A bacillus subtilis chassis and application thereof

Abstract

The present application relates to a kind of by knocking out Bacillus subtilis SacB gene constructed chassis strain and its application, belong to genetic engineering, enzyme engineering and food engineering technical field.The present application is by SacB gene on the genome of Bacillus subtilis Knocking out, obtain a kind of can efficiently express aminopeptidase, alkaline protease Bacillus subtilis expression system, lay the foundation for the efficient expression of protein, promote the efficient expression and industrial production of aminopeptidase, alkaline protease.The chassis strain described above, in the case of carrying aminopeptidase, alkaline protease expression cassette, respectively, 48H shake flask fermentation, fermentation broth aminopeptidase enzyme activity is as high as 1666.7U / mL, with the enzyme activity of starting strain as contrast, enzyme activity is increased by about 30%;Fermentation broth alkaline protease enzyme activity is as high as 6348U / mL, with the enzyme activity of starting strain as contrast, enzyme activity is increased by about 20%.

Description

TECHNICAL FIELD

[0001] The present application relates to a kind of by knocking out Bacillus subtilis SacB gene constructed chassis strain and its application, belong to genetic engineering, enzyme engineering and food engineering technical field. BACKGROUND

[0002] Aminopeptidases (APs, EC 3.4.11) are a class of exoproteases that selectively degrade the N-terminal amino acid residues of polypeptide chains and proteins, releasing free amino acids. By catalyzing the degradation of the N-terminal hydrophobic amino acid residues of bitter peptides, the purpose of reducing bitterness can be achieved. Therefore, the use of aminopeptidases can significantly improve the degree of hydrolysis of casein and soy protein hydrolysate and reduce bitterness. Aminopeptidase enzymatic debittering has high hydrolysis efficiency, mild conditions, and easy operation, and is therefore widely used in modern industries such as food.

[0003] Aminopeptidases have great commercial application value, however, few natural aminopeptidases can efficiently catalyze the desired reactions under the conditions of convenient production and economic savings. Existing aminopeptidases generally have low yield, poor enzyme activity, and are easily inactivated under high temperature conditions. There is a lack of aminopeptidases with high catalytic activity and stability in the field of food processing.

[0004] Alkaline protease is a class of enzymes that can catalyze the hydrolysis of peptide bonds, and its active center contains serine, also known as serine protease. It is an enzyme that hydrolyzes protein peptide bonds in an alkaline pH range. It not only hydrolyzes peptide bonds, but also has the functions of hydrolyzing amide bonds, ester bonds, and transesterification and transpeptidation. This type of enzyme is widely found in animal pancreas, bacteria, and molds, and its enzyme activity can be inhibited by diisopropyl phosphorofluoride (DFP), phenylmethylsulfonyl fluoride (PMSF), and potato inhibitor (PI).

[0005] Alkaline protease has a wide range of applications in food, washing, and leather industries. Microbial proteases are all extracellular enzymes, and compared with animal and plant proteases, they have the following advantages: relatively simple downstream technical processing, low price, wide source, easy to cultivate, high yield, simple and fast selection of high-yield strains, all the characteristics of animal and plant proteases, and stronger hydrolysis capacity and alkali resistance than neutral proteases. They have greater heat resistance and certain esterase activity, and are easy to realize industrial production.

[0006] Bacillus subtilis has a clear genetic metabolic pathway, non-pathogenic, no codon bias, short fermentation cycle, suitable for high cell density culture. In addition, Bacillus subtilis has strong protein secretion ability and can directly secrete to the extracellular. Therefore, Bacillus subtilis is commonly used as a food safety level strain. However, the high-efficiency expression system of Bacillus subtilis still limits the expression of many proteins, and at present, it is only limited to the production of a small number of industrial enzymes. Therefore, it is of great significance to realize the high-efficiency expression of aminopeptidase and alkaline protease in Bacillus subtilis extracellular for its industrial production. SUMMARY

[0007] In view of the above problems, the purpose of the present application is to provide a Bacillus subtilis chassis strain capable of high-yield aminopeptidase and alkaline protease and its application by genetic engineering to modify the host.

