Application of primers for detecting tRF expression in brain tissue in the preparation of auxiliary diagnostic kits for methamphetamine addiction
Patent Information
- Application Number
- CN202211645154.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-19
- Publication Date
- 2025-08-26
- Estimated Expiration
- 2042-12-19
AI Technical Summary
而治疗Meth依赖的临床试验前景一直不容乐观,迄今尚无令人信服的理想治疗方案(et al,2017;Siefried et al,2020)
[0035] Compared with the prior art, the present invention has the advantage that tRF-1_32-Gly-GCC-2-M2, whose expression is specifically downregulated in the brain tissue of methamphetamine-addicted rats, can be used as a new molecular marker for the diagnosis of methamphetamine addiction. This molecular marker can be used to diagnose methamphetamine addiction simply and quickly. By using reagents such as TRIzol and isopropanol and employing methods such as mixing and centrifugation, RNA of good concentration and purity can be extracted. Only approximately 40 mg of brain tissue from rats self-administering methamphetamine is required to detect tsRNA, making it an effective tool for diagnosing methamphetamine addiction and assessing treatment efficacy, and has good clinical application prospects. The real-time quantitative PCR instrument used is a common instrument, and the SYBR Green fluorescent dye method does not require the design of separate probes to simultaneously detect the target tsRNA and an external reference gene, making it economical and convenient. The method provided by the present invention is of great significance for further studying the biological functions of tsRNA associated with methamphetamine addiction.
Smart Images

Figure CN116287186B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a method for detecting tRNA-derived fragments in the brain tissue of methamphetamine-addicted rats, and in particular to a method for detecting tsRNA in the brain tissue of methamphetamine-addicted rats by real-time quantitative reverse transcription-polymerase chain reaction using a fluorescent dye method and an application thereof. Background Art
[0002] In recent years, methamphetamine has become the drug with the largest number of abusers in my country. Drug abuse causes drug addicts to have reduced or lost their ability to work, causes financial losses to their families, induces crime, and increases the chances of HIV transmission, bringing serious instability to society and hindering social progress and economic development. To date, the treatment methods for heroin dependence have become relatively mature, mainly including methadone and buprenorphine maintenance treatment, which have been widely used (Schuckit, 2016; Townsend et al, 2021). However, the prospects for clinical trials for the treatment of methamphetamine dependence have not been optimistic, and there is no convincing ideal treatment plan to date ( et al., 2017; Siefried et al., 2020). Biomarker development may be one of the key tools for diagnosing, treating, and preventing drug addiction. However, research on methamphetamine biomarkers is still relatively scarce. Few established biomarkers are available for clinical guidance, and the search for new, stable, and reliable methamphetamine biomarkers remains a pressing challenge in drug addiction research. Therefore, research on methamphetamine biomarkers could not only identify markers for the molecular diagnosis and treatment of related diseases, but also help deepen our understanding of the pathogenesis of complex methamphetamine-induced psychiatric disorders and potentially become new therapeutic targets for these conditions.
[0003] With the rapid development of molecular biology techniques, recent studies have revealed that transfer RNA (tRNA)-derived small RNAs (tsRNAs) can regulate gene expression during transcription or post-transcriptional regulation and play a crucial role in the development and progression of many human diseases, making them a new hotspot in biomarker research. tRNAs can be cleaved into a heterogeneous group of ncRNAs ranging from 18 to 40 nucleotides in length, termed tRNA-derived small RNAs (tsRNAs). Based on their length and the number of cleavage sites, tsRNAs can be divided into two main types: tRNA-derived fragments (tRFs) and tRNA-derived stress-induced RNAs (tiRNAs). These RNAs were initially thought to be byproducts of random tRNA cleavage, due to their relatively stable structures due to the presence of various nucleotide modifications. Increasing evidence indicates the widespread involvement of tsRNAs in the pathogenesis of various diseases, including psychiatric and neurological disorders, paving the way for the development of tsRNA-based biomarkers (Shen et al., 2018). They serve as signaling molecules for cellular stress responses such as hypoxia, toxicity, and oxidation, as well as being important regulators of gene expression. These characteristics make tsRNAs promising for the development and application of disease diagnosis and treatment methods. Summary of the Invention
[0004] The technical problem to be solved by the present invention is to provide a primer for detecting the expression of tRF-1_32-Gly-GCC-2-M2 in tissues in response to the above-mentioned existing technical status and to use it in the preparation of a methamphetamine addiction auxiliary diagnostic kit.
