Heterologous Expression of Bovine Lactoferrin in Pichia pastoris and Its Antibacterial Activity

Abstract

The present invention discloses heterologous expression of bovine lactoferrin in Pichia pastoris and research on its antibacterial activity, and belongs to the field of bioengineering. In the present invention, bovine lactoferrin is codon-optimized, and soluble expression is achieved in the recombinant bacteria constructed by the present invention under the conditions of 26°C and pH 6.0, with an expression amount of 40.2 mg·L ‑1 After promoter optimization, soluble expression was also achieved in P. pastoris GS115 / pGAP9K‑UBLF3, with an expression level of 70.5 mg·L ‑1 Through high copy screening and fermentation condition optimization, the expression level of recombinant bovine lactoferrin was 172.5 mg·L under the optimal protein expression conditions in shake flasks. ‑1 The expression level of the selected recombinant bacteria in a 3L fermenter was increased to 4303.4 mg·L ‑1 The present invention provides theoretical guidance for the heterologous expression and industrial production of bovine lactoferrin.

Description

Technical Field

[0001] The invention relates to heterologous expression of bovine lactoferrin in Pichia pastoris and research on its antibacterial activity, and belongs to the field of bioengineering. Background Art

[0002] Lactoferrin (LF, EC1.16.3.1) is a natural iron-binding glycoprotein with multiple physiological functions in the transferrin family, and is an important mediator of mammalian nonspecific immunity and acquired immune response. Lactoferrin is mainly expressed and secreted by mammary epithelial cells, with a high content in milk, and is also present in some secretions, such as tears, saliva, sweat, etc., and is also present in a small amount on the mucosal surface and in some particles of polymorphonuclear leukocytes. Lactoferrin has multiple biological functions, can promote the absorption of iron by the human body, has a broad spectrum of antibacterial and antiviral abilities, can also be antifungal, anti-inflammatory, and has significant therapeutic potential in antitumor. Therefore, lactoferrin has broad application prospects in food, feed additives, cosmetics and pharmaceutical industries.

[0003] According to different sources, lactoferrin can be divided into human lactoferrin (HLF), bovine lactoferrin (BLF), sheep lactoferrin (OLF), porcine lactoferrin (PLF), etc. The content of lactoferrin in human milk is the most abundant, and the content of lactoferrin in human colostrum is higher than 5g·L -1 The lactoferrin content of mature breast milk is 2-3 g·L -1 Cow’s milk is the richest source of milk, but the lactoferrin content of bovine colostrum is about 0.8 g·L -1 The content of mature milk is only 0.03-0.49 g·L -1 .

[0004] At present, commercial bovine lactoferrin is mainly extracted from cow milk, which is inefficient and costly. Therefore, the production of lactoferrin by constructing genetically engineered bacteria has gradually become a research hotspot in the food industry. However, since lactoferrin comes from large mammals, its heterologous expression has encountered great difficulties. Since 1990, when Powell, Rey, and Odgen published partial genes and cDNA sequences of human lactoferrin, researchers have successively expressed lactoferrin genes in mammals, insects, plants, bacteria and other systems, but the protein expression level is very low. In recent years, with the rapid development of transgenic technology, the hosts for heterologous expression of lactoferrin have become more and more diversified, and the expression amount has also increased to a certain extent. Rascón-Cruz et al. expressed bovine lactoferrin with antibacterial activity in Escherichia coli; Kim et al. expressed, purified and characterized the antibacterial properties of bovine lactoferrin C-leaf in Rhodococcus erythropolis; Jin et al. obtained bovine lactoferrin N-leaf with antibacterial activity in Bacillus subtilis. When expressing bovine lactoferrin using prokaryotic host cells, on the one hand, some hosts themselves produce toxins, such as Escherichia coli producing enterotoxins, which do not meet food safety standards; on the other hand, lactoferrin is a glycosylated protein, and prokaryotic host cells are unable to complete the subsequent processing and modification of the protein.

[0005] The Pichia pastoris expression system has certain advantages over other commonly used prokaryotic expression systems, such as Escherichia coli and Bacillus subtilis, in heterologous expression of some difficult-to-express proteins. First, the methanol metabolism strong promoter AOX1 commonly used in Pichia pastoris is one of the most effective promoters known. Under methanol induction conditions, the expression level of many proteins can reach g·L -1 Secondly, Pichia pastoris not only has the advantages of easy operation, low cost, and low requirements for culture conditions of the prokaryotic expression system, but also has post-translational folding modification, processing, glycosylation and other functions that the prokaryotic expression system does not have, which is more conducive to the functional expression of foreign proteins. Moreover, when the Pichia pastoris expression system expresses foreign proteins, the genes of foreign proteins are integrated into the yeast genome, and the stability is much higher than that of the prokaryotic expression system. When Pichia pastoris is well ventilated, the dry weight of Pichia pastoris can reach 100g·L -1 The level of bovine lactoferrin is very fast, and it grows very fast. It is suitable for high-density culture and can be used for large-scale industrial production, generating higher economic benefits at low cost. Bovine lactoferrin is a product encoded by eukaryotic genes, and requires folding modification and glycosylation after translation, so the Pichia yeast expression system is our only choice for heterologous expression of bovine lactoferrin.

[0006] In conclusion, it is very valuable to use Pichia pastoris to heterologously express lactoferrin. Summary of the invention

[0007] To solve the above problems, the present invention uses Pichia pastoris to express bovine lactoferrin heterologously, uses pPIC9K as an expression vector, and uses Pichia pastoris GS115 as a host bacteria to functionally express bovine lactoferrin. The expression amount of the target protein is increased by codon optimization, promoter optimization, high copy screening, and fermentation condition optimization strategies, and the antibacterial activity of the recombinant protein is studied by agar diffusion method, providing theoretical guidance for the heterologous expression and industrial production of bovine lactoferrin.