[0008] In order to achieve the above purpose, the technical scheme adopted by the present application is as follows:

[0009] One of the technical schemes provided by the present application is a Bacillus subtilis genetic engineering chassis, which is obtained by deleting the expression of SacB gene based on Bacillus subtilis WB600.

[0010] Further, the nucleotide sequence of the SacB gene is shown in SEQ ID NO: 1.

[0011] Further, the method for deleting the expression of SacB gene includes but is not limited to gene knockout, gene inactivation and other methods.

[0012] The second technical scheme provided by the present application is the application of the above-mentioned Bacillus subtilis genetic engineering chassis, especially in the expression of aminopeptidase or protease.

[0013] The third technical scheme provided by the present application is a strain of aminopeptidase-expressing genetic engineering bacteria, which is obtained by knocking out SacB gene based on Bacillus subtilis WB600 to obtain a chassis, and then expressing aminopeptidase in the chassis.

[0014] Further, the amino acid sequence of the aminopeptidase is shown in SEQ ID NO. 2.

[0015] The fourth technical scheme provided by the present application is a strain of alkaline protease-expressing genetic engineering bacteria, which is obtained by knocking out SacB gene based on Bacillus subtilis WB600 to obtain a chassis, and then expressing alkaline protease in the chassis.

[0016] Further, the amino acid sequence of the alkaline protease is shown in SEQ ID NO. 3.

[0017] The fifth technical solution provided by the application is the application of the genetically engineered bacteria expressing the aminopeptidase or the genetically engineered bacteria expressing the alkaline protease, in particular, the application in the production of the aminopeptidase or the alkaline protease.

[0018] The beneficial effects of the application are as follows:

[0019] The application obtains a Bacillus subtilis expression system capable of efficiently expressing aminopeptidase and alkaline protease by knocking out the SacB gene on the genome of Bacillus subtilis, lays a foundation for efficient expression of proteins, and promotes efficient expression and industrial production of aminopeptidase and alkaline protease.

[0020] The application provides a Bacillus subtilis chassis strain capable of high-yield aminopeptidase and alkaline protease, and in the case of carrying an aminopeptidase and alkaline protease expression cassette, 48h of shake flask fermentation is performed, the aminopeptidase enzyme activity of the fermentation liquor is as high as 1666.7 U / mL, and the enzyme activity is increased by about 30% compared with the starting strain; the alkaline protease enzyme activity in the fermentation liquor is as high as 6348 U / mL, and the enzyme activity is increased by about 20% compared with the starting strain. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 : Construction process of the temperature-sensitive knockout vector pQ-T2-ΔSacB.

[0022] Figure 2 : Gene knockout single exchange verification; M: marker; 1, ΔSacB, 2, WB600.

[0023] Figure 3 : SacB gene knockout verification; M: marker; 1, ΔSacB, 2, WB600.

[0024] Figure 4 : Enzyme activity determination of the genetically engineered bacteria WB600ΔSacB-YwaD expressing aminopeptidase.

[0025] Figure 5 : Enzyme activity determination of the genetically engineered bacteria WB600ΔSacB-AprE expressing alkaline protease. DETAILED DESCRIPTION

[0026] The application will be described below through specific embodiments. Unless otherwise specified, the technical means used in the application are methods known to those skilled in the art. In addition, the embodiments should be understood as illustrative rather than limiting the scope of the application, and the essence and scope of the application are limited only by the claims. For those skilled in the art, various changes or modifications to the material components and amounts in these embodiments without departing from the essence and scope of the application also belong to the protection scope of the application.

[0027] The present application provides a genetically engineered Bacillus subtilis chassis, which is deficient in the expression of SacB gene on the genome of Bacillus subtilis, and the nucleotide sequence of the SacB gene is shown in SEQ ID NO: 1. According to the present application, the SacB gene can be inactivated or knocked out by conventional means in the art.

[0028] The present application provides a genetically engineered Bacillus subtilis chassis, which is deficient in the expression of SacB gene on the genome of Bacillus subtilis, and the nucleotide sequence of the SacB gene is shown in SEQ ID NO: 1. According to the present application, the SacB gene can be inactivated or knocked out by conventional means in the art.