[0005] The technical solution adopted by the present invention to solve the above technical problems is: the use of the primer for detecting the expression of tRF-1_32-Gly-GCC-2-M2 in tissue in the preparation of a methamphetamine addiction auxiliary diagnostic kit, characterized in that the nucleotide sequence of the tRF-1_32-Gly-GCC-2-M2 is as shown in SEQ ID NO: 1, and the specific expression of the tRF-1_32-Gly-GCC-2-M2 in the brain tissue of methamphetamine-addicted rats is downregulated:
[0006] The primers are:
[0007] F1: 5'GATCGCATGGGTGGTTCAGT 3';
[0008] R1: 5'CTCTTCCGATCTAGGCGAGAAT 3'.
[0009] Furthermore, the kit also includes specific upstream and downstream primers for amplification of the external reference gene U6:
[0010] F2: 5'GCTTCGGCAGCACATATACTAAAAT 3'
[0011] R2: 5'CGCTTCACGAATTTGGCGTGTCAT 3'.
[0012] Among them, the tsRNA molecular marker for methamphetamine addiction detection is tRF-1_32-Gly-GCC-2-M2, and the corresponding tRNAs are tRNA-Gly-GCC-2-1 and tRNA-Gly-GCC-3-1, that is, these two tRNAs can produce the tsRNA. The nucleotide sequence of the tsRNA is shown in SEQ ID NO: 1, which is GCATGGGTGGTTCAGTGGTAGAATTCTCGCCT.
[0013] The present invention also provides a method for detecting tsRNA molecular markers, characterized in that the method comprises the following steps:
[0014] (1) A methamphetamine self-administration model was established in rats. The rats were anesthetized and the nucleus accumbens brain tissue was obtained to extract total RNA from the tissues.
[0015] (2) Pre-treating the total RNA and specifically reverse-transcribing it into cDNA;
[0016] (3) The cDNA was subjected to fluorescent dye qRT-PCR detection. After the reaction, the Cq values of tRF-1_32-Gly-GCC-2-M2 and the external reference gene U6 in the sample were detected;
[0017] (4) Based on the Cq value, the tsRNA level was normalized by the expression level of the external reference gene U6, and the PCR relative quantitative value of tRF-1_32-Gly-GCC-2-M2 was calculated using the ΔCq formula, where ΔCq = Cq(tRF-1_32-Gly-GCC-2-M2) - Cq(U6);
[0018] When the PCR relative quantitative value ΔCq of the tRF-1_32-Gly-GCC-2-M2 biomarker in the sample is less than or equal to 2.572, it is considered to be a non-methamphetamine addicted sample; when it is greater than 2.572, it is considered to be a methamphetamine addicted sample.
[0019] The process of extracting total RNA from the brain tissue of the methamphetamine self-administration model rats in step (1) is as follows:
[0020] Step a: Collect brain tissue samples: Excise approximately 40 mg of normal rat NAc nucleus tissue and immerse it in a 2.5 mL nuclease-free centrifuge tube. If not used immediately, store it in a -80°C ultra-low temperature freezer.
[0021] Step b, tissue lysis: Remove the tissue from step a from the -80°C freezer and thaw on ice. Add 1 mL of Trizol reagent to a 2.5 mL centrifuge tube and thoroughly grind the brain tissue into a homogenate using an electric homogenizer. Incubate at 15-30°C for 5 minutes to completely dissociate the nucleic acid-protein complex.