[0008] The invention provides a recombinant Pichia pastoris, comprising an expression vector connected with a target gene, wherein the target gene is a bovine lactoferrin UBLF gene with a nucleotide sequence as shown in SEQ ID NO.4.

[0009] The bovine lactoferrin UBLF gene, whose nucleotide sequence is shown in SEQ ID NO.4, is obtained by codon optimization based on the bovine lactoferrin UBLF gene shown in SEQ ID NO.1.

[0010] In one embodiment of the present invention, the recombinant Pichia pastoris uses P. pastoris GS115 and P. pastoris KM71 as expression hosts.

[0011] In one embodiment of the present invention, the recombinant Pichia pastoris is a pPIC9K plasmid or a P GAP Promoter replacement P AOX1 The pPIC9K plasmid with the promoter is used as an expression vector.

[0012] In one embodiment of the present invention, the P GAP The promoter nucleotide sequence is shown in SEQ ID NO.5.

[0013] In one embodiment of the present invention, the P AOX1 The promoter nucleotide sequence is shown in SEQ ID NO.6.

[0014] In one embodiment of the present invention, the copy number of the target gene bovine lactoferrin UBLF gene in the recombinant Pichia pastoris is 4-6.

[0015] In one embodiment of the present invention, the copy number of the target gene bovine lactoferrin UBLF gene in the recombinant Pichia pastoris is 5.88.

[0016] The present invention also provides a method for constructing the above-mentioned recombinant Pichia pastoris, which comprises the following steps:

[0017] (1) The bovine lactoferrin gene was expressed in the vector pPIC9K or in the vector pPIC9K. GAP Promoter replacement P AOX1After the pPIC9K vector of the promoter was connected, a recombinant vector was prepared;

[0018] (2) electroporating the obtained recombinant expression vector into Pichia pastoris to prepare recombinant Pichia pastoris;

[0019] (3) The recombinant Pichia yeast was added to a mixture containing 4.0 mg / mL G418. -1 The recombinant Pichia pastoris with 4 to 6 copies of the target protein was screened in YPD medium.

[0020] In one embodiment of the present invention, the copy number of the target protein bovine lactoferrin UBLF in the recombinant Pichia pastoris is 5.88.

[0021] The present invention also provides a method for increasing the expression level of bovine lactoferrin UBLF, wherein the method comprises using the above-mentioned recombinant Pichia pastoris to express the target protein bovine lactoferrin UBLF.

[0022] The present invention also provides a method for preparing recombinant bovine lactoferrin UBLF, which comprises fermenting the recombinant Pichia pastoris to obtain the UBLF.

[0023] In one embodiment of the present invention, the seed solution of the recombinant Pichia pastoris is centrifuged, resuspended in BMMY medium, and the resuspended solution is heated at 20-26°C, pH 4.0-7.0, and a rotation speed of 180 r·min -1 ~240r·min -1 After fermentation for 72 to 96 hours under the conditions, a fermentation broth is prepared, the fermentation broth is centrifuged to collect cells, the cells are broken, and the supernatant is collected by centrifugation to prepare bovine lactoferrin UBLF.

[0024] In one embodiment of the present invention, the preparation method of the recombinant Pichia pastoris seed solution is as follows: recombinant Pichia pastoris GS115 / pGAP9K-UBLF3-4 is inoculated into BMGY medium, and the mixture is incubated at 30°C and 200 r·min -1 The culture was carried out for 18 h until OD 600 is 4 to 5, and seed liquid is prepared respectively.

[0025] In one embodiment of the present invention, the recombinant Pichia pastoris seed solution is centrifuged, resuspended in BMMY medium, and the resuspended solution is heated at 24°C, pH 5.0, and a rotation speed of 220 r·min -1 After fermentation for 96 hours under the above conditions, a fermentation liquid was prepared.

[0026] In one embodiment of the present invention, the prepared fermentation broth is centrifuged at 8000×g for 5 min, the supernatant is discarded, the obtained cells are broken, and the broken cells are subjected to ammonium sulfate precipitation to purify the protein to prepare purified bovine lactoferrin UBLF without protein tag.

[0027] In one embodiment of the present invention, the recombinant Pichia seed liquid is inoculated into a 3L fermenter containing BSM medium, and the reaction conditions are: temperature of 24°C, pH of 5.0, while adjusting the ventilation volume and rotation speed to keep the dissolved oxygen at about 20%, and fermenting for 96 hours.

[0028] The present invention also provides the use of the recombinant Pichia pastoris in the preparation of an antibacterial agent, wherein the antibacterial agent is used to inhibit Escherichia coli, Salmonella, Pseudomonas aeruginosa, Helicobacter pylori, Staphylococcus aureus, and Bacillus.

[0029] Beneficial Effects

[0030] (1) The present invention uses the BLF gene as a template, performs codon optimization according to the codon preference of Pichia pastoris, constructs a recombinant expression vector pPIC9K-UBLF, and transforms it into Pichia pastoris GS115 by electroporation to obtain the recombinant bacteria P.pastoris GS115 / pPIC9K-UBLF. By promoter optimization, the recombinant bacteria P.pastoris GS115 / pGAP9K-UBLF3 are obtained. By optimizing the high copy strategy and fermentation conditions, combined with SDS-PAGE analysis of BLF protein expression, the antibacterial activity of the recombinant BLF protein against Gram-positive and Gram-negative bacteria is studied. The SDS-PAGE results show that BLF achieves soluble and efficient expression in P.pastoris GS115, with a molecular weight of about 76 kDa, which is consistent with its theoretical molecular weight.

