with adjustable light intensity LED white light, and the light intensity gradient was set to 50 lux using a handheld illuminometer (AS813) from Xima for 5 replicates. The shooting time was 16:30-22:00, the temperature in the behavior room was (26±1)℃, and the relative humidity was (60±5)%. The number of mating behaviors under each light intensity was counted every 30 minutes, and a total of 5 replicates were observed.

[0078] Results: After knocking out Orco, the attraction of trimethylpyrazine to male insects decreased significantly, and the attraction ability was almost lost. It proved that Orco is the main gene responsible for the trimethylpyrazine response gene. The wing-flapping behavior of the Orco mutant was significantly reduced and delayed during the peak of natural mating of fruit flies (17:00-19:00), indicating that the perception of pyrazine substances is crucial for wing-flapping behavior. Male insects with Orco knocked out cannot flap their wings normally and in time to court, and their mating success rate with female insects is significantly reduced ( Figure 5 ).

[0079] Example 5 Effect of light on mating and wing flapping of Bactrocera dorsalis

[0080] 5.1 Effect of light intensity on mating of Bactrocera dorsalis

[0081] Procedure: The effect of light on the mating behavior of the orange fruit fly was determined by using an experimental method to determine the effect of light on the mating behavior of the orange fruit fly. The experimental method is to use an acrylic transparent insect cage (18cm×12.5cm×14cm) as the mating cage for the mating experiment. Place it on the adjustable white light board of the behavior detection system, set 10 experimental light intensities of strong light (10000-30000lux), medium light intensity (2000-5000lux), and weak light (50-1000lux) and record the video, and analyze the video the next day.

[0082] Results: Through the mating experiment, the mating behavior of adults under 10 different light intensities was observed using a camera system. Generally speaking, when the light intensity exceeds 1000 lux, the mating of adults will decrease. Under laboratory lighting conditions ( Figure 6 B) After 1 hour of exposure (16:30-17:30), adults under low light (50-1000 lux) conditions performed mating behavior, which was not significantly different from the mating events under 100-1000 lux (p=0.9873, p=0.7956, p=0.9999). Few mating events were observed under medium light (2,000-5,000 lux), which was significantly lower than that under 50 lux (p=0.0025, p=0.0166, P=0.0011). No mating events were found under strong light (10,000-30,000 lux). However, when adults were continuously exposed to the corresponding light intensities, mating behavior under medium and strong light increased significantly. From 17:30 to 18:30, adults under 2,000 lux and 3,000 lux began to mate, and the number of matings reached below 50 lux (p = 0.9413, p = 0.6310) ( Figure 6 C). From 18:30 to 19:30, the mating behavior of adults further increased below 5,000 lux, reaching the mating level under 50 lux (P = 0.2786) ( Figure 6 D). The mating behavior of adults below 10,000 lux gradually increased from 17:30 to 21:30, and the number of matings generally reached the same level below 50 lux (P<0.0001, P=0.0003, P=0.0108, P=0.0509) ( Figure 6 C, D, E, F). In contrast, at stronger intensities of 20,000 and 30,000 lux, mating behavior was sporadic. A trend in this behavior over time was observed at 50, 2,000, and 10,000 lux. At 50 lux, most matings began within 1 hour. Adults did not mate at 2,000 and 10,000 lux early in the experiment, and subsequent mating was delayed (50 lux R2 = 0.9731, 2,000 lux R2 = 0.9856, 10,000 lux R2 = 0.9841) ( Figure 6 G). Therefore, strong light has the effect of inhibiting and delaying mating.

[0083] 5.2 Effects of light on wing flapping of male Bactrocera dorsalis

[0084] Procedure: The effect of light on the wing-flapping behavior of male Bactrocera dorsalis was determined by using an experimental method to determine the effect of light on the wing-flapping behavior of male Bactrocera dorsalis. The experimental method is to use an acrylic transparent insect cage (18cm×12.5cm×14cm) as the wing-flapping cage for the male wing-flapping experiment. Place it on the adjustable white light board of the behavior detection system, and select a light intensity from strong light, medium light intensity, and weak light. Set three experimental light intensities of strong light (10000lux), medium light intensity (2000lux), and weak light (50lux) and record the video, and analyze the video the next day.