[0022] Step c, chloroform extraction: Add 200 μL of chloroform, shake the tube vigorously by hand for 15 seconds, and incubate at 15 to 30°C for 2 to 3 minutes. Centrifuge at 12,000 rpm and 4°C for 15 minutes. After centrifugation, the mixture will separate into a lower red phenol-chloroform phase, an intermediate layer, and an upper colorless aqueous phase. The RNA is completely distributed in the aqueous phase. The volume of the aqueous phase is approximately 60% of the TRIReagent added during homogenization.
[0023] Step d, isopropanol precipitation: Transfer the aqueous phase to a new centrifuge tube, add an equal volume of isopropanol to the upper aqueous phase from step c, shake to mix, incubate at 15 to 30°C for 10 minutes, centrifuge at 12,000 rpm, 4°C for 10 minutes, and discard the supernatant to obtain the RNA precipitate;
[0024] Step e, ethanol washing and precipitation: discard the supernatant and add 1 mL of 75% ethanol to wash the precipitate. Centrifuge at 7500 rpm for 5 minutes at 4°C, discard the supernatant, let it stand at room temperature for 10 minutes to dry, and then add 15 μL of nuclease-free water to dissolve the precipitate. First, add RNase-free water and repeatedly pipette several times with a gun, then incubate at 55 to 60°C for 10 minutes. This is the total RNA extract from the tissue. The obtained RNA solution is stored at -70°C;
[0025] Step f, RNA concentration detection: Use NanoDrop2000 to detect the concentration and OD value of the sample RNA. If the OD260 / 280 value is between 1.8 and 2.1, subsequent experiments can be carried out;
[0026] Step g, 3' end deacetylation treatment: prepare the deacetylation reaction solution according to Table 1, vortex mix, incubate at 37°C for 40 minutes, then add 19 μL Deacylation Stop Buffer, vortex mix, and incubate at room temperature for 5 minutes to terminate the deacetylation reaction;
[0027] Step h, 3'-cP removal and 5'-P addition: Place the reaction mixture from step f on ice and add the reagents listed in Table 2 in sequence. Vortex to mix and incubate at 37°C for 40 minutes. Incubate at 70°C for 5 minutes to terminate the reaction. Then, re-extract RNA.
[0028] Step i, Demethylation: Prepare the demethylation reaction solution according to Table 3, then incubate in a 37°C water bath for 2 hours to allow the demethylation reaction to proceed. Then, add 40 μL of Nuclease-free Water and 10 μL of Demethylation Stop Buffer (5×) to terminate the demethylation reaction, and then re-extract the RNA.
[0029] Step j, ligation of 3′ linkers: Add the reagents listed in Table 4 to a 200 μL nuclease-free PCR tube, incubate at 70°C for 2 minutes in a thermal cycler, then move the tube to ice, add the reagents listed in Table 5, and incubate at 25°C for 1 hour in a thermal cycler.
[0030] Step k, Reverse Transcription Primer Hybridization: Add 2.3 μL of Nuclease-free Water and 0.5 μL of Reverse Transcription Primer to the PCR tube from step j to make a total volume of 12.8 μL; incubate in a thermal cycler at 75°C for 5 minutes, 37°C for 15 minutes, and 25°C for 15 minutes.
[0031] Step 1, ligation of 5' adapters: Resuspend the 5' adapter in 20 μL of enzyme-free water. Add 0.6 N μL of the 5' adapter to a separate 200 μL nuclease-free PCR tube (N is the number of samples processed in the experiment). Incubate in a thermal cycler at 70°C for 2 minutes and then immediately cool on ice. Add the reactants in Table 6 to the PCR tube in step k, mix thoroughly, and incubate in a thermal cycler at 25°C for 1 hour.
[0032] Step m. Specific reverse transcription of the RNA pretreated in Step 1: Add the reverse transcription reagents in Table 7 to a nuclease-free 200 μL PCR tube. Incubate in a 50°C thermal cycler for 1 hour, then immediately cool on ice. The reaction product can be used directly for PCR amplification. If PCR amplification is not planned immediately, incubate in a 70°C thermal cycler for 15 minutes to terminate the RT reaction; then store the sample in a -20°C freezer.
