Application of circRBM33 as a target in the diagnosis and treatment of prostate cancer

Abstract

The present invention relates to the application of circRBM33 as a target in the diagnosis and treatment of prostate cancer. The present invention fully reveals the role of circRBM33 in cancer, especially prostate cancer cells, and the target genes regulated therefrom, clarifies the new mechanism of circRBM33 regulating prostate cancer, and finds the key target for inhibiting prostate cancer. The present invention conducts an in-depth study on the functional role of circRBM33 in the progression of prostate cancer, clarifies the effect of circRBM33 on the proliferation and migration ability of prostate cancer cells, and clarifies the effect of circRBM33 on the treatment of androgen receptor pathway inhibitors (ARSI). The present invention provides a new explanation of the progression mechanism of prostate cancer, provides a new idea for the later development of related drugs, clinical diagnosis and treatment, and has great social significance and market prospects.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine and relates to the application of circRBM33 as a target in the diagnosis and treatment of prostate cancer. Background Art

[0002] Prostate cancer (PCa) ranks second in incidence and fifth in mortality among male malignancies worldwide. Androgen deprivation therapy (ADT), which reduces androgen levels through surgery or drugs, is currently the cornerstone for the treatment of advanced prostate cancer. However, due to abnormal reactivation of the androgen receptor signaling pathway, all prostate cancers inevitably develop into castration resistant prostate cancer (CRPC) about 18 months after ADT treatment. Fortunately, a series of androgen receptor signaling inhibitors (AR signaling inhibitors, ARSIs), including androgen synthesis inhibitors (Abiraterone, etc.) and AR antagonists (Enzalutamide, Darolutamide, Apalutamide, etc.), have been used in the treatment of CRPC, significantly prolonging the survival of patients. However, even so, due to AR splicing variants or bypass activation, CRPC will eventually become less sensitive to ARSIs and gradually develop drug resistance.

[0003] N6-methyladenosine (m6A) is one of the most common modifications in mammalian mRNA. It is a reversible epigenetic regulation that includes three groups of catalytic enzymes, namely methyltransferases, demethylases, and m6A recognition proteins. METTL3 is the core catalytic unit of the methyltransferase complex, which has been reported to regulate the proliferation, metastasis, angiogenesis, and metabolism of various cancers. FTO is the first confirmed m6A demethylase, which was initially shown to play an important role in the aggressiveness of leukemia and was subsequently shown to play different roles in various solid cancers. In addition, m6A recognition proteins have a wide range of effects on the stability, degradation, translation, and other processes of their corresponding bound RNAs. For example, YTH DF1 can bind to the m6a modification site of EIF3C mRNA and increase its translation, thereby promoting the occurrence and metastasis of ovarian cancer.

[0004] In addition to modifying mRNA, m6A has also been found in many types of non-coding RNA, such as circular RNA (circRNA). CircRNA is a post-spliced ​​non-coding RNA that was previously thought to be a product of misprocessing. However, to date, more and more studies have shown that circRNA participates in the occurrence and pathogenesis of various diseases in different ways, such as acting as a miRNA sponge, interacting with proteins, and even translating new peptides. It is reported that m6A modification not only contributes to the synthesis and nucleocytoplasmic transport of circular RNA, but also promotes the interaction between circular RNA and proteins, and even confers circular RNA translation ability. Conversely, cir cRNA can also regulate m6A modification, such as circ0008399 interacting with WTAP, promoting the assembly of m6A complexes, and enhancing cisplatin resistance in bladder cancer. Therefore, the interaction between m6A modification and circRNA is complex, and therefore, it is urgent to find new therapeutic perspectives, screen circRNAs that are closely related to prostate cancer, and conduct in-depth studies on their mechanisms of action. Summary of the invention

[0005] The purpose of the present invention is to solve the technical problems existing in the prior art that the molecular mechanism of cancer, especially prostate cancer proliferation and metastasis is not clear enough and there is a lack of effective treatment methods, thereby studying the progression mechanism of prostate cancer and providing a new prevention, treatment and prognosis evaluation method for prostate cancer.

[0006] In order to solve the above technical problems, the present invention is implemented through the following technical solutions.

[0007] A first aspect of the present invention provides use of a circRBM33 inhibitor in the preparation of a product for preventing and / or treating prostate cancer.

[0008] Preferably, the circRBM33 inhibitor is selected from shRNA designed based on the circRBM33 gene.

[0009] Preferably, the shRNA designed based on the circRBM33 gene is selected from one or more of sh-C1 and sh-C2, wherein the sequence of sh-C1 is: ccggGATGAATTTACAATGA TGActcgagTCATCATTGTAAATTCATCttttttg, and the sequence of sh-C2 is: ccggGAATTT ACAATGATGACTTctcgagAAGTCATCATTGTAAATTCttttttg.

[0010] A second aspect of the present invention provides the use of a reagent for detecting the expression level of circRBM33 in the preparation of a product for auxiliary diagnosis and / or prognosis evaluation of prostate cancer.

[0011] Preferably, the reagent for detecting the expression level of circRBM33 includes a primer pair for detecting the expression level of the circRBM33 gene.

[0012] Preferably, the forward primer sequence of the primer pair is: GAATTGTATACTCAA GAGTACC, and the reverse primer sequence is: CTGGTCAAAGTCATCATTGTA.

[0013] It should be understood that, unless otherwise specified, in the context of the present invention, the primers and / or primer pairs refer to PCR primers used to synthesize the cDNA chain of the circRBM33 gene in PCR, thereby detecting the RNA expression level of the circRBM33 gene. In addition to the primers and / or primer pairs listed in the present invention, those skilled in the art are fully capable of designing corresponding primers and / or primer pairs based on the gene sequence of circ RBM33 using conventional methods in the art including but not limited to molecular biology, and screening the designed primers and / or primer pairs by conventional experimental means, as long as the specific detection of the expression level of circRBM33 can be achieved.