[0085] Results: Through mating experiments, based on the results obtained in the above experiments, male wing-flapping behavior was observed under three light intensities (50 lux, 2,000 lux, and 10,000 lux) that strongly regulate mating behavior. At 2000 lux and 10,000 lux, the male wing-flapping behavior was significantly weakened. From 16:30 to 17:30, most of the male Bactrocera dorsalis actively flapped their wings and beat their anus below 50 lux. Compared with 50 lux, only a few adult males vibrated their wings below 2000 lux, and no wing-flapping behavior was observed below 10,000 lux (2000 luxp=0.0009, 10,000 luxp=0.0034)( Figure 7B). The wing-flapping behavior of males under 2000 lux increased significantly between 17:30 and 19:30, only slightly lower than or equal to 50 lux (p = 0.0288, p = 0.7528). Only a few males flapped their wings at 10,000 lux, which was significantly lower than 50 lux (P < 0.0001, P = 0.0023) ( Figure 7 CD). From 19:30 to 20:30, there was still some wing-flapping behavior below 50 lux, but this was significantly lower than 2000 lux and 10000 lux (p=0.0003, p=0.0004) ( Figure 7 E). From 20:30 to 21:30, only weak wing-flapping behavior was observed under the three light intensities. There was no significant difference between 2000 lux and 50 lux (p = 0.1315), and 10000 lux was only slightly higher than 50 lux (P = 0.0072) ( Figure 7 F). The wing-flapping behavior was also delayed at 2000lux and 10000lux. Figure 7 G). Therefore, strong light has the effect of inhibiting and delaying wing flapping.

[0086] Example 6 Obtaining a homozygous strain of the white gene mutation of the citrus fruit fly

[0087] 6.1 Based on the genome analysis of Bactrocera dorsalis, specific primers for the white gene were designed to amplify exon 2 and 3 and sequence the amplified exon 2 and 3 regions.

[0088] (1) Specific primers

[0089] BdorWhite F:GCAGTCCTATGAGCAGTCTTC

[0090] BdorWhite R:TGTACCCAGAAAGGCGACT

[0091] (2) Extraction of genomic DNA from Bactrocera dorsalis

[0092] Take 10 male and female wild-type Bactrocera dorsalis, remove the midlegs, separate the insects into separate tubes, and extract DNA. The extraction reagents and methods are as follows:

[0093] Reagent preparation: Use 2M-NaOH, 0.5M-EDTA, and 1M-Tris-HCL three stock solutions to prepare two reagents, named solution I and solution II respectively.

[0094] Solution I: 625 μl NaOH, 20 μl EDTA, 49.355 mL sterile water to prepare a total volume of 50 mL solution I; Solution II: 2 mL Tris-HCl, 48 mL sterile water to prepare solution II.

[0095] a. The mid-legs of ten female and ten male Bactrocera dorsalis adults were removed and placed in a 1.5 mL centrifuge tube, and then steel beads were added, and the tube was quickly frozen in liquid nitrogen and then ground;

[0096] b. Add 50 μL of solution I to each tube (the added volume is related to the tissue size), shake and mix, and then centrifuge at 10000 rpm for 3 min;

[0097] c. After centrifugation, place the centrifuge tube in a 95℃ dry bath and heat for 20 minutes, gently shaking it 2-3 times.

[0098] d. Add 50 μL of solution II (same volume as solution I) to the tube, vortex to mix, and centrifuge at 10,000 rpm for 3 min.

[0099] e. Transfer 50 μL of the supernatant to a clean centrifuge tube. This solution is the gDNA of Bactrocera dorsalis, and 1-3 μL can be used directly for PCR.

[0100] (3) PCR amplification

[0101] Reaction system:

[0102]

[0103] Reaction conditions:

[0104]

[0105] Gel electrophoresis was used to detect the amplified target gene, and the band size was basically consistent with the genome analysis results ( Figure 8 ).

