Molecular marker for rapid identification of genetic sex of early age labroides dimidiatus and application thereof
By using 2b-RAD simplified genome high-throughput sequencing technology to screen specific molecular markers and design primer pairs, the problem of genetic sex identification of *Scophila glabripennis* has been solved, achieving accuracy and efficiency in early sex identification of *Scophila glabripennis*, promoting the breeding of all-female or high-female-ratio seedlings, and improving the economic benefits of *Scophila glabripennis* farming.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- ZHEJIANG INST OF FRESH WATER FISHERIES
- Filing Date
- 2023-02-21
- Publication Date
- 2026-05-12
AI Technical Summary
Current technology cannot effectively identify the genetic sex of the broodstock, which affects the breeding of all-female or high-female-ratio fry and restricts the improvement of broodstock farming yield and economic benefits.
Specific molecular markers were screened using 2b-RAD simplified genome high-throughput sequencing technology, and primer pairs were designed to rapidly identify the genetic sex of the 'Scoidea glaciana' through PCR amplification and agarose gel electrophoresis.
It enables accurate identification of the genetic sex of early-stage broiler fish, supports the breeding of all-female or high-female-ratio fry, and improves aquaculture yield and economic benefits.
Smart Images

Figure CN116287302B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a molecular marker, and more particularly to a molecular marker for rapid identification of the genetic sex of early-stage *Scophila spp.* and its applications. It belongs to the field of fish sex identification technology. Background Technology
[0002] The fasciatus fasciatus, commonly known as the freshwater grouper, belongs to the family Cyprinidae, subfamily Barbinae, and genus Acrossocheilus. In its natural habitat, it inhabits fast-flowing environments in mountain streams or the upper reaches of rivers. Currently, it is being promoted for aquaculture as a local stream fish species with high economic value, and in recent years has become a key small economic fish species being developed in the mountainous areas of western Zhejiang.
[0003] The *Scleroderma gracilis* exhibits typical sexual dimorphism, with females growing significantly faster than males. Therefore, breakthroughs in asexual breeding techniques to cultivate all-female or high-female-to-male-ratio fry may be beneficial for increasing aquaculture yield and economic benefits. For this reason, developing molecular markers closely linked to sex in *Scleroderma gracilis* is a key factor in implementing all-female asexual breeding techniques and can also provide important information for elucidating the regulatory mechanisms of sex determination in *Scleroderma gracilis*. Chinese invention patent application CN1880478A discloses a female-specific AFLP fragment and a PCR method for genetic sex identification in *Scleroderma gracilis*, which has advantages such as speed, accuracy, and sensitivity; however, it is not applicable to sex identification in *Scleroderma gracilis*. Currently, there are no reports of effective sex-linked molecular markers for *Scleroderma gracilis*. Summary of the Invention
[0004] The purpose of this invention is to provide a DNA molecular marker suitable for rapid identification of the genetic sex of early-stage *Scophila glabripennis*. This provides important data support for the breeding of all-female juvenile *Scophila glabripennis* and the sex regulation mechanism.
[0005] To achieve the above objectives, the specific technical solution of the present invention is as follows:
[0006] A molecular marker for rapid identification of the genetic sex of early-stage *Gymnocypris spp.* has the nucleotide sequence SEQ ID NO 1: GGTCAACAAACAAACTCTCCTCGATT.
[0007] This invention first provides a specific molecular marker obtained based on 2b-RAD simplified genome high-throughput sequencing technology. This marker is used to facilitate rapid detection of genetic sex in juvenile *Scophila glabripennis* using PCR.
[0008] Another object of the present invention is to provide primer pairs for detecting the molecular markers.
[0009] The primer pair used to detect the above molecular markers includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is SEQ ID NO 2: TTTCAACGTCTTGTGCAAAGAGTC; and the nucleotide sequence of the downstream primer is SEQ ID NO 3: GCCATTCCTGAAAATCTGCATAAC.