[0014] The third aspect of the present invention provides the use of a circRBM33 inhibitor in the preparation of a drug for promoting the sensitivity of androgen receptor signaling pathway inhibitors (ARSIs) to cancer treatment.

[0015] Preferably, the cancer is selected from prostate cancer.

[0016] Preferably, the androgen receptor signaling pathway inhibitor is selected from one or more of Enzalutamide, Darolutamide, Apalutamide, and Abiraterone.

[0017] Preferably, the circRBM33 inhibitor is selected from shRNA designed based on the circRBM33 gene.

[0018] Preferably, the shRNA designed based on the circRBM33 gene is selected from one or more of sh-C1 and sh-C2, wherein the sequence of sh-C1 is: ccggGATGAATTTACAATGA TGActcgagTCATCATTGTAAATTCATCttttttg, and the sequence of sh-C2 is: ccggGAATTT ACAATGATGACTTctcgagAAGTCATCATTGTAAATTCttttttg.

[0019] A fourth aspect of the present invention provides a pharmaceutical composition for preventing and / or treating prostate cancer, comprising a circRBM33 inhibitor and a FMR1 inhibitor.

[0020] Preferably, the circRBM33 inhibitor is selected from shRNA designed based on the circRBM33 gene; and the FMR1 inhibitor is selected from siRNA designed based on the FMR1 gene.

[0021] Preferably, the shRNA designed based on the circRBM33 gene is selected from one or more of sh-C1 and sh-C2, wherein the sh-C1 sequence is: ccggGATGAATTTACAATGA TGActcgagTCATCATTGTAAATTCATCttttttg, and the sh-C2 sequence is: ccggGAATTT ACAATGATGACTTctcgagAAGTCATCATTGTAAATTCttttttg; the siRNA designed based on the FMR1 gene is selected from one or more of si-1 and si-2, wherein the si-1 sequence is CCAGAAGACUUACGGCAAATT, and the si-2 sequence is GCAUCAAAUGCUUCUGAAATT.

[0022] The fifth aspect of the present invention provides the use of the above-mentioned pharmaceutical composition in the preparation of a drug for preventing and / or treating prostate cancer.

[0023] The inventors of the present invention have found through research that circRBM33 is significantly increased in prostate cancer cells, and the increase is associated with a poor prognosis in prostate cancer patients; the biochemical recurrence-free (BCR-free) time of prostate cancer patients with higher circRBM33 expression is significantly shorter than that of patients with higher circRBM33 expression; at the same time, inhibition of cir cRBM33 can significantly inhibit the proliferation and migration of prostate cancer cells in vivo and in vitro. Clinical sample detection shows that the expression level of circRBM33 is positively correlated with the Gleason score, and high expression of circ RBM33 indicates that the BCR-free survival period of prostate cancer patients is poor. In addition, the present invention also clarifies that the expression level of circRBM33 has a significant effect on the therapeutic effect of ARSI. When the level of circRBM33 in cells is reduced by inhibiting the expression of circRBM33, the sensitivity of PCa to ARSIs treatment can be effectively increased.

[0024] As a new epigenetic modification, RNA m6A is widely present in various types of RNA, and a large number of studies have reported that m6A modification is involved in the biogenesis and multiple functions of circRNA, such as METTL3 mediating m6A modification of circIGF2BP3 to make it circularized. Here, the present invention focuses on the relationship between m6A modification and circRNA, and studies their functional role in the progression of prostate cancer, confirming that circRBM33 is methylated by MET TL3 and then interacts with FMR1 in an m6A manner. FMR1 has no effect on the stability of circRNA, but forms a binary complex with circRBM33 to regulate downstream target molecules. A large number of studies have shown that FMR1 protein deficiency is closely related to fragile X chromosome syndrome (including mental retardation, abnormal behavior, etc.). At present, more and more evidence shows that FMR1 plays an important role in tumorigenesis and metastasis. The results of the present invention also consistently show that silencing FMR1 can also inhibit the growth and migration of prostate cancer cells; clinical sample detection also suggests that high expression of FMR1 indicates a shorter progression-free survival in prostate cancer patients. The research of the present invention shows that the protein expression level of FMR1 is positively correlated with the expression level of circRBM33, circ RBM33 interacts with FMR1 through the m6A mode to form a binary complex, and then binds to PDHA1mRNA to enhance its stability and increase translation output, thereby enhancing mitochondrial respiration and promoting PCa growth and metastasis; and by inhibiting circRBM33 and / or FMR1, the progression of prostate cancer can be effectively inhibited.

[0025] Compared with the prior art, the present invention has the following technical effects:

[0026] (1) The present invention has conducted in-depth research on the pathogenesis and development mechanism of prostate cancer and found that the expression level of circRBM33 is a factor highly correlated with prostate cancer. Furthermore, by detecting circRBM33 in the subject's body and obtaining its expression level index, the probability of the subject suffering from prostate cancer can be effectively predicted. That is, the expression level of circRBM33 can be used as a biomarker for clinical auxiliary diagnosis of prostate cancer. When the expression level of prostate cancer is significantly increased, it can be determined that the subject is a prostate cancer patient or a high-risk group for prostate cancer, which can effectively prevent the rapid development and deterioration of the disease from causing irreversible health damage to the patient.

[0027] (2) By detecting the expression level of circRBM33 in prostate cancer patients, we can make a reasonable prediction of the degree of tumor differentiation in patients, thereby providing personalized treatment plans to improve clinical treatment effects; we can also make a reasonable assessment of the patient's prognosis and provide reasonable and effective guidance for treatment and rehabilitation. At the same time, by inhibiting the expression of circRBM33, the sensitivity of prostate cancer to ARSIs treatment can be effectively improved.