[0033] The real-time quantitative PCR reaction conditions in step (3) are as follows: 95°C, 10 min; 40 PCR cycles (95°C, 10 s; 60°C, 60 s (collecting fluorescence)); in order to establish the melting curve of the PCR product, after the amplification reaction, the reaction was continued according to (95°C, 10 s; 60°C, 60 s; 95°C, 15 s); and then slowly heated from 60°C to 95°C;
[0034] The present invention also provides a use of a tsRNA molecular marker in preparing a methamphetamine addiction auxiliary diagnosis kit. The kit includes enzymes and reagents commonly used in PCR reactions, such as Taq enzyme, dNTP mixture, fluorescent reagent, PCR buffer, and diethylpyrocarbonate (DEPC) water.
[0035] Compared with the prior art, the present invention has the advantage that tRF-1_32-Gly-GCC-2-M2, whose expression is specifically downregulated in the brain tissue of methamphetamine-addicted rats, can be used as a new molecular marker for the diagnosis of methamphetamine addiction. This molecular marker can be used to diagnose methamphetamine addiction simply and quickly. By using reagents such as TRIzol and isopropanol and employing methods such as mixing and centrifugation, RNA of good concentration and purity can be extracted. Only approximately 40 mg of brain tissue from rats self-administering methamphetamine is required to detect tsRNA, making it an effective tool for diagnosing methamphetamine addiction and assessing treatment efficacy, and has good clinical application prospects. The real-time quantitative PCR instrument used is a common instrument, and the SYBR Green fluorescent dye method does not require the design of separate probes to simultaneously detect the target tsRNA and an external reference gene, making it economical and convenient. The method provided by the present invention is of great significance for further studying the biological functions of tsRNA associated with methamphetamine addiction. BRIEF DESCRIPTION OF THE DRAWINGS
[0036] Figure 1 This is a graph showing the results of next-generation sequencing of tsRNA in brain tissue of rats self-administering methamphetamine in Example 1 of the present invention;
[0037] Figure 2 Graph showing the amplification curves of tRF-1_32-Gly-GCC-2-M2 and U6 in brain tissues of normal rats and brain tissues of methamphetamine-addicted rats in Example 2 of the present invention;
[0038] Figure 3 The tRF-1_32-Gly-GCC-2-M2 in Example 3 of the present invention is significantly underexpressed in methamphetamine-addicted tissues;
[0039] Figure 4 This is the ROC curve of tRF-1_32-Gly-GCC-2-M2 in Example 3 of the present invention. DETAILED DESCRIPTION
[0040] The present invention will be described in further detail below with reference to the accompanying drawings and embodiments.
[0041] Example 1
[0042] Detection of the expression of tRF-1_32-Gly-GCC-2-M2 in the brain tissues of methamphetamine-addicted rats and normal rats:
[0043] Sequencing detection: The next generation sequencing method was used to detect the levels of tsRNA in the brain tissues of methamphetamine-addicted rats and normal rats using tsRNA sequencing reagents from Arraystar, USA.
[0044] Result analysis: The results are as follows Figure 1 As shown in Figure 2, by analyzing the brain tissues of methamphetamine-addicted rats and normal rats, the molecular markers of tsRNA-derived fragments with significantly downregulated expression were obtained. The difference in tRF-1_32-Gly-GCC-2-M2 between the brain tissues of methamphetamine-addicted rats and normal rats was 2.13 times. Figure 1 As indicated by the arrow, tRF-1_32-Gly-GCC-2-M2 may serve as a novel biomarker molecule specific for methamphetamine addiction.
[0045] Example 2
[0046] Normal rat brain tissue was collected as a normal control group, and tsRNA was detected according to the following steps, including the following steps:
[0047] Step a: Collect brain tissue samples: Excise approximately 40 mg of normal rat NAc nucleus tissue and immerse it in a 2.5 mL nuclease-free centrifuge tube. If not used immediately, store it in a -80°C ultra-low temperature freezer.