[0106] 6.2 Based on the sequencing results of each of the above genes, CRISPR / Cas9 target sites were designed in the exon 2 and 3 regions for knockout.

[0107] (1) Based on the above sequencing results, a total of 4 targets were selected

[0108] Target sequence (BdorWhite target):

[0109] BdorWhite Target1: CTATCCGGGTGAATTGCTAGCGG

[0110] BdorWhite Target2: CGGTGGCGAACGTAAACGCTTGG

[0111] BdorWhite Target3: ACGTTGTGCTTATGTTCAACAGG

[0112] BdorWhite Target4:CAACTGCTGAATCGTGTAAAAGG

[0113] a. Preparation of sgRNA DNA template

[0114] The PCR reaction was performed at room temperature in a volume of 25 μL. TM High-Fidelity PCR Master Mix (2X), 12.5μl; Tracr Fragment + T7 Primer Mix, 1μl; 0.3μM Target F1 / R1 oligonucleotide mix, 1μl; Nuclease-free water, 10.5μl. Reaction conditions are: 98℃10s; 98℃5s, 55℃15s-×32; 72℃1min; 4℃ storage (Since the gRNA DNA template is very short (120bp), a two-step PCR protocol is used. No separate extension step is required in the 32 polymerase chain reaction cycles). Take 5uL of the product for electrophoresis to detect the template assembly (120bp). If the target band is correct, in vitro transcription can be performed to produce gRNA.

[0115] b. Add the gRNA obtained by in vitro transcription in the following order: NTP mix (100 mM each of ATP, GTP, CTP, UTP), 8 μL; gRNA DNA template (from PCR assembly), 6 μL; 5X TranscriptAid TM ReactionBuffer, 4μL; TranscriptAid TM Enzyme Mix, 2 μL.

[0116] Mix the reaction components thoroughly, centrifuge and incubate at 37°C for 2 hours (can also be extended to 4h to increase yield). Add 1μL DNaseI immediately after the in vitro transcription reaction and incubate at 37°C for 15 minutes to remove the remaining DNA template, stop the transcription reaction, and prevent the template DNA from interfering with the downstream reaction of the RNA transcript. After the reaction, take 0.5μL of IVT product and dilute it in 10μL DEPC-treated water. 2% agarose gel detection, the expected gRNA size is 100 bases. The discrete band at 100 bases represents the complete RNA.

[0117] c. Purification of in vitro transcribed gRNA

[0118] Purify the in vitro transcribed gRNA using a gRNA purification kit, elute the gRNA with 10 μL RNA-free H2O, determine the concentration of the purified gRNA, dilute and package it according to the required concentration, and store it at -80°C. Fig. 9 It shows that 4 gRNAs were successfully synthesized.

[0119] 6.3 Injection was performed during the embryonic stage of Bactrocera dorsalis, and the mutant types were screened in the G0 generation. The mutant offspring types with frameshift termination or deletion of more than 3 amino acids were screened, and the mutants were constructed by hybridization.

[0120]

[0121] (1) Preparation of injection solution

[0122] Take 2.5 μl of each target shown in the table above, mix, add 1 μL phenol red and 0.3 μL 500 mg / mL Cas9 protein. After flicking to mix, centrifuge at 4°C, 10,000 rpm / min for 10 min.

[0123] (2) Embryo collection

[0124] The adult fruit flies were collected into insect cages, the insect population density was controlled at 300 per cage, and they were fed with artificial feed (beer yeast: white sugar = 1:1), and the feed and water were changed every two days. After 6 days of age, the insect cages were placed under dim light (50 Lux) for mating every evening, and after mating for 3-5 days, eggs were taken for microinjection. The egg-laying box was placed in the insect cage 30 minutes before the injection began. When a large number of female insects began to lay eggs, a new egg-laying box was replaced. The eggs were collected once every 10 minutes, and the fresh eggs were placed on a homemade egg-laying table. Generally, 3 pm is the peak period for egg-laying of the fruit fly, and microinjection begins after 3 pm.