[0028] (3) The present invention clarifies that inhibiting the expression of circRBM33 can have a significant inhibitory effect on prostate cancer cells, and also clarifies that circRBM33 interacts with FMR1 through m6A to form a binary complex, thereby affecting the progression of prostate cancer; inhibiting cir cRBM33 and / or FMR1 can effectively inhibit the progression of prostate cancer. The present invention provides a new drug treatment target for humans to conquer prostate cancer, provides a new direction for finding new tumor markers or new treatment strategies related to prostate cancer diagnosis, and is helpful for subsequent drug development, clinical treatment, etc., and has important scientific significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Schematic diagram of the MeRIP experimental results of circRBM33 in two prostate cancer cell lines.

[0030] Figure 2 Schematic diagram of the results of convergent and divergent primer amplification experiments performed in four prostate cancer cell lines.

[0031] Figure 3 Schematic diagram of the results of RNase R tolerance experiments conducted in four prostate cancer cell lines.

[0032] Figure 4 Schematic diagram of the experimental results of actinomycin D in two prostate cancer cell lines.

[0033] Figure 5 Schematic diagram of the KM analysis results of circRBM33 expression levels in prostate cancer patients.

[0034] Figure 6 Schematic diagram of the expression levels of circRBM33 in different cell lines.

[0035] Figure 7 Schematic diagram of the results of overexpression or inhibition of circRBM33 in cells.

[0036] Figure 8 Schematic diagram of the effect of inhibiting circRBM33 on the proliferation of prostate cancer cells.

[0037] Fig. 9 Schematic diagram of the effect of inhibiting circRBM33 on prostate cancer cell clone formation.

[0038] Fig.10 Schematic diagram of the effect of inhibiting circRBM33 on prostate cancer cell migration.

[0039] Fig.11 Schematic diagram of the effect of circRBM33 overexpression on prostate cancer cell proliferation.

[0040] Fig.12 Schematic diagram of the effect of circRBM33 overexpression on prostate cancer cell clone formation.

[0041] Fig.13 Schematic diagram of the effect of circRBM33 overexpression on prostate cancer cell migration.

[0042] Fig.14 Schematic diagram of the effect of circRBM33 on subcutaneous tumor growth in mice.

[0043] Fig.15 Schematic diagram of the effect of inhibiting circRBM33 on the therapeutic activity of ARSIs.

[0044] Fig.16 Schematic diagram of the effects of inhibiting circRBM33 combined with Enzalutamide on subcutaneous tumor growth in mice.

[0045] Fig.17 Schematic diagram of the effects of inhibiting circRBM33 combined with Darolutamide on subcutaneous tumor growth in mice.

[0046] Fig.18 Schematic diagram of the FISH sublocalization results of circRBM33 in two prostate cancer cell lines.

[0047] Fig.19 Schematic diagram of the expression results of circRBM33 in the nucleus and cytoplasm in two prostate cancer cell lines.

[0048] Fig. 20 Schematic diagram of the co-localization experimental results of circRBM33 and FMR1.

[0049] Fig.21 Schematic diagram of the ChIRP analysis results of circRBM33 and FMR1.

[0050] Fig. 22 Schematic diagram of the RIP analysis results of FMR1 in prostate cancer cells.

[0051] Fig.23 MeRIP analysis was performed to confirm the role of METTL3 in m6A modification of circRBM33.

[0052] Fig.24 FMR1-RIP assay was performed to confirm that circRBM33 interacted with FMR1 in an m6A-dependent manner.

[0053] Fig.25 Schematic diagram of WB results of FMR1 inhibition using siRNA.

[0054] Fig.26 Schematic diagram of the effect of inhibiting FMR1 on the proliferation of prostate cancer cells.

[0055] Fig. 27 Schematic diagram of the effect of inhibiting FMR1 on prostate cancer cell clone formation.

[0056] Fig.28 Schematic diagram of the effect of inhibiting FMR1 on the migration of prostate cancer cells.

[0057] Fig.29 Schematic diagram of DFS analysis results for prostate cancer patients with different FMR1 expression levels.

[0058] Fig.30 Schematic diagram of the expression levels of circRBM33 in prostate cancer tissues with different Gleason scores.

[0059] Fig.31 Schematic diagram of the results of FMR1 immunohistochemical analysis of prostate cancer tissues with different Gleason scores.

[0060] Fig.32 Schematic diagram of the differences in FMR1 scores in prostate cancer tissues with different circRBM33 expression levels.

[0061] Fig.33Schematic diagram of the results of using the chi-square test to confirm the correlation between circRBM33 and FMR1 expression.

[0062] Fig.34 Schematic diagram of the effect of FMR1 knockdown on the expression of PDHA1 in circRBM33 overexpressing cells.

[0063] Fig.35 Schematic diagram of the effects of circRBM33 and FMR1 on prostate cancer cell proliferation.

[0064] Fig.36 Schematic diagram of the effects of circRBM33 and FMR1 on prostate cancer cell clone formation.