[0048] Step b, tissue lysis: Remove the tissue from step a from the -80°C freezer and thaw on ice. Add 1 mL of Trizol reagent to a 2.5 mL centrifuge tube and thoroughly grind the brain tissue into a homogenate using an electric homogenizer. Incubate at 15-30°C for 5 minutes to completely dissociate the nucleic acid-protein complex.
[0049] Step c, chloroform extraction: Add 200 μL of chloroform, shake the tube vigorously by hand for 15 seconds, and incubate at 15 to 30°C for 2 to 3 minutes. Centrifuge at 12,000 rpm and 4°C for 15 minutes. After centrifugation, the mixture will separate into a lower red phenol-chloroform phase, an intermediate layer, and an upper colorless aqueous phase. The RNA is completely distributed in the aqueous phase. The volume of the aqueous phase is approximately 60% of the TRIReagent added during homogenization.
[0050] Step d, isopropanol precipitation: Transfer the aqueous phase to a new centrifuge tube, add an equal volume of isopropanol to the upper aqueous phase from step c, shake to mix, incubate at 15 to 30°C for 10 minutes, centrifuge at 12,000 rpm, 4°C for 10 minutes, and discard the supernatant to obtain the RNA precipitate;
[0051] Step e, ethanol washing and precipitation: discard the supernatant and add 1 mL of 75% ethanol to wash the precipitate. Centrifuge at 7500 rpm for 5 minutes at 4°C, discard the supernatant, let it stand at room temperature for 10 minutes to dry, and then add 15 μL of nuclease-free water to dissolve the precipitate. First, add RNase-free water and repeatedly pipette several times with a gun, then incubate at 55 to 60°C for 10 minutes. This is the total RNA extract from the tissue. The obtained RNA solution is stored at -70°C;
[0052] Step f, detecting RNA concentration: using NanoDrop2000 to detect the concentration and OD value of the sample RNA, if the OD260 / 280 value is between 1.8-2.1, subsequent experiments can be carried out.
[0053] Step g, 3' end deacetylation treatment: prepare the deacetylation reaction solution according to Table 1, vortex mix, incubate at 37°C for 40 minutes, then add 19 μL Deacylation Stop Buffer, vortex mix, and incubate at room temperature for 5 minutes to terminate the deacetylation reaction;
[0054] Step h, 3'-cP removal and 5'-P addition: Place the reaction mixture from step f on ice and add the reagents listed in Table 2 in sequence. Vortex to mix and incubate at 37°C for 40 minutes. Incubate at 70°C for 5 minutes to terminate the reaction. Then, re-extract RNA.
[0055] Step i, Demethylation: Prepare the demethylation reaction solution according to Table 3, then incubate in a 37°C water bath for 2 hours to allow the demethylation reaction to proceed. Then, add 40 μL of Nuclease-free Water and 10 μL of Demethylation Stop Buffer (5×) to terminate the demethylation reaction, and then re-extract the RNA.
[0056] Step j, ligation of 3′ linkers: Add the reagents listed in Table 4 to a 200 μL nuclease-free PCR tube, incubate at 70°C for 2 minutes in a thermal cycler, then move the tube to ice, add the reagents listed in Table 5, and incubate at 25°C for 1 hour in a thermal cycler.
[0057] Step k, Reverse Transcription Primer Hybridization: Add 2.3 μL of Nuclease-free Water and 0.5 μL of Reverse Transcription Primer to the PCR tube from step j to make a total volume of 12.8 μL; incubate in a thermal cycler at 75°C for 5 minutes, 37°C for 15 minutes, and 25°C for 15 minutes.