[0125] (3) Microinjection

[0126] Take 3 μL of the prepared injection solution and add it to the pulled microinjection needle, remove the air in the needle, grind the needle tip to the ideal tip on the needle grinder, then install the needle on the microinjection instrument, adjust the distance between the needle and the egg, insert it from the tail of the egg at a 45° angle, and lightly press the pedal to complete the injection. Inject all the eggs in turn, inject 200 eggs each time, and inject 2-3 times in succession.

[0127] (4) Mutant screening

[0128] The injected eggs were promptly picked onto moist filter paper to keep them moist, placed in an artificial incubator (temperature 26.5°C, humidity 55%, L:D=14:10) for hatching, and placed on larval feed the next afternoon. After the injected insects emerged, gDNA of the adult midlegs was extracted, and exons 2 and 3 of the white eye gene of the citrus fruit fly were amplified by PCR to detect mutations. The passage was performed until a homozygous mutant strain was screened out.

[0129] (5) Construction of mutant strains Fig.10 .

[0130] Example 7: White group mating

[0131] (1) Preparation of test insects

[0132] About 200 eggs are laid at a time, and the larval feed is placed in about 1 / 3 of the feeding bowl. When the larvae are close to pupation, the larvae and the feed are placed in the pupa box. After about 2 days, the pupa sand is taken out, and after 7 days, the sand is sieved to take out the pupae. The pupae will emerge in about 2 days. After emergence, the adult insects are strictly distinguished between males and females, and are raised in small cages of 18cm×12.5cm×14cm. Each small cage is raised with about 30-50 heads, and the feed is changed and water is added every 2 days.

[0133] (2) Experiment on mating behavior of white-eyed mutants

[0134] Intra-group mating: Twelve healthy male and female white-eyed mutant Bactrocera dorsalis adults were placed in a mating cage of 18cm×12.5cm×14cm for pairing when they were 12 days old; twelve healthy male and female wild-type control Bactrocera dorsalis adults were placed in a mating cage of 18cm×12.5cm×14cm for pairing when they were 12 days old. The mating cage was placed under an observation board with adjustable LED white light intensity, and a handheld illuminance meter (AS813) was used to set the light intensity gradient to 50lux for 5 replicates. The shooting time was 16:30-22:00, the temperature in the behavior room was (26±1)℃, and the relative humidity was (60±5)%. The number of mating behaviors occurring under each light intensity was counted every 30 minutes, and a total of 5 replicates were observed. See the experimental design diagram for details. Fig.11 Relevant literature shows that the most suitable light intensity for mating of Bactrocera dorsalis is 57.8 lux. In order to explore whether the White eye mutation has an effect on group mating, WT was used as a control.

[0135] The results showed that the white eye mutation of the orange fruit fly would delay its mating time and reduce its number ( Fig.12 A, Fig.12 B).

[0136] Inter-group mating: In order to explore whether it is the females with white eye mutation or the males with white eye mutation that reduce the number of matings, WT females or males were mated with 12-day-old groups of White males or females.

[0137] The results showed that the number of matings of White♀×WT♂ was consistent with the mating results of the wild-type group. Moreover, the mating results of the White♂×WT♀ group also corresponded to the mating results of the White group ( Fig.12 C, Fig.12 D) Therefore, we can know that the low number and delay of mating in the White group are mainly affected by the white-eyed male insects.

[0138] Example 8 Effect of light intensity on mating of the White mutant of the citrus fruit fly

[0139] Twelve healthy male and female white-eyed mutants and wild-type (control) Bactrocera dorsalis adults were placed in a mating cage of 18 cm long, 12.5 cm wide, and 14 cm high for pairing. The mating cage was placed under an observation board with an adjustable light intensity LED white light. A handheld illuminometer (AS813) was used to set the light intensity gradient to 50 lux, 2000 lux, and 10000 lux, with 5 replicates for each gradient. The shooting time was 16:30-22:00, the temperature of the behavior room was (26±1)℃, and the relative humidity was (60±5)%. The number of mating behaviors under each light intensity was counted every 30 minutes, and a total of 5 replicates were observed.