[0031] (2) The present invention obtained a high copy number of 4 mg mL -1 Transformants grown on Geneticin G418 resistant plates; by optimizing the fermentation conditions, the optimal protein expression conditions were obtained: 24°C, pH 5.0, and a rotation speed of 220 r·min -1 Under this condition, the expression level of recombinant BLF was 172.5 mg·L -1 .

[0032] (3) The expression level of the target protein in the recombinant Pichia pastoris GS115 / pGAP9K-UBLF3-4 was further increased to 4303.4 mg·L by fed-batch fermentation in a 3 L fermenter. -1 .

[0033] (4) The results of the antibacterial experiment showed that the recombinant BLF had strong antibacterial activity against Escherichia coli and Staphylococcus aureus, and the antibacterial effect of the recombinant BLF on Escherichia coli and Staphylococcus aureus was basically consistent with that of commercial bovine lactoferrin. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 : Expression of P.pastoris GS115 / pPIC9K-UBLF1 in Pichia pastoris; wherein, M: protein marker; 1, 3, 5, 7: fermentation supernatant of P.pastoris GS115 / pPIC9K-UBLF1 transformants 1 to 4 after 96 hours; 2, 4, 6, 8: whole cells of P.pastoris GS115 / pPIC9K-UBLF1 transformants 1 to 4 after 96 hours.

[0035] Figure 2 : Expression of P.pastoris GS115 / pPIC9K-UBLF2 in Pichia pastoris; wherein, M: protein marker; 1-4: fermentation supernatant of P.pastoris GS115 / pPIC9K-UBLF2 transformants 1 to 4 at 96 hours; 5-8: whole cells of P.pastoris GS115 / pPIC9K-UBLF2 transformants 1 to 4 at 96 hours.

[0036] Figure 3 :Expression of P.pastoris GS115 / pPIC9K-UBLF3 in Pichia pastoris; wherein, (A): M: protein marker; 1-3: whole cells of P.pastoris GS115 / pPIC9K-UBLF3 transformants 1 to 3 at 96 hours; 4: control - commercial bovine lactoferrin; (B): M: protein marker; 1, 2, 3: supernatant of cell disruption of P.pastoris GS115 / pPIC9K-UBLF3 transformants 1 to 3 at 96 hours; 4: control - commercial bovine lactoferrin.

[0037] Figure 4 : Expression of P.pastoris GS115 / pGAP9K-UBLF3 in Pichia pastoris; wherein, M: protein Marker; 1, 3, 5, 7: fermentation supernatant of P.pastoris GS115 / pGAP9K-UBLF3 at 24h, 48h, 72h, 96h; 2, 4, 6, 8: whole cells of P.pastoris GS115 / pGAP9K-UBLF3 at 24h, 48h, 72h, 96h.

[0038] Figure 5: SDS-PAGE analysis of protein purified from P. pastoris GS115 / pGAP9K-UBLF3; wherein, M: protein marker; 1: target protein obtained after purification.

[0039] Figure 6 : Standard curves of GAP gene (A) and UBLF3 gene (B).

[0040] Figure 7 :Effects of temperature (A), pH (B) and rotation speed (C) on the expression level of BLF.

[0041] Figure 8 : Expression and purification of P.pastoris GS115 / pGAP9K-UBLF3-4 fed-batch fermentation; wherein, (A): M: protein marker; 1: supernatant of P.pastoris GS115 / pGAP9K-UBLF3-4 fermentation broth after 96h of fermentation; 2: supernatant of P.pastoris GS115 / pGAP9K-UBLF3-4 cell disruption after 96h of fermentation; (B): M: protein marker; 1: purified BLF.

[0042] Fig. 9 :Inhibitory effect of recombinant BLF on Escherichia coli (A) and Staphylococcus aureus (B); Wherein, (A): E.coliJM109; (B): S.aureus CGMCC1.282; a: ddH 2 O; b: 0.1 mg·mL -1 Amp; c: 1mg·mL -1 Recombinant UBLF.

[0043] Fig.10 : Antibacterial effects of recombinant UBLF and commercial BLF (cBLF) against Escherichia coli (A) and Staphylococcus aureus (B). DETAILED DESCRIPTION

[0044] The culture medium involved in the following examples is as follows:

[0045] BMGY medium: potassium phosphate buffer (pH 6.0) 100 mM, glycerol 10 mL·L -1 , yeast extract 10g·L -1 , YNB 13.4 g·L -1 , biotin 0.4mg·L -1 , peptone 20 g·L -1 .

[0046] BMMY medium: potassium phosphate buffer (pH 6.0) 100 mM, methanol 5 mL·L-1 , yeast extract 10g·L -1 , YNB 13.4 g·L -1 , biotin 0.4mg·L -1 , peptone 20 g·L -1 .

[0047] MD medium: glucose 20 g·L -1 , agar 20 g·L -1 , YNB 13.4 g·L -1 , biotin 0.4mg·L -1 .

[0048] YPD medium: yeast extract 10 g L -1 , peptone 20 g·L -1 , glucose 20g·L -1 .

[0049] YPD-G418 solid medium: yeast extract 10 g L -1 , peptone 20 g·L -1 , glucose 20g·L -1 , agar 20 g·L -1 , G418 (Geneticin) 4g·L -1 (Other concentrations are added in proportion).