[0058] Step 1, ligation of 5' adapters: Resuspend the 5' adapter in 20 μL of enzyme-free water, add 0.6 N μL of the 5' adapter to a separate 200 μL nuclease-free PCR tube (N is the number of samples processed in the experiment), incubate in a thermal cycler at 70°C for 2 minutes, and then immediately cool on ice; add the reactants in Table 6 to the PCR tube in step k, mix thoroughly, and incubate in a thermal cycler at 25°C for 1 hour;
[0059] Step m: Specific reverse transcription of the RNA pretreated in step 1 above: Add the reverse transcription reactants in Table 7 to a nuclease-free 200 μL PCR tube, incubate in a thermal cycler at 50°C for 1 hour, and then immediately cool on ice. The reaction product can be directly used for PCR amplification. If PCR amplification is not planned to be performed immediately, incubate in a thermal cycler at 70°C for 15 minutes to terminate the RT reaction; then store the sample in a -20°C refrigerator.
[0060] Step n, fluorescent dye qRT-PCR detection: The reverse transcription product obtained in step m above was added to the reaction system according to the ratio in Table 8, and the PCR parameters were set according to the program in Table 9;
[0061] The specific amplification upstream and downstream primers of tRF-1_32-Gly-GCC-2-M2 used are:
[0062] F1:5'GATCGCATGGGTGGTTCAGT 3';
[0063] R1:5'CTCTTCCGATCTAGGCGAGAAT 3';
[0064] The specific upstream and downstream primers for amplification of the external reference gene U6 used are:
[0065] F2: 5'GCTTCGGCAGCACATATACTAAAAT 3';
[0066] R2: 5'CGCTTCACGAATTTGGCGTGTCAT 3'.
[0067] Table 1. Deacetylation reaction solution
[0068]
[0069] Table 2. Reaction solutions for 3'-cP removal and 5'-P addition
[0070]
[0071] Table 3. Demethylation reaction solution
[0072]
[0073] Table 4. 3′ linker ligation reaction solution 1
[0074]
[0075] Table 5. 3′ linker ligation reaction solution 2
[0076]
[0077] Table 6. Reaction solution for ligating 5' linkers
[0078]
[0079] Table 7. Specific reverse transcription reaction system
[0080]
[0081] Table 8. Fluorescent dye quantitative PCR reaction system
[0082]
[0083] Table 9. PCR parameters
[0084]
[0085]
[0086] from Figure 2 It can be seen that tRF-1_32-Gly-GCC-2-M2 and U6 are effectively amplified in the tissues of normal rats and methamphetamine-addicted rats, and amplification curves of the expression levels of U6 and tRF-1_32-Gly-GCC-2-M2 in tissue samples can be obtained. From the amplification curve of U6, the Cq values of the detected methamphetamine-addicted rat tissue and normal rat tissue specimens are 16.51 and 16.53, respectively. From the amplification curve of tRF-1_32-Gly-GCC-2-M2, the Cq values of the detected methamphetamine-addicted rat tissue and normal rat tissue specimens are 20.19 and 18.54, respectively. A comparison of the expression levels of tRF-1_32-Gly-GCC-2-M2 in methamphetamine-addicted rat tissue and normal rat tissue specimens can be obtained, which is consistent with the results of gene sequencing in Example 1.
[0087] Using the Cq values of U6 and tRF-1_32-Gly-GCC-2-M2 in the same sample, the formula ΔCq = Cq (tRF-1_32-Gly-GCC-2-M2) -Cq (U6)The ΔCq value of tRF-1_32-Gly-GCC-2-M2 was calculated, and the relative expression level of tRF-1_32-Gly-GCC-2-M2 could be determined based on the ΔCq value; the smaller the ΔCq value, the higher the corresponding expression level of tRF-1_32-Gly-GCC-2-M2, and the larger the ΔCq value, the lower the corresponding expression level of tRF-1_32-Gly-GCC-2-M2;
[0088] from Figure 2 It can be seen that the ΔCq of normal tissue is 2.01; the ΔCq of methamphetamine-addicted rat tissue is 3.69, which is significantly greater than the ΔCq value of normal tissue, indicating that tRF-1_32-Gly-GCC-2-M2 is lowly expressed in the tissues of methamphetamine-addicted rats.