[0029] The present application provides a genetically engineered Bacillus subtilis chassis, which is deficient in the expression of SacB gene on the genome of Bacillus subtilis, and the nucleotide sequence of the SacB gene is shown in SEQ ID NO: 1. According to the present application, the SacB gene can be inactivated or knocked out by conventional means in the art.

[0030] According to a preferred embodiment of the present application, the SacB gene can be knocked out by conventional means in the art, for example, by homologous recombination, constructing a knockout vector and electroporating into Bacillus subtilis, and then performing single or double exchange to knockout the gene from the genome, preferably, the knockout vector is pQ-T2 plasmid.

[0031] According to the present application, the overexpression of the aminopeptidase / alkaline protease can be achieved by conventional means in the art, for example, by introducing an expression vector containing an expression cassette of aminopeptidase-encoding gene ywaD or alkaline protease-encoding gene AprE into the chassis.

[0032] According to a preferred embodiment of the present application, the overexpression of the aminopeptidase / alkaline protease is achieved by electroporating an expression plasmid pWB980 containing an expression cassette of aminopeptidase-encoding gene ywaD or alkaline protease-encoding gene AprE into the chassis, respectively.

[0033] The present application provides a method for constructing the above-mentioned strain expressing aminopeptidase or alkaline protease, which comprises: inactivating or knocking out the SacB gene with the nucleotide sequence shown in SEQ ID NO: 1 in Bacillus subtilis WB600, and optionally introducing and overexpressing aminopeptidase-encoding gene ywaD or alkaline protease-encoding gene AprE in Bacillus subtilis.

[0034] According to a specific embodiment of the present application, the construction method comprises the following steps: knocking out the SacB gene in the original strain Bacillus subtilis WB600 to obtain a chassis strain WB600ΔSacB.

[0035] Further, an expression vector containing an aminopeptidase gene ywaD expression cassette is respectively transformed into the strains WB600 and WB600ΔSacB to obtain Bacillus subtilis WT-YwaD and WB600ΔSacB-YwaD with high aminopeptidase production.

[0036] Further, an expression vector containing an alkaline protease encoding gene AprE expression cassette is respectively transformed into the strains WB600 and WB600ΔSacB to finally obtain Bacillus subtilis WT-AprE and WB600ΔSacB-AprE with high alkaline protease production.

[0037] According to a more preferred embodiment of the present application, the construction method comprises the following steps:

[0038] (1) knocking out the SacB gene to obtain a chassis strain

[0039] The SacB gene is knocked out according to the following steps:

[0040] 1) obtaining homologous sequences up and down flanking the target gene by PCR amplification;

[0041] 2) obtaining a linear knockout plasmid vector by double digestion and agarose nucleic acid gel electrophoresis;

[0042] 3) obtaining a knockout plasmid by connecting the homologous sequences and the linear vector through seamless cloning technology;

[0043] 4) methylating the knockout plasmid by methylation induction;

[0044] 5) electrotransforming the methylated knockout plasmid into the competent cells of Bacillus subtilis WB600;

[0045] 6) screening the knockout strain through single and double exchange, and verifying the sequence through sequencing to obtain the chassis strain WB600ΔSacB;

[0046] The specific operation methods of the above steps can be realized according to the technical manuals, textbooks or literature reports easily obtained by the persons skilled in the art.

[0047] (2) overexpressing the aminopeptidase / alkaline protease gene

[0048] The recombinant plasmid carrying the aminopeptidase-encoding gene ywaD or the alkaline protease-encoding AprE expression cassette is respectively electroporated into the above-mentioned knockout strain WB600ΔSacB, as a comparison, and is also electroporated into the starting strain WB600, to obtain the aminopeptidase-producing engineering strain, which is named WB600ΔSacB-YwaD, WT-YwaD respectively, and the alkaline protease-producing engineering strain, which is named WB600ΔSacB-AprE, WT-AprE respectively.

[0049] The above-mentioned strains produce aminopeptidase or alkaline protease through shake flask fermentation.