[0050] The detection methods involved in the following embodiments are as follows:

[0051] Determination of protein concentration: The protein concentration was determined by the Coomassie brilliant blue method, and a standard curve was drawn with bovine serum albumin. The absorbance value of the obtained recombinant protein was measured at 595 nm using an ELISA instrument, and the obtained value was substituted into the standard curve to obtain the protein concentration.

[0052] Example 1: Acquisition of bovine lactoferrin UBLF gene

[0053] The cDNA sequence of bovine lactoferrin (BLF) was retrieved from NCBI (the NCBI database gene accession number is JX294418.1). According to the codon preference of P. pastoris, the gene was codon optimized and chemically synthesized by a biological company. Three codon-optimized BLF genes were obtained by different optimization methods and named UBLF1, UBLF2, and UBLF3 (the nucleotide sequences are shown in SEQ ID NOs. 2 to 4, respectively).

[0054] Primers UBLF-F and UBLF-R were designed, and UBLF was used as a template for PCR amplification to obtain the optimized bovine lactoferrin gene UBLF with homology arms.

[0055] The PCR amplification system was as follows: PrimeSTAR 25 μL, template 1 μL, upstream and downstream primers 1 μL × 2, ddH 2 O 22 μL. The amplification program was: 98°C pre-denaturation for 30 s, 98°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 40 s, 30 cycles; 72°C extension for 10 min.

[0056] Amplification primers are as follows:

[0057] UBLF1-F: AAGAGAGGCTGAAGCTTACGTAATGGCCCCTCGTAAGA;

[0058] UBLF1-R: GCGAATTAATTCGCGGCCGCTTAGCGTGTCAGAAAGGCAC;

[0059] UBLF2-F:AAAGAGAGGCTGAAGCTTACGTAATGGCACCTAGGAAGAA;

[0060] UBLF2-R: AAGGCGAATTAATTCGGCGGCCGCTTACCGCGTCAAGAAAG;

[0061] UBLF3-F:GAAAAGAGAGGCTGAAGCTTACGTAATGGCTCCAAGAAAAA;

[0062] UBLF3-R: AAGGCGAATTAATTCGCGGCCGCTTATCTAGTCAAAAAAG.

[0063] After the amplification was completed, nucleic acid gel electrophoresis was performed to verify the success, and the PCR product was purified using a column purification kit from Novozymes to obtain UBLF1, UBLF2, and UBLF3 genes with nucleotide sequences shown in SEQ ID NOs. 2 to 4, respectively.

[0064] Example 2: Construction of recombinant expression vector pPIC9K-UBLF

[0065] The specific steps are as follows:

[0066] (1) The expression vector pPIC9K was double-digested with SnaBI and NotⅠ and then purified. The double-digestion system was 30 μL of vector, 5 μL of 10× buffer, 1 μL of SnaBI, 1 μL of NotⅠ, ddH 2 O 13μL, 37℃, react for 1h.

[0067] (2) Using a single-fragment homologous recombinase, the purified target genes UBLF1, UBLF2, and UBLF3 obtained in Example 1 were connected to the linear vector pPIC9K after restriction digestion at 37°C for 30 min. The connection system was mμL of linearized vector, nμL of inserted fragment, 2μL of 5×CE buffer, 1μL of Exnase, and ddH 2 O to make up 10 μL, m = (0.02 × number of vector base pairs) / concentration; n = (0.04 × number of inserted fragment base pairs) / concentration.

[0068] (3) The ligated recombinant plasmids pPIC9K-UBLF1, pPIC9K-UBLF2, and pPIC9K-UBLF3 were transformed into E. coli JM109 competent cells, respectively. After PCR verification, they were sent to Tianlin Biotechnology Co., Ltd. for sequencing verification. The sequencing was successful, and the recombinant expression vectors pPIC9K-UBLF1, pPIC9K-UBLF2, and pPIC9K-UBLF3 were obtained.

[0069] Example 3: Construction of a recombinant Pichia yeast system

[0070] The specific steps are as follows:

[0071] (1) The recombinant expression vectors pPIC9K-UBLF1, pPIC9K-UBLF2, and pPIC9K-UBLF3 prepared in Example 2 were linearized using restriction endonuclease SalⅠ. The linearization system was 30 μL of recombinant vector, 5 μL of 10× buffer, 2 μL of SalⅠ, and ddH 2 O 13μL, react at 37℃ for 1h.

[0072] (2) The linearized recombinant expression vectors pPIC9K-UBLF1, pPIC9K-UBLF2, and pPIC9K-UBLF3 were electroporated into P. pastoris GS115 competent cells. The preparation method of Pichia pastoris competent cells was referred to the Pichia pastoris expression manual of Invitrogen. The electroporated cells were incubated at 30°C for 1-2 h, coated with MD medium, and cultured at 30°C for 3 days until large colonies grew.

[0073] The His obtained from MD plate + Multiple single clones were selected from the transformants, inoculated into YPD medium for overnight culture, and the genome was extracted using the "boil-freeze-boil" method. PCR was performed using AOX1 as a primer to identify whether pPIC9K-UBLF was integrated into the yeast genome.

[0074] The AOX1 primer sequences are as follows:

[0075] 5'AOX1:GACTGGTTCCAATTGACAAGC;

[0076] 3'AOX1:GCAAATGGCATTCTGACATCC.

[0077] The clones with positive PCR identification results were P. pastoris GS115 / pPIC9K-UBLF positive transformants, that is, P. pastoris GS115 / pPIC9K-UBLF1, P. pastoris GS115 / pPIC9K-UBLF2, and P. pastoris GS115 / pPIC9K-UBLF3 were prepared respectively.