[0010] This invention performs a survey analysis on the genome of the bryophyll carp, obtains the sequences at both ends of the molecular marker based on the survey results, and provides primer pairs for detecting the molecular marker, namely SEQ ID NO 2 and SEQ ID NO 3.
[0011] Secondly, the present invention also provides a method for rapidly identifying the genetic sex of the bryophyll fish using PCR amplification via the aforementioned specific markers.
[0012] A rapid method for identifying the genetic sex of a bryophyll fish includes the following steps:
[0013] a. To prepare the DNA extraction solution, cut a small amount of tail fin tissue, break the tissue in a centrifuge tube, add DNA lysis buffer and Proteinase K, incubate, heat in a metal bath, cool to room temperature, centrifuge, and the supernatant is the crude DNA extract.
[0014] b. Using the crude DNA extract as a template, perform PCR amplification to obtain PCR products; the primers are the specific molecular markers described in claim 1.
[0015] c. Perform agarose gel electrophoresis on the above PCR products. Determine the results: if the electrophoresis results show two bands, it is male; if there is only one band, it is female.
[0016] As a preferred embodiment of the above technical solution, in step a), a DNA extraction solution is prepared using a rapid nucleic acid lysis method.
[0017] As a preferred embodiment of the above technical solution, in step a), the DNA lysis buffer is universal DNAzol, and the volume is 200 μL; the Proteinase K specification is 20 mg / mL, and the volume is 2 μL.
[0018] As a preferred embodiment of the above technical solution, in step a), the specific operation is as follows: DNA extraction solution is prepared using a rapid nucleic acid lysis method; a small amount of tail fin tissue is cut off and the tissue is broken up in a 1.5 mL centrifuge tube; 200 μL of universal DNAzol lysis buffer and 2 μL of 20 mg / mL Proteinase K are added; the mixture is incubated at 55 °C for 30 min; then heated in a 95 °C metal bath for 5 min and cooled to room temperature; the tissue material is then gently centrifuged at room temperature to precipitate; the supernatant is the crude DNA extraction solution.
[0019] As a preferred embodiment of the above technical solution, in step b), the PCR reaction system is as follows: 2 μL DNA template; 12.5 μL 2x Super PfxMasterMix; 2 μL each of upstream and downstream primers; and sterile water to a final volume of 25 μL.
[0020] As a preferred embodiment of the above technical solution, in step b), the PCR reaction program is as follows: 98℃, 1 min; 98℃, 10 s; 55℃, 20 s; 72℃, 30 s; 35 cycles; 72℃, 5 min.
[0021] As a preferred embodiment of the above technical solution, in step c), the concentration of agarose gel is 1%.
[0022] As a preferred embodiment of the above technical solution, in step c), the result is determined as follows: if the electrophoresis result shows one band of about 300 bp and one band of about 500 bp, it is determined to be male; if the electrophoresis result shows one band of about 300 bp, it is determined to be female.
[0023] In summary, the present invention has the following beneficial effects:
[0024] 1) This invention screened and obtained molecular markers that can be used for early genetic sex identification of the bryophyll carp, which has an important auxiliary role in the later development of asexual breeding;
[0025] 2) The method for sex identification implemented in this invention does not require genome extraction, only requires a very small amount of tissue to achieve sex identification, and the individual being tested can continue to survive;
[0026] 3) The sex determination of the bryophyll carp using this invention has high accuracy;
[0027] 4) The molecular markers provided by this invention can be used for breeding all-female or high-female-ratio broodfish, which will help the rapid development of this industry chain. Attached Figure Description
[0028] Figure 1 These are sex-specific markers for the *Sclerodermus fasciatus* from Examples 1-10 of this invention;
[0029] In the figure, M represents the standard molecular weight. Detailed Implementation
[0030] The present invention will be further explained and described below with reference to the accompanying drawings. This specific embodiment is merely an explanation of the present invention and is not intended to limit it. Any changes made by those skilled in the art after reading this specification, as long as they fall within the scope of the claims, will be protected by patent law.