[0050] The aminopeptidase enzyme activity determination method refers to the LNA method, that is, 1 enzyme activity unit (U / mL) is defined as the amount of enzyme required for 1 mL of enzyme solution to hydrolyze leucine p-nitroaniline to produce 1 μg of p-nitroaniline under the condition of 60℃ and pH 9 for 1 min. Each sample is set in triplicate, and the results are averaged. Reference: Y. Fundoiano-Hershcovitz, L. Rabinovitch, S. Shulami, V. Reiland, G. Shoham, and Y. Shoham (2005). The ywaD gene from Bacillus subtilis encodes a double-zinc aminopeptidase. FEMS Microbiol Lett, 243, 157-163.

[0051] The alkaline protease enzyme activity determination method refers to the Folin-phenol method in Appendix B of GB / T 23527-2009, that is, 1 enzyme activity unit (U / mL) is defined as the amount of enzyme required for 1 mL of enzyme solution to hydrolyze casein to produce 1 μg of tyrosine under the condition of 40℃ and pH 10.5 for 1 min. Each sample is set in triplicate, and the results are averaged.

[0052] According to a preferred embodiment of the present application, the aminopeptidase-encoding gene ywaD and the alkaline protease-encoding gene AprE are respectively introduced into the chassis strain by constructing recombinant plasmids P ly-2 -SP amyE -ywaD-pWB980, P ly-2 -SP amyE -AprE-pWB980, wherein the promoter P ly-2 and the signal peptide SP amyE The nucleotide sequence of the signal peptide SP is shown in SEQ ID NO: 4.

[0053] The present application provides the use of the above-mentioned strains in high-yield aminopeptidase or alkaline protease production.

[0054] According to a preferred embodiment of the present application, the genetically engineered strain WB600ASacB-YwaD is used for fermentative production of aminopeptidase, and the enzyme activity of aminopeptidase in the fermentation liquor of the genetically engineered strain reaches up to 1666.7 U / mL, which is about 30% higher than that of the strain WT-YwaD.

[0055] According to a preferred embodiment of the present application, the genetically engineered strain WB600ASacB-AprE is used for fermentative production of alkaline protease, and the enzyme activity of alkaline protease in the fermentation liquor of the genetically engineered strain reaches up to 6348 U / mL, which is about 20% higher than that of the strain WT-AprE.

[0056] The present application provides a method for efficiently producing aminopeptidase and alkaline protease, which comprises culturing the strain expressing aminopeptidase or alkaline protease under suitable conditions, and collecting aminopeptidase or alkaline protease from the culture.

[0057] According to a preferred embodiment of the present application, the suitable conditions refer to a culture temperature of 35-37℃, a rotation speed of 200-220 r / min, and the following fermentation medium composition:

[0058] 60 g of soybean cake powder is dissolved in 1 L of deionized water, NaOH is used to adjust the pH to 12, heating to 50-52℃, stirring for 1-2 h, cooling to room temperature, adjusting the ph to 7-7.3 with phosphoric acid, and centrifuging to obtain the supernatant for use. 100 ml of the supernatant is taken, 3 g of dextrin, 0.03 g of KH2PO4, and 0.4 g of Na2HPO4 are added.

[0059] The present application will be described in more detail through specific examples. Unless otherwise specified, the following examples are:

[0060] Seed medium: 5 g / L of yeast powder, 10 g / L of proteose peptone, 10 g / L of sodium chloride, and the rest is water;

[0061] Fermentation medium: 60 g of soybean cake powder is dissolved in 1 L of deionized water, NaOH is used to adjust the pH to 12, heating to 50-52℃, stirring for 1-2 h, cooling to room temperature, adjusting the ph to 7-7.3 with phosphoric acid, and centrifuging to obtain the supernatant for use. 100 ml of the supernatant is taken, 3 g of dextrin, 0.03 g of KH2PO4, and 0.4 g of Na2HPO4 are added.