[0065] Fig.37 Schematic diagram of the effects of circRBM33 and FMR1 on prostate cancer cell migration. DETAILED DESCRIPTION

[0066] In order to make the purpose, technical scheme and effect of the present invention clearer and more specific, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0067] Unless otherwise specified, the prostate cancer cell lines listed in the context of the present invention, including PC-3, C4-2, DU145, 22Rv1, etc., were purchased from BeNa Culture Collection, wherein C4-2 and 22Rv1 were cultured in RPMI-1640 medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin; PC-3 and DU145 were cultured in DMEM medium containing 10% fetal bovine serum and 1% penicillin-streptomycin. RWPE-1 was purchased from iCell Bioscience and cultured in a keratinocyte serum-free medium (K-SFM) containing 0.05 mg / mL bovine pituitary extract and 5 ng / mL human recombinant epidermal growth factor. All cell lines were identified by short tandem repeat analysis of the China Center for Type Culture Collection (Wuhan), and the presence of mycoplasma contamination was verified using a PCR detection kit (Shanghai Biothrive Sci), and were frozen in liquid nitrogen and used for subsequent experiments. The reagents used in the present invention were all commercially available. For the use of clinical specimens, informed consent was signed with the patients, and the relevant procedures and methods were in compliance with medical ethics requirements and drug clinical trial quality management standards, and were approved by the Ethics Committee of Zhujiang Hospital of Southern Medical University. The experimental methods used in the present invention, such as bioinformatics analysis, nucleic acid extraction, transcriptome sequencing, primer design, tumor cell culture, PCR, lentiviral vector construction, cell transfection, Western blot, molecular cloning, small molecule interference technology, immunohistochemistry, immunofluorescence staining, cell proliferation experiment, cell migration experiment, cell clone formation experiment, fluorescence in situ hybridization experiment, methylated RNA immunoprecipitation experiment, RIP experiment, etc. are all conventional methods and techniques in the field, and the animal experiments were carried out with the approval of the Animal Protection Committee of Zhujiang Hospital of Southern Medical University.

[0068] Representative results from repeated biological experiments were presented in the context figures, and the data were presented as mean ± SD and mean ± SEM as specified in the figures. All experiments were repeated at least three times. The data were analyzed using GraphPad Prism 9.0 or SPSS 20.0 software. Conventional medical statistical methods such as t-test, chi-square test, rank sum test, and analysis of variance were used to compare the mean differences between two or more groups. p < 0.05 was considered to be significant.

[0069] Example 1 Screening of targets related to prostate cancer

[0070] In order to identify the types of m6A-related circRNAs that can be used for prostate cancer treatment and prognosis assessment, we first obtained the expression matrix of all circRNAs in prostate cancer patient tissues and screened out circRNAs with high abundance characteristics (FPKM < 0.5). Subsequently, circular RNAs related to biochemical recurrence of prostate cancer were screened out from the circRNA data containing follow-up data, and a total of 1,382 circRNAs that met the criteria were screened; next, methylated RNA immunoprecipitation sequencing (MeRIP) experiments were performed using prostate cancer cells to study the m6A-related circRNA spectrum. The specific steps are as follows:

[0071] (1) MeRIP detection was performed using a methylated RNA immunoprecipitation kit (BersinBio, Bes5203) and an RNA immunoprecipitation kit (BersinBio, Bes5101). Total RNA was isolated using Trizol and separated to approximately 300 bp using an ultrasonic cell disruptor.

[0072] (2) The RNA fragments were co-immunoprecipitated with anti-N6-methyladenosine antibody in a vertical rotator at 4°C for 4 h, incubated with protein A / G beads for 1 h, and eluted with proteinase K at 55°C for 45 min to obtain m6A-modified RNA.

[0073] (3) The collected cells were lysed on ice with lysis buffer and DNA was removed with DNase. Subsequently, anti-m6A antibody was used for immunoprecipitation at 4°C for 4 h, incubated with protein A / G beads for 1 h, eluted with proteinase K at 55°C for 45 min, and finally the obtained RNA samples were detected by transcriptome next-generation sequencing technology.

[0074] A total of 355 circRNAs related to m6A were obtained through the above MeRIP-seq; finally, a circRNA related to m6A with prognostic value, namely circRBM33 (hsa_circ_0001771), was obtained through the Venn diagram. The gene encoding circRBM33 is located on chromosome 7, and the transcript sequence contains 4 exons (i.e., exons 2, 3, 4, and 5), which are reverse spliced ​​from exons 2 and 5. Motif analysis was performed on the MeRIP-seq data to identify possible m6A binding sites, and two of the motifs were found to be potential targets.

[0075] Subsequently, m6A-RNA immunoprecipitation (MeRIP) experiments were performed to determine whether circRBM33 could be modified by m6A. Figure 1As shown. The results showed that in two prostate cancer cell lines (22Rv1, C4-2), circRBM33 fragments appeared in the m6a antibody lane and the Input lane but not the IgG lane, indicating that circRBM33 can be modified by m6a. To further verify the above results, PCR amplification was performed using convergent and divergent primers in cDNA and gDNA samples of four prostate cancer cell lines. The results showed that in the four prostate cancer cell lines, circRBM33 could only be amplified in cDNA but not in gDNA (see Figure 2 Next, an RNase R tolerance experiment was performed to compare the stability of circRBM33 and linear RBM33. The specific steps are as follows:

[0076] (1) Four prostate cancer cell lines were treated with 2 mg / mL actinomycin D (Sigma, USA) at 0, 6, 12, and 24 h isocratic time points.

[0077] (2) Collect total RNA from corresponding cell samples; add RNase R (2 U / μg RNA) and digest at 37°C for 30 min.

[0078] (3) The expression levels of the above genes were detected by qPCR.

[0079] The results showed that circRBM33 was more stable than linear RBM33 after RNase R treatment (see Figure 3 On the other hand, the actinomycin D assay also showed that circRBM33 was more stable than linear RBM33 (see Figure 4 ), the results are consistent with the above.