[0078] Example 4: Expression of recombinant Pichia yeast

[0079] The specific steps are as follows:

[0080] (1) The recombinant Pichia pastoris GS115 / pPIC9K-UBLF1, P. pastoris GS115 / pPIC9K-UBLF2, and P. pastoris GS115 / pPIC9K-UBLF3 prepared in Example 3 were inoculated into BMGY medium and incubated at 30°C and 200 r / min. -1 The culture was carried out for 18 h until OD 600 is 4 to 5, and seed liquid is prepared respectively.

[0081] (2) The seed solution obtained in step (1) was centrifuged at room temperature and 4000×g for 10 min, the supernatant was discarded, and the precipitate was resuspended in BMMY medium to an OD of 600 1 to obtain a heavy suspension.

[0082] (3) The resuspended solution obtained in step (2) was heated at 26°C and 200 r / min. -1 Expression was induced under the conditions of , with methanol added every 24 h at a final concentration of 0.5% (v / v), pH 6.0, and a total induction time of 96 h.

[0083] The fermentation supernatant and cultured cells P.pastoris GS115 / pPIC9K-UBLF1, P.pastoris GS115 / pPIC9K-UBLF2, and P.pastoris GS115 / pPIC9K-UBLF3 were collected after the culture was completed, and the expression of proteins in the fermentation supernatant and cells after 96 hours of fermentation were detected by SDS-PAGE. The results are as follows: Figures 1 to 3 As shown, transformants 1 to 4 refer to the 4 transformants verified as positive.

[0084] The results show:

[0085] like Figure 1 As shown, there is no target band in the supernatant of P. pastoris GS115 / pPIC9K-UBLF1 fermentation broth (lanes 1 to 4) and cells (lanes 5 to 8).

[0086] like Figure 2 As shown, no target band was found in the supernatant of P. pastoris GS115 / pPIC9K-UBLF2 fermentation broth (lanes 1 to 4) and cells (lanes 5 to 8).

[0087] At the same time, P. pastoris GS115 / pPIC9K-UBLF3 did not express the target protein in the fermentation supernatant; however, the target protein was expressed in the cells. The expression of the whole cell in Pichia pastoris is shown in Figure 3 As shown in (A), transformants 1 to 3 all expressed the target protein at 76 kDa;

[0088] The cells of the three samples of P. pastoris GS115 / pPIC9K-UBLF3 were disrupted, and the supernatants were subjected to SDS-PAGE. The results are as follows: Figure 3 As shown in (B), the target protein was present in the supernatant of cell disruption, and its size was similar to that of the control commercial bovine lactoferrin. BLF was expressed soluble in P. pastoris GS115 / pPIC9K-UBLF3, with an expression level of 40.2

[0089] mg·L -1 .

[0090] Example 5: Promoter Optimization

[0091] The specific steps are as follows:

[0092] (1) Based on the successfully constructed recombinant expression vector pPIC9K-UBLF3, the promoter P was obtained by PCR amplification using the P. pastoris GS115 genome as a template, GCAGCGAGCTCAATGTCTTGGTGTCCTCGTC (Sac I) as an upstream primer and GGCCGGATCCATTTAAAGTCTTTGGGTCAGG (BamH I) as a downstream primer. GAP The gene fragment (nucleotide sequence is shown in SEQ ID NO.5) was then replaced by the promoter P of the recombinant expression vector pPIC9K-UBLF3 by double enzyme digestion. AOX1The fragment (nucleotide sequence is shown in SEQ ID NO.6) was used to form a recombinant expression vector named pGAP9K-UBLF3.

[0093] (2) The recombinant expression vector pGAP9K-UBLF3 prepared in step (1) was electroporated into P. pastoris GS115 to obtain recombinant Pichia pastoris GS115 / pGAP9K-UBLF3.

[0094] (3) Expression in recombinant Pichia yeast:

[0095] The recombinant Pichia pastoris GS115 / pGAP9K-UBLF3 was inoculated into BMGY medium and incubated at 30°C and 200 r·min -1 The culture was carried out for 18 h until OD 600 is 4 to 5, and seed liquid is prepared respectively.

[0096] The seed solution was centrifuged at room temperature and 4000 × g for 10 min, the supernatant was discarded, and the precipitate was resuspended in BMMY medium (without methanol) to OD 600 1 to obtain a heavy suspension.

[0097] The resuspended liquid was heated at 26°C and 200 r / min -1 The expression was carried out under the conditions of 96 hours, and the fermentation supernatant and cultured cells were collected after the culture was completed. The expression of proteins in the fermentation supernatant and cells after 96 hours of fermentation were detected by SDS-PAGE. The results are as follows Figure 4 shown.

[0098] The results showed that UBLF was not expressed in the supernatant of the fermentation broth of P. pastoris GS115 / pGAP9K-UBLF3, but was soluble in the whole cells with an expression level of 70.5 mg·L -1 .

[0099] Example 6: Purification of target protein

[0100] The fermentation broth was initially purified by centrifugation and ammonium sulfate precipitation.

[0101] The specific steps are as follows:

[0102] The P. pastoris GS115 / pGAP9K-UBLF3 fermentation broth prepared in Example 5 was centrifuged at 8000×g for 5 min, the supernatant was discarded, the obtained cells were broken, and the supernatant was collected by centrifugation at 12000×g for 30 min;

[0103] Add ammonium sulfate to the collected cell disruption supernatant and stir to dissolve until the final concentration of ammonium sulfate is 400 g·mL -1 , placed at 4°C overnight, and centrifuged at 12000×g, 4°C for 15 min to collect the protein precipitate.

[0104] Finally, the crude protein was separated by size exclusion chromatography (SuperdexG100) using the AKTA Avant protein purification system, and the purified protein was analyzed by SDS-PAGE.