[0062] The strains and plasmids involved in the present application and examples are shown in Table 1:

[0063] Table 1

[0064] Plasmid Use Resistance T2(2)-ori Knockout vector Kana P ly-2 -SP amyE -ywaD-pWB980]]> Carrying ywaD expression cassette Kana P ly-2 -SP amyE -AprE-pWB980]]> Carrying AprE expression cassette Kana

[0065] Note: T2 (2)-ori plasmid (pQ-T2 plasmid is used as a substitute in this application), disclosed in CN201810898060.8 A bacillus licheniformis strain with malR knocked out and a construction method and application;

[0066] PWB980 plasmid is a commercial plasmid.

[0067] The primer information involved in the examples is shown in Table 2:

[0068] Table 2

[0069] Primer name Sequence Restriction site SacB-up-F CCACCGCGGTGGCGGCCGCTCTAGAcacatatacctgccgttcactattatt Sma I SacB-up-R tcagcaggaagttcgtttctttcgcaaacgc SacB-down-F agaaacgaacttcctgctgaacatcaaaggc SacB-down-R TTAACGAATTCCTGCAGCCCGGG tgtgttctctttatccaccacgac BamHI SJH-F CCACCGCGGTGGCGGCCGCTCTAGAcacatatacctgccgttcactattatt SJH-R TAACGAATTCCTGCAGCCCGGGgatccttcagccatgaccatg XbaI-F TGCTACAGAGTTCTTGAAGTGGTGG DJH-down-R TAACGAATTCCTGCAGCCCGGGgatccttcagccatgaccatg DJH-up-F CCACCGCGGTGGCGGCCGCTCTAGAcacatatacctgccgttcactattatt SmaI-R: GTGATAACTCGGCGTATGTTATTCAAG

[0070] Example 1: Construction of genetically engineered strain

[0071] (1) Knockout of SacB gene

[0072] 1) Amplification of homologous sequences of target genes

[0073] According to the sequence of the SacB gene of Bacillus subtilis (SEQ ID NO. 1), the homologous arm sequences at the up end and the down end of the SacB gene sequence were designed and obtained by PCR amplification. The homologous arm amplification primers are shown in Table 2. The Bacillus subtilis WB600 genome was used as a template for PCR amplification. The amplification reaction system is as follows:

[0074] Primer F 2 μL Primer R 2 μL DNA template 2 μL PrimerStar enzyme 25 μL ddH2O 19 μL

[0075] The amplification program is set as follows: pre-denaturation: 95℃ 5min; denaturation: 95℃ 30s; annealing: 56℃ 45s; extension: 72℃ 5s; reaction for 30 cycles; extension: 72℃, 10min.

[0076] The PCR product was subjected to agarose gel electrophoresis, and the up end and the down end were electrophoretic bands between 1000bp and 1500bp. Then the PCR product was recovered by a small amount of DNA recovery kit, and the upstream and downstream homologous arm fragments of the SacB gene were obtained.

[0077] 2) Linearization of vector

[0078] The pQ-T2 plasmid was extracted, and the extraction process was referred to the operation manual of the kit. After double digestion with BamHI and SmaI, agarose gel electrophoresis was performed, and the product was recovered by a DNA gel recovery kit, obtaining the linearized vector sequence.

[0079] The double digestion system is as follows:

[0080]

[0081]

[0082] After mixing, the enzyme was cut for 2 h in a 37℃ water bath. After the reaction was completed, the enzyme cutting product was subjected to agarose gel electrophoresis, and the 4260 bp target band was recovered by a small amount of DNA recovery kit.

[0083] 3) Construction of knockout vector

[0084] The linear pQ-T2 plasmid fragment and the upstream and downstream homologous arms of the SacB gene obtained by enzyme cutting were connected by seamless cloning to form a recombinant plasmid pQ-T2-ΔSacB. (See the construction schematic diagram in Figure 1 )

[0085] The enzyme reaction system of seamless cloning is as follows:

[0086] Seamless cloning enzyme 5 μL Linear vector 2 μL Insert fragment 3 μL

[0087] After mixing, the reaction was carried out at 50℃ for 15 min.