[0080] After clarifying the basic properties of circRBM33, it is necessary to clarify whether it can play a key role in prognostic evaluation in prostate cancer. To this end, the Kaplan-Meier (KM) method was used to analyze the expression of circRBM33 in a public prostate cancer patient cohort for survival prognosis. PCa patients were divided into two subgroups according to the median expression of circRBM33: the cir cRBM33 high expression group and the circRBM33 low expression group. The results are as follows: Figure 5As shown. The results showed that, therefore, the BCR-Free survival rate of the circRBM33 high expression group was significantly worse than that of the circRB M33 low expression group (p < 0.05). Through the study of the relationship between the expression level of circRBM33 and some clinical pathological characteristics of prostate cancer, it was found that the expression level of circRBM33 was positively correlated with the Gleason score and tumor progression to a certain extent (not shown in the figure). Based on the above studies, it can be made clear that circRBM33 can be modified by m6A and can be used as a key indicator for evaluating the BCR prognosis of prostate cancer.

[0081] Example 2 Study on the expression of circRBM33 in prostate cancer cells

[0082] To determine the potential role of circRBM33 in PCa in vitro and in vivo, we first detected the expression level of circRBM33 in four prostate cell lines by qPCR. Figure 6 As shown. The results showed that circRBM33 was lowly expressed in normal prostate tissue cells, but significantly highly expressed in prostate cancer cells (**p<0.01, ****p<0.0001). Among the four prostate cancer cell lines, 22Rv1 and DU145 cells showed very significant high expression levels of circRBM33, while C4-2 and PC-3 cells showed relatively low expression levels. In this regard, shRNAs were designed based on the circRBM33 sequence, namely shC1 (sequence: ccggGATGAATTTACAATGATGActcgagTCATCATTGTAAATTCATCttttttg) and shC2 (sequence: ccggGAATTTACAATGATGACTTctcgagAAGTCATCATTGTA AATTCtttttg), which were transfected into 22Rv1 and DU145 cells to silence the expression of circRBM33, and sh-NC (empty vector) was used as a negative control; at the same time, lentiviral vectors were used to overexpress circRBM33 in C4-2 and PC-3 cells, and ciR5 was used as a negative control. The results are shown in Figure 2. Figure 7 As shown in the figure, the results showed that sh-C1 and sh-C2 could successfully inhibit the expression of circRBM33 and reduce the level of circRBM33 in cells; the expression level of circRBM33 in C4-2 and PC-3 cells after lentiviral transfection was significantly increased. It was also found that at the transcriptional level, lentiviral transfection only had a regulatory effect on the expression level of circRBM33, but had no effect on linear RBM33 (not shown in the figure).

[0083] Example 3 Effects of circRBM33 on prostate cancer behavior and function in vivo and in vitro

[0084] From the above examples, it can be expected that circRBM33 may have a certain promoting effect on the progression of prostate cancer, that is, circRBM33 plays the role of a cancer-promoting factor in the progression of prostate cancer. In order to verify this conclusion, a series of in vitro experiments were performed to support it.

[0085] By designing shRNA targeting circRBM33, we studied its effect on prostate cancer cell proliferation. The specific steps are as follows:

[0086] (1) ShRNAs targeting circRBM33 (sh-C1 and sh-C2) were transfected into 22Rv1 and DU145 cells, respectively;

[0087] (2) When the cells grow to the logarithmic phase, trypsinize and count them, select the appropriate cell density according to the doubling time of various cells, and inoculate them into 96-well plates (3 replicates);

[0088] (3) The cells were cultured in a 37°C incubator and CCK-8-containing culture medium was added at a ratio of CCK-8: culture medium (10 μL:90 μL) at 24 h, 48 h, 72 h, and 96 h, respectively. The culture plates were incubated in the incubator for 2 h, and the absorbance at 450 nm was measured to evaluate the cell proliferation.

[0089] The results are as follows Figure 8 The results showed that after silencing circRBM33 using shRNA, the proliferation ability of prostate cancer cells was significantly weakened, which could significantly inhibit the growth of prostate cancer cells and significantly reduce the proliferation activity of prostate cancer cells. The difference was statistically significant (**p<0.01).

[0090] Subsequently, the effect of shRNA targeting circRBM33 on the clonogenicity of prostate cancer cells was studied as follows:

[0091] (1) ShRNAs targeting circRBM33 (sh-C1 and sh-C2) were transfected into 22Rv1 and DU145 cells, respectively;

[0092] (2) When the cells grow to the logarithmic phase, trypsinize and count them. According to the doubling time of various cells, the appropriate cell density is selected and the cells are inoculated into a six-well plate containing 2 mL of 37°C pre-warmed culture medium. The plates are gently shaken back and forth and left and right to evenly disperse the cells and cultured in a cell culture incubator at 37°C containing 5% CO2;

[0093] (3) When clones visible to the naked eye appear in the culture dish, terminate the culture, discard the supernatant, carefully rinse twice with PBS, add 1 mL of methanol containing 0.5% crystal violet to each well, and stain for 30 min; discard the methanol and wash the remaining methanol with water; cell clones can be observed; observe under a microscope, and a valid clone is counted when the number of cells is greater than 50.

[0094] Test results such as Fig. 9 The results showed that compared with the blank vector sh-NC group, after silencing circRBM33 with shRNA, the cloning ability of prostate cancer cells was significantly weakened, and the cloning of prostate cancer cells was significantly inhibited, with statistically significant differences (**p<0.01, ***p<0.001).

[0095] Furthermore, the effect of shRNA targeting circRBM33 on the migration of prostate cancer cells was studied. The specific steps are as follows:

[0096] (1) When the cells grow to the logarithmic phase, trypsinize and count them, select the appropriate cell density according to the doubling time of various cells, dilute the cells with serum-free medium to prepare a cell suspension;

[0097] (2) Add 200 μL of cell suspension to each well in the upper chamber, and add 500 μL of culture medium containing 10% FBS to the lower chamber, and place in a 37°C incubator for culture;

[0098] (3) After 24 / 48 hours, remove the membrane, remove excess liquid from the upper chamber, wash twice with PBS, and gently rotate the membrane in the upper chamber with a cotton swab to absorb water and wipe off cells on the inner side of the membrane;

[0099] (4) Add 0.5% crystal violet dye solution to the upper chamber and dye for 20 min. Recover the dye solution and slowly rinse it with PBS. Use a cotton swab to gently rotate in the upper chamber again to absorb the water.