[0105] The purification results are as follows Figure 5 As shown, there is a target band at 76 kDa corresponding to the theoretical molecular weight of BLF, and the purified target protein UBLF is prepared.

[0106] The purified target protein UBLF obtained by the above method is a tag-free protein, which is consistent with the natural protein.

[0107] Example 7: High copy screening and fermentation condition optimization to improve the purification of target protein

[0108] 1. Construction of P. pastoris GS115 / pGAP9K-UBLF3-4 strain

[0109] (1) High copy screening

[0110] The recombinant expression vector pGAP9K-UBLF3 was electroporated into P. pastoris GS115 and spread on MD plates. When larger colonies grew on the plates, the transformants on the plates were mixed with water using a disposable spreading stick and transferred to a centrifuge tube. The OD was measured. 600 Read the mixture and calculate the cell concentration (1OD 600 About 5×10 7 cells / mL).

[0111] When adding 0, 0.25, 0.5, 1.0, 1.5, 2.0, 3.0, 4.0, 5.0 mg mL -1 The same number of cells were spread on YPD plates with different concentrations of G418 and cultured at 30°C until larger colonies grew.

[0112] When the G418 concentration is 4.0 mg mL -1 The transformant grown on the plate was named P. pastoris GS115 / pGAP9K-UBLF3-4, and the G418 concentration was greater than 4.0 mg mL -1 The transformants with resistance to G418 concentration of 4.0 mg·mL were selected. -1 The transformants were selected to optimize the subsequent fermentation conditions.

[0113] (2) Detection of the copy number of the UBLF3 gene in the P. pastoris GS115 / pGAP9K-UBLF3-4 strain

[0114] RT-qPCR technology was used. The housekeeping gene GAP of Pichia pastoris was used as the internal reference. The copy number of UBL3 gene in recombinant Pichia pastoris GS115 / pGAP9K-UBLF3-4 was determined by RT-qPCR in SYBR Green mode.

[0115] The specific steps are as follows:

[0116] 1) Obtaining standard plasmids

[0117] The construction method in Example 5 was used to construct the vector pGAP9K; the recombinant vector pGAP9K-UBLF3 was the recombinant expression vector successfully constructed in Example 2.

[0118] 2) Preparation of samples to be tested

[0119] The high-copy P. pastoris GS115 / pGAP9K-UBLF3-4 was inoculated into the culture medium and cultured according to the culture method in Example 5. After the expression was completed, the total RNA was extracted and reverse transcribed to prepare the synthetic complementary deoxyribonucleic acid.

[0120] (complementary deoxyribonucleic acid, cDNA) sample.

[0121] 3) RT-qPCR amplification procedures and systems

[0122] PCR amplification system (20 μL): 0.5 μL of each primer, 0.5 μL of template, 8.5 μL of double distilled water (ddH2O), 10 μL of 2×UltraSYBR Mixture. PCR amplification program: 95°C pre-denaturation for 10 min; 95°C denaturation for 15 s, 60°C extension for 1 min, for a total of 40 cycles.

[0123] 4) Establishment of GAP and UBLF3 gene standard curves

[0124] The concentrations of pGAP9K and pGAP9K-UBLF3 were measured using a micro-nucleic acid analyzer, and the copy number of the standard plasmid was calculated according to the following formula: (6.02×10 23 )×(g / mL) / (DNA base length×660)=copy number / mL. 3 , 10 4 , 105 , 10 6 , 10 7 100 copies / μL) as template, and RT-qPCR was performed with GAP-F / GAP-R and UBLF3-F / UBLF3-R primers. The standard curves of GAP and UBLF3 genes were established with Ct value (y) as ordinate and the logarithm of the number of plasmid copies in the starting template (x) as abscissa. The relative content of the target gene can be analyzed by using the double standard curve method. The standard curve of GAP gene is shown in Figure 6 As shown in (A), the standard curve of UBLF3 gene is as follows Figure 6 As shown in (B), the regression equation of the GAP gene standard curve is y = -3.4197x + 37.0031 (R 2 =0.999), and the regression equation of the UBLF3 gene standard curve was y=-3.3786x+36.4654 (R 2 =0.999)

[0125] The relevant primers are as follows:

[0126] GAP-F: TTTTTGTAGAAATGTCTTGGTGTCCT;

[0127] GAP-R: CCCTATTTCAATCAATTGAACAACTAT;

[0128] UBLF3-F:GAAAAGAGAGGCTGAAGCTTACGTAATGGCTCCAAGAAAAA;

[0129] UBLF3-R: AAGGCGAATTAATTCGCGGCCGCTTATCTAGTCAAAAAAG.

[0130] 5) Detection of UBLF3 gene copy number

[0131] When detecting the copy number of the UBLF3 gene, the previously prepared cDNA sample was used as a template, and primers GAP-F / GAP-R and UBLF3-F / UBLF3-R were used for RT-qPCR detection. The GAP gene exists in the genome of Pichia pastoris as a single copy, so the starting copy number of the UBLF3 gene in the genome of Pichia pastoris is the ratio of the copy number of the UBLF3 gene to the copy number of the GAP gene.

[0132] Table 1 Real-time fluorescence quantitative PCR detection of GAP and UBLF3 gene copy numbers

[0133]

[0134] The results are shown in Table 1. The copy number of the target gene in P. pastoris GS115 / pGAP9K-UBLF3-4 was 5.88.

[0135] 2. Optimization of fermentation conditions

[0136] The fermentation conditions of the recombinant strain P. pastoris GS115 / pGAP9K-UBLF3-4 were optimized, including temperature, pH value and rotation speed.