[0088] 4) Methylation modification of the knockout vector and electrotransformation into B. amyloliquefaciens competent cells

[0089] The constructed knockout vector pQ-T2-ΔSacB was electrotransformed into EC135.P.Bam. competent cells. When the OD600 value of the culture solution was 0.2, 80 μL of 50 mg / mL aqueous solution of arabinose was added for methylation induction, and the culture was incubated at 30℃ overnight.

[0090] The methylation-modified knockout vector was electrotransformed into B. subtilis WB600 competent cells using the electrotransformation method, and colony PCR verification was performed using the knockout vector verification primers XbaI-F and SmaI-R.

[0091] 5) Single exchange verification

[0092] After the successfully electrotransformed single colony was cultured at 45℃ for 3-4 generations, it was diluted and plated, and single colonies were selected for colony PCR verification. Since single exchange may occur in the upstream or downstream homologous sequence during single exchange, two groups of primers XbaI-F, DJH-down-R and DJH-up-F, SmaI-R can be used for verification. Figure 2 )。

[0093] 6) Double exchange verification

[0094] The single colony with successful single exchange was cultured at 37℃ for 6-9 generations, diluted and plated, and single colonies were selected for colony PCR verification. The primers used were SJH-F and SJH-R. Figure 3 )。 The strain after single and double exchange verification was named: WB600ΔSacB.

[0095] (2) Introducing the aminopeptidase gene ywaD

[0096] The aminopeptidase gene ywaD was introduced into the WB600ΔSacB to construct the strain WB600ΔSacB-YwaD.

[0097] 1) The nucleotide sequence of the pLY-2 promoter and the Bacillus subtilis amyE signal peptide synthesized by Suzhou Jinyuzhi Biotechnology Co., Ltd. (as shown in SEQ ID NO: 4), and the nucleotide sequence of the aminopeptidase gene synthesized according to SEQ ID NO: 2;

[0098] 2) The pWB980 was extracted by a kit and subjected to EcoRI and BamHI double digestion, and the enzyme digestion system was as follows:

[0099] Plasmid / fragment 20 μL 10 x buffer 10 μL Restriction enzyme 5 μL each ddH2O 60 μL

[0100] 3) The pLY-2 promoter and the Bacillus subtilis amyE signal peptide fragment, the aminopeptidase gene ywaD recovery fragment, and the linearized vector pWB980 obtained by enzyme digestion were connected by using the seamless cloning enzyme purchased from Beijing Quanshi Jin Biotechnology Co., Ltd. to obtain the recombinant plasmid P ly-2 -SP amyE -ywaD-pWB980; the connection system was as follows:

[0101] pLY-2 promoter with B. subtilis amyE signal peptide fragment 1 μL Aminopeptidase gene recovery fragment 1 μL Linearized vector pWB980 3 μL Seamless cloning enzyme 5 μL

[0102] 4) After the reaction system in step 3) was reacted at 50°C for 15 min, it was transformed into Bacillus subtilis WB600 and WB600ΔSacB, and the method was as follows:

[0103] ① Respectively pick single colonies of newly activated Bacillus subtilis WB600 and WB600ΔSacB in 5 mL of LB liquid medium, and incubate at 37°C, 220 r / min, overnight;

[0104] ② Take 100 μL of the culture and transfer it to 5 mL of SPI medium, and incubate at 37°C, 220 r / min until the end of the logarithmic growth phase OD600 = 1.2 (about 3-4 h);

[0105] ③ Take 200 μL of the culture grown to the end of the logarithmic phase and transfer it to 2 mL of SPII medium, and incubate at 37°C, 100 r / min for 1.5 h;

[0106] ④ Add 20 μL of 10 mmol / L EGTA to the bacterial cells in the above SPII medium, and incubate at 37°C, 100 r / min for 10 min;

[0107] ⑤ Add the connection product: the recombinant plasmid P ly-2 -SPamyE - ywaD-pWB980, 37℃, 100 r / min for 30 min;

[0108] ⑥Adjust the rotation speed to 220 r / min, continue to culture for 1.5 h, take the bacterial liquid to spread on the LB screening plate containing 100 μg / mL kanamycin, and culture at 37℃ for 12 h, screen the positive transformants for verification. The genetically engineered strains producing aminopeptidase are named as WT-YwaD and WB600ΔSacB-YwaD respectively.