[0089] Example 3
[0090] Method for detecting methamphetamine addiction using the tRF-1_32-Gly-GCC-2-M2 biomarker
[0091] 1. Establish a methamphetamine self-administration model in rats;
[0092] 2. Extraction of RNA from methamphetamine-addicted rat tissues (the extraction method is the same as in Example 2);
[0093] 3. Specific reverse transcription and fluorescent dye qRT-PCR detection were performed in the same manner as in Example 2, “Specific reverse transcription and fluorescent dye qRT-PCR detection”;
[0094] 4. Using tRF-1_32-Gly-GCC-2-M2 as a biomarker for methamphetamine addiction, the expression levels of tRF-1_32-Gly-GCC-2-M2 were analyzed in tissues from 18 methamphetamine-addicted rats and 16 normal rats. The ΔCq of tRF-1_32-Gly-GCC-2-M2 in methamphetamine-addicted rats was significantly higher than that in the normal group (P<0.0001), indicating that the expression level of tRF-1_32-Gly-GCC-2-M2 in the methamphetamine-addicted rats was significantly lower than that in the normal group. Figure 3 The cutoff value of tRF-1_32-Gly-GCC-2-M2 as a methamphetamine addiction marker is 2.572. When the PCR relative quantitative value ΔCq of the tRF-1_32-Gly-GCC-2-M2 biomarker in the sample is less than or equal to 2.572, it is considered to be a non-methamphetamine addicted sample; when it is greater than 2.572, it is considered to be a methamphetamine addicted sample.
[0095] 5. Detect the tRF-1_32-Gly-GCC-2-M2 levels in 18 methamphetamine-addicted rat tissues and 16 normal rat tissues, and create an ROC curve. Figure 4 As shown, the AUC value was 0.9965, P < 0.0001. Table 10 shows the results of using tRF-1_32-Gly-GCC-2-M2 as a biomarker for the diagnosis of methamphetamine addiction. It can be concluded that the sensitivity of tRF-1_32-Gly-GCC-2-M2 as a marker for methamphetamine addiction is 94.44% and the specificity is 100%.
[0096] Table 10. Results of using tRF-1_32-Gly-GCC-2-M2 as a biomarker for the diagnosis of methamphetamine addiction
[0097]
[0098] Example 4 Detection kit and its application
[0099] The tRF-1_32-Gly-GCC-2-M2 biomarker detection kit for methamphetamine addiction detection in the present embodiment, except containing conventional real-time quantitative PCR reagent, also includes the detection primer of external reference and the detection primer of tRF-1_32-Gly-GCC-2-M2.Wherein, conventional real-time quantitative PCR reagent includes Taq enzyme, dNTP reagent, fluorescent reagent, PCR buffer, DEPC (diethyl pyrocarbonate) treated water (RNase free water).When utilizing above-mentioned detection kit to detect, its specific operating method can carry out the detection of sample and the judgment of methamphetamine addiction with reference to the operating method of embodiment two.
[0100] The detection kit in this example can be used to simply, quickly, and conveniently detect the tRF-1_32-Gly-GCC-2-M2 biomarker to determine methamphetamine addiction, and has important value as an auxiliary diagnostic method for methamphetamine addiction.
Claims
1. Use of a primer for detecting tRF-1_32-Gly-GCC-2-M2 expression in tissues in the preparation of a methamphetamine addiction auxiliary diagnostic kit, characterized in that: The nucleotide sequence of tRF-1_32-Gly-GCC-2-M2 is shown in SEQ ID NO:
1. The expression of tRF-1_32-Gly-GCC-2-M2 is specifically downregulated in the tissues of methamphetamine-addicted rats: The primers are: F1: 5'GATCGCATGGGTGGTTCAGT 3'; R1: 5'CTCTTCCGATCTAGGCGAGAAT 3'.
2. The use according to claim 1, characterized in that: The kit also includes specific upstream and downstream primers for amplification of the external reference gene U6: F2: 5'GCTTCGGCAGCACATATACTAAAAT 3' R2: 5'CGCTTCACGAATTTGGCGTGTCAT 3'.
Citation Information
Patent Citations
Short non-coded RNA and application thereof
CN106636089A
KR20210069264A