[0100] (5) Place a glass slide on an upright microscope, invert the cell chamber on the slide, take a picture at 100x field of view, and count the top, bottom, left, right, and middle of the membrane.

[0101] Test results such as Fig.10 The results showed that, compared with the blank vector sh-NC group, the use of shRNA to inhibit the expression level of circRBM33 in cells significantly inhibited the migration ability of prostate cancer cells in both 22Rv1 cells and DU145 cells, and the difference was statistically significant (**p<0.01, ***p<0.001).

[0102] Subsequently, PC-3 and C4-2 cells were transfected with the lentiviral transfection method in Example 2, and the above cell proliferation, clone formation and cell migration experiments were repeated. The results were as follows: Figure 11-13 As shown. The results showed that after lentiviral transfection, the expression level of circRBM33 in PC-3 and C4-2 was significantly increased, and the overexpression of circRBM33 significantly increased the proliferation activity, clone formation level and migration ability of prostate cancer (**p<0.01, ***p<0.001). Based on the above results, it can be clearly seen that circRBM33 has a significant effect on the functional activity of prostate cancer cells. By inhibiting the expression of circRBM33, the proliferation, cloning and metastasis of prostate cancer can be effectively inhibited. When circRBM33 is overexpressed, it can significantly promote the proliferation, cloning and metastasis of prostate cancer. It can be seen that cir cRBM33 is a key target closely related to the progression of prostate cancer. By intervening in it, the progression of prostate cancer can be effectively inhibited.

[0103] In order to study the effect of circRBM33 on prostate cancer in vivo, 4-week-old BALB / c-nu mice were selected for in vivo experiments. The specific steps are as follows:

[0104] First, tumor volume was measured every 3 days after day 7, and at the end of day 28, all mice were sacrificed for dissection and tumor measurement.

[0105] (1) One day before the experiment, place the already packaged Matrigel from -20°C into a 4°C refrigerator overnight to melt it from a solid state to a liquid state.

[0106] (2) Twenty 4-week-old BALB / c-nu mice were randomly divided into 4 groups, designated as Group 1 to Group 4, and circRBM33 upregulated or circRBM33 silenced prostate cancer cells mixed with Matrigel were subcutaneously injected into the back of the mice, respectively. Among them, mice in Group 1 were subcutaneously injected with circRBM33 overexpressing PC-3 cells, mice in Group 2 were subcutaneously injected with 3_ciR5-containing PC-3 as a negative control, mice in Group 3 were subcutaneously injected with circRBM33 expression-inhibited 22Rv1 cells, and mice in Group 4 were subcutaneously injected with sh-NC-containing 22Rv1 cells as a negative control.

[0107] (3) The growth and mental state of the mice were observed daily. The tumor size of each group of mice was measured every 3 days after 7 days of injection, and the tumor volume was calculated using the following formula: Volume (mm 3 )=Length(mm)×Width 2 (mm 2 ) / 2.

[0108] (4) On the 28th day, the mice were killed by overdose of anesthesia, and the tumors of each group of mice were removed, photographed, and measured in volume.

[0109] The experimental results are as follows Fig.14 The results showed that overexpression of circRBM33 significantly upregulated tumor volume and growth rate, while inhibition of circRBM33 expression effectively hindered tumor progression.

[0110] Existing studies have found that castration-resistant prostate cancer cells have a stronger mitochondrial metabolic capacity, which leads to increased oxidative phosphorylation, making them vulnerable to mitochondrial metabolic treatments. Given that circRBM33 has an indirect effect on mitochondrial respiration, we evaluated whether silencing cir cRBM33 would affect the sensitivity of PCa cells to ARSIs. To evaluate the response of PCa cells to ARSIs, two ARSIs, Enzalutamide and Darolutamide (see Fig.15 ). As the drug concentration increased, the growth of prostate cancer cells showed a downward trend. In contrast, in cells where circRBM33 expression was inhibited, cell growth was more significantly inhibited, indicating that circRBM33 can effectively enhance the therapeutic effect of ARS I on prostate cancer.

[0111] Subsequently, circRBM33 expression suppression cells (sh-C1) and negative control cells (sh-NC) were subcutaneously injected into BALB / c-nu mice to induce xenograft tumors. After the tumors were formed, the mice were randomly divided into two groups and treated with Enzalutamide and DMSO by gavage, respectively. The status of the mice was regularly monitored and the tumor volume of the mice was measured. The mice were killed one month later, and the tumor growth curve of the mice was drawn, and the weight and volume of the mice were measured. The experimental results are shown in Fig.16 The results showed that, consistent with the previous experiment, downregulating the expression of circRBM33 could effectively inhibit the growth of tumors in mice compared with the negative control group; at the same time, the inhibition of cir cRBM33 expression could more effectively increase the anti-tumor activity of Enzalutamide. The above experiment was repeated using Darolutamide, and the results obtained were similar (Participants Fig.17 ), which proves that the therapeutic effect of ARSIs can indeed be improved by inhibiting circRBM33.

[0112] Example 4 Study on the mechanism of action of circRBM33

[0113] In order to explore how circRBM33 affects prostate cancer, we conducted an in-depth study on its mechanism of action. First, FISH (Fluorescence in Situ Hybridization) was used to detect the subcellular localization of circRBM33 in cells. Cy3-labeled circRBM33 and 18S probe (cytoplasmic indicator) were synthesized by GenePharm. The kit used in the experiment was RiboTM Fluorescence in Situ Hybridization Kit (RIBOBI O, C10910). The specific experimental steps are as follows:

[0114] (1) Prostate cancer cells (PC-3, C4-2) were fixed with 4% paraformaldehyde and then perforated with pre-cooled 1% Triton.