[0109] ⑦The construction method of alkaline protease producing strain is the same as that of aminopeptidase producing strain. First, the nucleotide sequence of pLY-2 promoter and Bacillus subtilis amyE signal peptide (as shown in SEQ ID NO: 4) is synthesized by Suzhou Jinyuzhi Biotechnology Co., Ltd., and the nucleotide sequence of alkaline protease gene is synthesized according to SEQ ID NO: 3; the pLY-2 promoter, Bacillus subtilis amyE signal peptide fragment, alkaline protease gene AprE recovery fragment and linearized vector pWB980 are connected by using seamless cloning enzyme purchased from Beijing Quanshi Gold Biotechnology Co., Ltd., to obtain recombinant plasmid P ly-2 - SP amyE - AprE-pWB980; the connection system is the same as above. The genetically engineered strains producing alkaline protease are named as WT-AprE and WB600ΔSacB-AprE respectively.

[0110] Example 2: Method for producing aminopeptidase and alkaline protease by genetically engineered strains

[0111] Shaking flask fermentation: the genetically engineered strains WT-YwaD, WB600ΔSacB-YwaD, WT-AprE and WB600ΔSacB-AprE are respectively subjected to three-zone streaking on LB plates, and cultured at 37℃ overnight, and the activated single colonies are picked to 5 mL LB medium, and cultured at 37℃, 220 r / min for 12 h, and then transferred to 50 mL LB liquid medium with 2% inoculation amount when the OD600 reaches 0.8-1.0, and then transferred to 100 mL fermentation medium in a baffle flask with 2% inoculation amount, and cultured at 37℃, 220 r / min for 12-60 h. Take samples at regular time intervals, centrifuge at 4℃, 12000 r / min for 2 min, and take the fermentation supernatant. After appropriate dilution, the aminopeptidase or alkaline protease enzyme activity is determined.

[0112] The results are as follows: Figure 4 and Figure 5As shown, after 48h shake flask fermentation, the aminopeptidase enzyme activity in the fermentation broth of WB600ΔSacB-YwaD reached 1666.7U / mL, which was about 30% higher than that in the fermentation broth of WT-YwaD strain; the alkaline protease enzyme activity in the fermentation broth of WB600ΔSacB-AprE reached 6348U / mL, which was about 20% higher than that in the fermentation broth of WT-AprE.

[0113] Fermentation medium: 60g soybean cake powder was dissolved in 1L deionized water, NaOH was added to adjust the pH to 12, heated to 50-52℃, stirred for 1-2h, cooled to room temperature, and the pH was adjusted to 7-7.3 with phosphoric acid, centrifuged to obtain the supernatant for use. 100mL of the supernatant was taken, 3g dextrin, 0.03g KH2PO4, and 0.4g Na2HPO4 were added.

[0114] Although the present application has been disclosed in the preferred embodiments as above, it is not intended to limit the present application, and any person skilled in the art can make various changes, modifications, replacements and variations in form and details to these embodiments without departing from the spirit and principles of the present application, and the scope of the present application is defined by the claims and their equivalents.

Claims

1. A genetically engineered bacterium expressing an aminopeptidase, characterized in that, The genetically engineered bacteria are obtained by knocking out the gene of SacB The genetically engineered bacteria are obtained by knocking out the gene of The genetically engineered bacteria are obtained by knocking out the gene of The amino acid sequence of the aminopeptidase is shown in SEQ ID NO.

2.

2. A genetically engineered bacterium expressing alkaline protease, characterized in that, The genetically engineered bacteria are obtained by knocking out the gene of SacB The base chassis is obtained by knocking out the gene of the Bacillus subtilis WB600, and then expressing alkaline protease in the chassis. The amino acid sequence of the alkaline protease is shown in SEQ ID NO.

3.

3. The use of the genetically engineered bacteria expressing aminopeptidase according to claim 1, characterized in that, The use in the production of aminopeptidases.

4. The use of the genetically engineered bacteria expressing alkaline protease according to claim 2, characterized in that, The use in the production of alkaline proteases.

Images