[0140] Results: Using a behavioral monitoring system, we set three different light intensities of 50 lux, 2000 lux, and 10000 lux to observe the mating of WT and White mutant adults. The results showed that under 50 lux light conditions, within one hour from the start of the experiment (16:30-17:30), an average of 10 pairs of mating occurred in the wild, an average of 4 pairs of mating occurred at 2000 lux, and no mating occurred in White. From 17:30 to 18:30, under 50 lux, 2000 lux, and 10000 lux light conditions, the number of matings of WT increased, and the White mutant mated an average of 5 pairs under 50 lux light, which was significantly different from WT, and no mating occurred at 2000 lux and 10000 lux. From 18:30 to 19:3 Under 0 and 50 lux light conditions, WT mating has tended to be stable. Under 2000 lux and 10000 lux light conditions, the number of WT matings increased, and the White mutant began to mate under 2000 lux conditions; from 19:30 to 20:30, under 2000 lux and 10000 lux light conditions, the number of WT matings increased, and the number of White matings also increased at 2000 lux, and there was no mating at 10000 lux; from 20:30 to 21:30, under 10000 lux light, a few White mated, which was significantly different from WT; from 21:30 to 22:00, under 2000 lux light, some WT fruit flies ended mating, the number of matings decreased, and White was basically stable. The results showed that the higher the light intensity, the lower the number of matings of the White mutant was compared with the WT, and the mating time was delayed ( Fig.13 ).

[0141] Example 9: Delayed group wing-flapping behavior in white-eye mutants

[0142] Watch the video and record the number of male insects that flap their wings within 5 minutes. For example, if 5 male insects were observed to have flapped their wings within 5 minutes, the frequency of wing flapping during this time period was recorded as 5. The frequency of wing flapping within 1 hour was the accumulation of the number of insects that flapped their wings in all 5-minute intervals during this time period. For example, 16:30-17:30 included 12 5-minute time periods, and the number of wing flappings was 9 (16:35); 10 (16:40); 11 (16:45); 10 (16:50); 11 (16:55); 11 (17:00); 11 (17:05); 9 (17:10); 9 (17:15); 9 (17:20); 9 (17:25); 10 (17:30). The final cumulative frequency of wing flapping was the total number of these 10 time periods, 119 (9+10+11+20…). When calculating the change of wing-flapping frequency over time, the frequency of male wing-flapping within 5 minutes is directly used.

[0143] According to the results of the mating experiment, the phenomenon of group wing flapping of 12-day-old WT and White male insects under low light conditions of 50lux was studied. The results showed that most WT had flapped their wings at 16:30-17:30, while the number of White wing flapping was significantly different from WT; from 17:30 to 18:30, the number of WT wing flapping was basically the same as the previous hour, and the number of White wing flapping increased gradually compared with the previous hour, but it was significantly different from WT; from 18:30 to 19:30, the number of WT wing flapping gradually decreased, while the number of White wing flapping was still in the rising stage, basically the same as WT; from 19:30 to 20:30, the number of WT wing flapping decreased, and the number of White increased, which was higher than WT; from 20:30 to 21:30, the number of WT wing flapping was still in the declining stage, and the number of White decreased, but the number of wing flapping was higher than WT, with a significant difference; from 21:30 to 22:00, the number of WT and White wing flapping was basically the same, with no difference. The results show that the peak period of wing flapping of the White mutant is delayed, which corresponds to the results of the group mating experiment ( Fig.14 ).

[0144] Example 10 Effect of pyrazine on attracting male and female white mutant Bactrocera dorsalis

[0145] Determination of Bdwhite using double-choice olfactory traps - / - And the tendency of WT to TMP. The experimental method is to use an acrylic transparent insect cage (18cm×24cm×14cm), and place a conical bottle inside as an insect trap. The conical bottle stopper is made of silicone with a circular through opening on it. A 1000μl pipette tip is used as the adult entry channel, and the tip of the pipette tip is cut off. Use paraffin oil as the solvent to prepare 100μg / μL TMP. A total of 100μL of TMP solution is dropped on a filter paper strip (1×2cm) and placed in the trap to ensure that the dose reaches 10mg. The trap bottle containing paraffin oil is used as a control. 30 Bdwhites are placed in the acrylic transparent insect cage. - / - Or WT females or males, observe their preference for trimethylpyrazine. Repeat 5 times. Calculation of trapping rate: trapping rate = number of insects in the trap / number of insects used in the experiment.