[0115] (2) Incubate the cells in pre-hybridization buffer at room temperature for 30 min and incubate the cells overnight at 37°C with hybridization buffer mixed with 20 μM probe.

[0116] (3) The cells were washed with 4×SSC, 0.1% Tween-20, 2×SSC and 1×SSC buffers in sequence, and stained with an anti-fluorescence quencher (P0131) containing DAPI.

[0117] The results are as follows Fig.18 The results showed that circRBM33 was mainly localized in the cytoplasm of prostate cancer cells. In addition, the results of the nuclear cytoplasm separation and extraction experiment were consistent with the above FISH results: circRBM33 was mainly localized in the cytoplasm (see Fig.19 ).

[0118] Subsequently, bioinformatics analysis using catRAPID and CircInteractome revealed that FMR1 (also known as FMRP (Fragile X Mental Retardation Protein)) may interact with circRBM33. In this regard, FISH experiments were performed to co-localize circRBM33 and FMR1. The specific steps are as follows:

[0119] (1) Prostate cancer cells (PC-3, C4-2) were fixed with 4% paraformaldehyde and then perforated with pre-cooled 1% Triton.

[0120] (2) Incubate the cells in pre-hybridization buffer at room temperature for 30 min and incubate the cells overnight at 37°C with hybridization buffer mixed with 20 μM probe.

[0121] (3) The cells were washed with 4×SSC, 0.1% Tween-20, 2×SSC and 1×SSC buffers in sequence, blocked with 1% bovine serum albumin (BSA) solution at room temperature for 30 minutes, and then incubated with anti-FMR1 primary antibody at 4°C overnight.

[0122] (4) The cells were incubated with secondary antibodies labeled with Coralite488 (Proteintech, SA00013), stained with DAPI, and colocalized using a confocal imaging system (ZEISS, LSM 900). The results showed that circRBM33 and FMR1 may indeed interact (see Fig. 20 ).

[0123] In order to verify whether FMR1 is one of the molecules interacting with circRBM33, a probe targeting circRBM33 was designed for ChIRP analysis (BersinBio, Bes5104) to lock in the molecules interacting with circRBM33. The specific steps are as follows:

[0124] (1) Collect cells, cross-link with 4% formaldehyde solution, and neutralize with glycine at room temperature.

[0125] (2) Lyse the cells using a lysis buffer containing protease and RNase inhibitors.

[0126] (3) The cell lysate was disrupted by ultrasound and pre-cleared with agarose beads at 4°C.

[0127] (4) The probe targeting circRBM33 and the negative control probe were hybridized with the cell lysate and incubated with streptavidin magnetic beads.

[0128] (5) The pulled-down RNA and protein samples were identified by qRT-PCR and WB, respectively.

[0129] Test results such as Fig.21 The results showed that the RNA isolated from the ChIRP sample was circRM33, and the protein isolated from the ChIRP sample was detected by WB, and FMR1 was found to be one of the RBPs of circRBM33. Subsequently, the RIP detection of anti-FMR1 confirmed the molecular binding between FMR1 and circRBM33 (see Fig. 22 ).

[0130] Since METTL3 is one of the most important regulatory factors in m6A modification, we silenced the expression of METTL3 using sh-METTL3 (sequence: ccggGCTGCACTTCAGACGAATTATctcgagATAATT CGTCTGAAGTGCAGCtttttt) to study whether circRBM33 interacts with FMR1 in an m6A-dependent manner. The results showed that when the expression level of METTL3 was downregulated, M1 and M2 containing the potential binding site sequence of circRBM33 could not be detected in the MeRIP samples, indicating that METTL3 is involved in the m6A modification of circRBM33 (see Fig.23 ). Subsequent FMR1-RIP experimental results showed that inhibiting the expression of METTL3 disrupted the binding between FMR1 and circRBM33 (see Fig.24 ), which clearly showed that MET TL3 was involved in the interaction between FMR1 and circRBM33, demonstrating that circRBM33 interacted with FMR1 in an m6A-dependent manner.

[0131] Example 5

[0132] The aforementioned implementation case verified that circRBM33 interacts with FMR1. In order to clarify whether FMR1 affects the progression of prostate cancer, 22Rv1 and DU145 cells were transfected with siRNA (si-1, si-2, where the si-1 sequence is CCAGAAGACUUACGGCAAAT T, the si-2 sequence is GCAUCAAAUGCUUCUGAAATT, and si-NC is a blank control) to construct cells with FMR1 expression silencing (see Fig.25 ). Subsequently, the effects of siRNA targeting FMR1 on the proliferation, clone formation and migration of prostate cancer cells were studied. For specific steps, see Example 3.

[0133] The results are as follows Figure 26-28As shown. The results of the cell proliferation experiment showed that after silencing FMR1 with siRNA, the proliferation ability of prostate cancer cells was significantly weakened, which could significantly inhibit the growth of prostate cancer cells, and the proliferation activity of prostate cancer cells was significantly reduced, and the difference was statistically significant. The results of the clone formation experiment showed that compared with the blank vector si-NC group, after silencing FMR1 with siRNA, the clone formation ability of prostate cancer cells was significantly weakened, which could significantly inhibit the clone formation of prostate cancer cells, and the difference was statistically significant (***p<0.001, ****p<0.0001). The results of the cell migration experiment showed that for both 22Rv1 cells and DU145 cells, compared with the blank vector si-NC group, after inhibiting the expression level of FMR1 in cells with siRNA, the migration ability of prostate cancer cells was significantly inhibited, and the difference was statistically significant (**p<0.01, ***p<0.001).