[0137] 2.1. Temperature optimization:

[0138] (1) The recombinant Pichia pastoris GS115 / pGAP9K-UBLF3-4 was inoculated into BMGY medium and incubated at 30°C and 200 r / min. -1 The culture was carried out for 18 h until OD 600 is 4 to 5, and seed liquid is prepared respectively.

[0139] (2) The seed solution was centrifuged at room temperature and 4000 × g for 10 min, the supernatant was discarded, and the pellet was resuspended in BMMY medium (without methanol) to an OD of 600 is 1.0 to obtain a heavy suspension.

[0140] (3) The temperature gradient of P. pastoris GS115 / pGAP9K-UBLF3 was set to 20, 22, 24, and 26°C, that is, the resuspension was heated at 20, 22, 24, and 26°C, pH 6.0, and 200 r / min. -1 The cells were fermented for 96 h under the conditions of , and the cells were collected after the culture was completed. The cells were broken by glass beads, and the supernatant was taken. The supernatant was purified according to the method of Example 6, and the expression amount of the purified protein was detected. The results are as follows. Figure 7 (A) shown.

[0141] The results showed that the protein expression level of P. pastoris GS115 / pGAP9K-UBLF3-4 was 80.9 mg·L at 20°C. -1 ; The protein expression at 22°C was 110.1 mg·L -1 ; Protein expression at 24°C: 130.2 mg·L -1 ; Protein expression at 26°C: 70.5 mg·L -1 .

[0142] In summary, 24℃ is the optimal expression temperature for P. pastoris GS115 / pGAP9K-UBLF3-4.

[0143] 2.2. Optimize pH at the optimum temperature:

[0144] The specific steps are the same as 2.1, except that the temperature is set to 24°C and the speed is set to 200 r / min -1 , using potassium phosphate buffer at pH 4.0, 5.0, 6.0, and 7.0, respectively. After 96 h of fermentation, the protein expression was analyzed. The results are as follows Figure 7 (B) shown.

[0145] The results showed that when the pH was 4.0, the protein expression was 135.4 mg·L -1 ; When pH was 5.0, the protein expression was 144.5 mg·L -1 ; When pH was 6.0, the protein expression was 130.2 mg·L -1 ; When pH was 7.0, the protein expression was 130.0 mg·L -1 .

[0146] In summary, pH 5.0 is the optimal expression pH for P. pastoris GS115 / pGAP9K-UBLF3-4.

[0147] 2.3. Under the conditions of the optimum temperature and the optimum pH, optimize the rotation speed:

[0148] The specific steps are the same as 2.1, except that the temperature is set to 24°C, the pH is 5.0, and the speed is set to 180 r / min. -1 、200r·min -1 、220r·min -1 、240r·min -1 After 96h of fermentation, the protein expression was analyzed. Figure 7 (C) shown.

[0149] The results show that the speed is 180r·min -1 When -1 ; Speed: 200r·min -1 When -1 ; Speed: 220r·min -1 When -1 ; Speed: 240r·min -1 When -1 .

[0150] In summary, the speed is 220r·min -1This is the optimal expression speed of P. pastoris GS115 / pGAP9K-UBLF3-4.

[0151] Therefore, at an induction temperature of 24°C, pH of 5.0, and a rotation speed of 220 r·min -1 When the expression level of the target protein in Pichia pastoris was increased to 172.5 mg·L -1 .

[0152] Example 8: Recombinant Pichia pastoris fed-batch fermentation

[0153] (1) Fed-batch fermentation

[0154] The recombinant Pichia pastoris GS115 / pGAP9K-UBLF3-4 obtained in Example 7 was streaked into YPD-G418 solid culture medium, cultured at 30°C for 3 days, and then a single colony was picked from the culture medium into 100 mL YPD culture medium (without resistance), and cultured in a shaking incubator at 30°C for 16 to 20 hours to prepare a seed solution.

[0155] The temperature in the 3L fermenter was set to 30°C, and the pH of the BSM medium (1L) in the fermenter was adjusted to 6.0 by feeding ammonia water. The rotation speed was set to 300 r·min. -1 . After all parameters are stable, inoculate all the seed liquid into the tank and set the dissolved oxygen to 100%. After the seed liquid is inoculated into the fermentation tank, culture until the first rebound of dissolved oxygen occurs, and then start to add glycerol. Culture conditions: adjust the temperature to 24℃, pH to 5.0, and adjust the ventilation volume and speed to keep the dissolved oxygen at around 20%, and ferment for 96 hours.

[0156] (2) Processing of fermentation samples

[0157] After the fermentation is completed, the fermentation liquid in the tank is divided into 500mL centrifuge bottles and centrifuged using a Beckman centrifuge at 4°C, 4000×g for 60min. After the centrifugation is completed, if the supernatant is still turbid, transfer it to a 50mL centrifuge tube with a dark cap and centrifuge again at 4°C, 12000×g for 30min to completely separate the fermentation liquid supernatant and the bacteria.

[0158] (3) SDS-PAGE of fermentation samples

[0159] The fermentation supernatant and cell disruption samples were taken separately. At the same time, the protein was purified according to the method of Example 6. The expression of the target protein in the fermentation supernatant and cells was analyzed by SDS-PAGE. The results are as follows: Figure 8 shown.

[0160] The results show that Figure 8As shown in (A), there is no protein expression in the fermentation supernatant of P. pastoris GS115 / pGAP9K-UBLF3-4, but the 76 kDa target protein BLF appears in the supernatant of cell fragmentation;

[0161] After purification, the results were Figure 8 As shown in (B), the purified UBLF was obtained, and the protein expression level was calculated to be 4303.4 mg·L -1 .