[0146] Results: Comparison of Bdwhite by double-choice trap experiments - / - and WT to trimethylpyrazine. - / - The tendency of male adults to trimethylpyrazine was much lower than that of WT. The number of WT trapped by trimethylpyrazine continued to increase every 20 minutes, while that of Bdwhite - / - There was no significant increase ( Fig.15 A) When trapping female insects, Bdwhite - / - There was no decrease in chemotaxis to TMP ( Fig.15B). Therefore, pyrazine reduced the attractant capacity of male white-eyed Bactrocera dorsalis, but had no effect on the attractant capacity of female white-eyed Bactrocera dorsalis.

[0147] Example 11 Effect of light on the tendency of female Bactrocera dorsalis to pyrazine

[0148] Procedure: The experimental method of measuring the tendency behavior of fruit flies to specific chemical substances was used to determine the attracting effect of pyrazines on female fruit flies. The experimental method is to use an acrylic transparent insect cage with a conical bottle placed inside as an insect trap. The conical bottle stopper is made of silicone and has a circular through opening on it. A 1000μl pipette tip is used as the adult entry channel, and the tip of the pipette tip is cut off. Two conical bottle traps are placed in one with 1mg trimethylpyrazine and the other with 10μl paraffin oil.

[0149] Results: Through the trap experiment, according to the results of the light on mating behavior, the tendency of female orange fruit flies to trimethylpyrazine was observed in the three representative light intensities of medium, low and high. The light intensity can reduce the number of orange fruit flies trapped. Within one hour of the initial placement (16:30-17:30), the low light intensity of 50lux successfully trapped the female orange fruit flies, and the control group did not trap the female orange fruit flies (p=0.0002). The medium light intensity of 2000lux and the high light intensity of 10000lux had no trapping effect, which was significantly lower than 50lux (p<0.0001, p<0.0001)( Fig.16 B). As the exposure time went by, female Bactrocera dorsalis was attracted under medium light intensity. Bactrocera dorsalis under 2000 lux was attracted between 17:30 and 21:30, and the number of attracted flies was always lower than 50 lux (p=0.0104, p=0.0149, p=0.0149, p=0.0237). Trimethylpyrazine had no effect on attracting female flies under 10000 lux intensity ( Fig.16 CDEF).

[0150] Obviously, those skilled in the art can make various changes and modifications to the present application without departing from the spirit and scope of the present application. Thus, if these modifications and variations of the present application fall within the scope of the claims of the present application and their equivalents, the present application is also intended to include these modifications and variations.

Claims

1. A method for luring male fruit flies, characterized in that: An effective amount of pyrazines is used as attractants, wherein the pyrazines include trimethylpyrazine and / or tetramethylpyrazine.

2. The method according to claim 1, characterized in that Further includes the combined use of other attractants or insecticides.

3. The method according to claim 2, characterized in that Other attractants are methyl eugenol.

4. A method for killing Bactrocera dorsalis, characterized in that: An effective amount of pyrazines is used as the insecticide, wherein the pyrazines include trimethylpyrazine and / or tetramethylpyrazine.

5. The method according to claim 4, characterized in that Further includes the combined use of other attractants or insecticides.

6. The method according to claim 5, characterized in that Other attractants are methyl eugenol.

7. Use of pyrazines as pesticides or insecticides, characterized in that: The pesticide or insecticide is used for preventing and controlling the fruit fly, and the pyrazine substance includes trimethylpyrazine and / or tetramethylpyrazine.

8. The use according to claim 7, characterized in that Further includes the combined use of other attractants or insecticides.

9. The use according to claim 8, characterized in that Other attractants are methyl eugenol.

Images