[0134] Analysis of clinical samples revealed that patients with low FMR1 expression levels had better DFS than those with high FMR1 expression levels, suggesting that FMR1 is associated with a poor prognosis in prostate cancer (see Fig.29 ). Further analysis found that the expression level of circRBM33 in tumor tissues of prostate cancer patients was significantly higher than that in normal tissues, and the higher the Gleason score, the higher the expression of circRBM33 (see Fig.30 ). Immunohistochemistry results showed that the level of FMR1 in tumor tissue was significantly higher than that in normal tissue, and the more severe the malignancy, the higher the expression of FMR1 (see Fig.31 In addition, there was a significant difference in FMR1 scores between the circRBM33 low expression group and the circRBM33 high expression group (see Fig.32 ). The tumor tissues of patients with high circRBM33 expression group had higher FMR1 scores than those of patients with low circRBM33 expression group. In this regard, the chi-square test confirmed that circRBM33 and FMR1 were significantly positively correlated in prostate cancer (see Fig.33 ). It can be assumed that circRBM33 may interact with FMR1 to form a complex, thereby jointly exerting its tumor-promoting effect in PCa, and inhibition of circRBM33 and / or FMR1 will effectively inhibit the progression of prostate cancer.

[0135] To test the above hypothesis, we knocked down FMR1 using siRNA in prostate cancer cells overexpressing circRBM33 to investigate the role of FMR1 in the malignant phenotype mediated by circRBM33. Fig.34As shown in the results, FMR1 knockout can significantly inhibit the expression of PDHA1 in circRBM33 overexpressing cells. A series of cell experiments confirmed that the reduction of FMR1 expression can effectively inhibit the proliferation, colony formation and migration ability of prostate cancer cells, and has a significant reversal effect on the functional changes of prostate cancer cells caused by circRBM33 overexpression (see Figure 35-37 ).

[0136] Based on the above results, the present invention fully reveals the role of circRBM33 in cancer, especially prostate cancer cells, and the target genes regulated by it, clarifies the new mechanism of circRBM33 regulating prostate cancer, and finds the key target for inhibiting prostate cancer. The present invention conducts in-depth research on the functional role of circRBM33 in the progression of prostate cancer, clarifies the effect of circRBM33 on the proliferation and migration ability of prostate cancer cells, and clarifies the effect of circRBM33 on the treatment of ARSIs. The present invention provides a new explanation of the progression mechanism of prostate cancer, provides a new idea for the later development of related drugs, clinical diagnosis and treatment, and has great social significance and market prospects.

[0137] The above specific implementation method part specifically introduces the analytical method involved in the present invention. It should be noted that the above introduction is only to help those skilled in the art better understand the method and ideas of the present invention, rather than limiting the relevant content. Without departing from the principle of the present invention, those skilled in the art may also make appropriate adjustments or modifications to the present invention, and the above adjustments and modifications shall also fall within the scope of protection of the present invention.

Claims

1. Use of a circRBM33 inhibitor in the preparation of a product for preventing and / or treating prostate cancer, characterized in that: The circRBM33 inhibitor is selected from shRNA designed based on the circRBM33 gene; the shRNA designed based on the circRBM33 gene is selected from one or more of sh-C1 and sh-C2, wherein the sh-C1 sequence is: ccggGATGAATTTACAATGATGActcgagTCATCATTGTAAATTCATCttttttg, and the sh-C2 sequence is: ccggGAATTTACAATGATGACTTctcgagAAGTCATCATTGTAAATTCttttttg.

2. Use of a reagent for detecting the expression level of circRBM33 in the preparation of a product for auxiliary diagnosis and / or prognosis evaluation of prostate cancer, characterized in that: The reagent for detecting the expression level of circRBM33 includes a primer pair for detecting the expression level of the circRBM33 gene; the forward primer sequence of the primer pair is: GAATTGTATACTCAAGAGTACC, and the reverse primer sequence is: CTGGTCAAAGTCATCATTGTA.

3. Use of a circRBM33 inhibitor in the preparation of a drug for promoting the sensitivity of androgen receptor signaling pathway inhibitors to the treatment of prostate cancer, characterized in that: The circRBM33 inhibitor is selected from shRNA designed based on the circRBM33 gene; the shRNA designed based on the circRBM33 gene is selected from one or more of sh-C1 and sh-C2, wherein the sh-C1 sequence is: ccggGATGAATTTACAATGATGActcgagTCATCATTGTAAATTCATCttttttg, and the sh-C2 sequence is: ccggGAATTTACAATGATGACTTctcgagAAGTCATCATTGTAAATTCttttttg; the androgen receptor signaling pathway inhibitor is selected from one or more of enzalutamide and darolutamide.

4. A pharmaceutical composition for preventing and / or treating prostate cancer, characterized in that: It includes a circRBM33 inhibitor and an FMR1 inhibitor; the circRBM33 inhibitor is selected from shRNA designed based on the circRBM33 gene; the FMR1 inhibitor is selected from siRNA designed based on the FMR1 gene; the shRNA designed based on the circRBM33 gene is selected from one or more of sh-C1 and sh-C2, wherein the sh-C1 sequence is: ccggGATGAATTTACAATGATGActcgagTCATCATTGTAAATTCATCttttttg, and the sh-C2 sequence is: ccggGAATTTACAATGATGACTTctcgagAAGTCATCATTGTAAATTCttttttg; the siRNA designed based on the FMR1 gene is selected from one or more of si-1 and si-2, wherein the si-1 sequence is CCAGAAGACUUACGGCAAATT, and the si-2 sequence is GCAUCAAAUGCUUCUGAAATT.

Images