[0162] Example 9: Antibacterial Effects of Recombinant Bovine Lactoferrin

[0163] (1) The antibacterial effect of recombinant bovine lactoferrin was detected by agar diffusion method.

[0164] From the E.coli JM109 and S.aureus CGMCC1.282 plates, single clones were picked into LB test tubes and cultured overnight at 37℃ in a shaking incubator. 2mL of cultured bacterial solution was transferred to 200mL of LB solid medium cooled to 50-60℃ (too high temperature may cause bacterial death). Be sure to shake well to ensure that the growing bacteria can evenly cover the entire plate, and prepare the indicator bacterial suspension with a bacterial concentration of 0.6mg / mL.

[0165] (2) Pour the LB solid culture medium to which the bacterial suspension prepared in step (1) is added onto a plate. First, pour a thin layer of LB culture medium. After this layer solidifies, pour a second layer of LB culture medium. Then, place an Oxford cup in the unsolidified upper layer of culture medium and wait for it to solidify.

[0166] After the plates are prepared, add 100 μL of ddH 2 O (negative control), 100 μL 0.1 mg mL -1 of ampicillin (positive control) and 100 μL of 1 mg mL -1 The purified recombinant bovine lactoferrin (prepared in Example 8) was cultured at 37° C. for 16 h to observe whether an inhibition zone was generated.

[0167] The results are as follows Fig. 9 As shown, ddH 2 O was the negative control, ampicillin (Amp) was the positive control, and the recombinant UBLF produced inhibition zones of 1.5 cm and 1.2 cm for both E. coli and S. aureus, respectively.

[0168] The results showed that the recombinant UBLF had a certain inhibitory effect on both bacteria, and in comparison, it had a better inhibitory effect on E. coli.

[0169] (3) With reference to the antibacterial method of Bai et al. (Bai XJ, Teng D, Tian ZG, Zhu YP, Yang YL, Wang JH. Contribution of bovine lactoferrin inter-lobe region to iron binding stability and antimicrobial activity against Staphylococcus aureus. BioMetals, 2010, 23(3): 431–439), the growth inhibition effects of recombinant UBLF (prepared in Example 8) and commercial BLF (cBLF, purchased from Shanghai Huicheng Biotechnology Co., Ltd.) on Escherichia coli and Staphylococcus aureus were studied.

[0170] The results are as follows Fig.10 As shown, Fig.10 CK in the table is a normal growing bacterial solution without adding bovine lactoferrin or antibiotics; Amp is a bacterial solution with the addition of antibiotics, UBLF is a bacterial solution with the addition of UBLF, and cBLF is a bacterial solution with the addition of commercial BLF. The results showed that both recombinant UBLF and commercial BLF had inhibitory effects on both bacteria, but had a better inhibitory effect on Escherichia coli, and the antibacterial effect of the obtained recombinant BLF was basically consistent with that of the commercial BLF.

[0171] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A recombinant Pichia pastoris, characterized in that: The invention comprises an expression vector connected with a target gene, wherein the target gene is a bovine lactoferrin UBLF gene with a nucleotide sequence as shown in SEQ ID NO.4; the recombinant Pichia pastoris uses Pichia pastoris GS115 as an expression host; and uses a pPIC9K plasmid or a P GAP Promoter replacement P AOX1 The pPIC9K plasmid with the promoter is used as an expression vector.

2. The recombinant Pichia pastoris according to claim 1, characterized in that The copy number of the target gene bovine lactoferrin UBLF gene in the recombinant Pichia pastoris is 4-6.

3. The method for constructing the recombinant Pichia pastoris according to claim 1 or 2, characterized in that the method comprises the following steps: (1) Intracellular lactoferrin gene was expressed in pPIC9K vector or in P GAP Promoter replacement P AOX1 After the pPIC9K of the promoter was connected, a recombinant vector was prepared; (2) electroporating the obtained recombinant expression vector into Pichia pastoris to prepare recombinant Pichia pastoris; (3) Add the recombinant Pichia pastoris to a medium containing 4.0 mg / mL G418. -1 The recombinant Pichia pastoris with 4 to 6 copies of the target gene was screened in YPD medium.

4. A method for increasing the expression of bovine lactoferrin UBLF, characterized in that: The method comprises the following steps: using the recombinant Pichia pastoris according to claim 1 or 2 to express the target protein bovine lactoferrin UBLF.

5. A method for preparing recombinant bovine lactoferrin UBLF, characterized in that: The method is to prepare the recombinant Pichia yeast by fermentation according to claim 1 or 2.

6. The method according to claim 5, characterized in that The seed solution of the recombinant Pichia pastoris was centrifuged and resuspended in BMMY medium. The resuspended solution was heated at 20-26°C, pH 4.0-7.0, and a rotation speed of 180 r·min -1 ~240 r·min -1 After fermentation for 72 to 96 hours under the conditions, a fermentation broth was prepared, the fermentation broth was centrifuged to collect cells, the cells were broken, and the supernatant was collected by centrifugation to prepare bovine lactoferrin UBLF.

7. The method according to claim 6, characterized in that The recombinant Pichia yeast seed solution was centrifuged and resuspended in BMMY medium. The resuspended solution was heated at 24°C, pH 5.0, and a rotation speed of 220 r·min -1 After fermentation for 96 h under the above conditions, the fermentation broth was prepared.

8. Use of the recombinant Pichia yeast according to any one of claims 1 to 2 in the preparation of an antibacterial agent, characterized in that: The antibacterial agent is used for inhibiting Escherichia coli or Staphylococcus aureus.

Images