[0031] Example 1
[0032] The specific steps for quickly identifying the genetic sex of the ichthyosaur are as follows:
[0033] a. DNA extraction solution was prepared using a rapid nucleic acid lysis method. A small amount of tail fin tissue was cut from a known female bryorrhizoid culter (female No. 1), and the tissue was lysed in a 1.5 mL centrifuge tube. 200 μL of Universal DNAzol lysis buffer and 2 μL of 20 mg / mL Proteinase K were added. The mixture was incubated at 55 °C for 30 min, then heated in a 95 °C metal bath for 5 min and cooled to room temperature. The tissue material was then gently centrifuged at room temperature to precipitate the tissue material. The supernatant was the crude DNA extract.
[0034] b. Using the extracted nucleic acid solution as a template, PCR amplification was performed. The primers were specific molecular markers. The PCR reaction system was as follows: 2 μL DNA template; 12.5 μL 2x Super Pfx MasterMix (Beijing Kangwei); 2 μL each of forward and reverse primers; and sterile water to a final volume of 25 μL. The PCR reaction program was as follows: 98℃, 1 min; 98℃, 10 s; 55℃, 20 s; 72℃, 30 s; 35 cycles; 72℃, 5 min.
[0035] c. Perform 1% agarose gel electrophoresis on the above PCR products. The electrophoresis results are as follows: Figure 1 As shown, there is only a single band of about 300bp. It is identified as female, which is consistent with the results.
[0036] Example 2
[0037] The specific steps for quickly identifying the genetic sex of the ichthyosaur are as follows:
[0038] a. DNA extraction solution was prepared using a rapid nucleic acid lysis method. A small amount of tail fin tissue was cut from a known female bryorrhiza (female No. 2), and the tissue was lysed in a 1.5 mL centrifuge tube. 200 μL of Universal DNAzol lysis buffer and 2 μL of 20 mg / mL Proteinase K were added. The mixture was incubated at 55 °C for 30 min, then heated in a 95 °C metal bath for 5 min and cooled to room temperature. The tissue material was then gently centrifuged at room temperature to precipitate the tissue material. The supernatant was the crude DNA extract.
[0039] b. Using the extracted nucleic acid solution as a template, PCR amplification was performed. The primers were specific molecular markers. The PCR reaction system was as follows: 2 μL DNA template; 12.5 μL 2x Super Pfx MasterMix (Beijing Kangwei); 2 μL each of forward and reverse primers; and sterile water to a final volume of 25 μL. The PCR reaction program was as follows: 98℃, 1 min; 98℃, 10 s; 55℃, 20 s; 72℃, 30 s; 35 cycles; 72℃, 5 min.
[0040] c. Perform 1% agarose gel electrophoresis on the above PCR products. The electrophoresis results are as follows: Figure 1 As shown, there is only a single band of about 300bp. It is identified as female, which is consistent with the results.
[0041] Example 3
[0042] The specific steps for quickly identifying the genetic sex of the ichthyosaur are as follows:
[0043] a. DNA extraction solution was prepared using a rapid nucleic acid lysis method. A small amount of tail fin tissue from a known female bryorrhiza (female No. 3) was cut and lysed in a 1.5 mL centrifuge tube. 200 μL of Universal DNAzol lysis buffer and 2 μL of 20 mg / mL Proteinase K were added. The mixture was incubated at 55 °C for 30 min, then heated in a 95 °C metal bath for 5 min and cooled to room temperature. The tissue material was then gently centrifuged at room temperature to precipitate the tissue material. The supernatant was the crude DNA extract.
[0044] b. Using the extracted nucleic acid solution as a template, PCR amplification was performed. The primers were specific molecular markers. The PCR reaction system was as follows: 2 μL DNA template; 12.5 μL 2x Super Pfx MasterMix (Beijing Kangwei); 2 μL each of forward and reverse primers; and sterile water to a final volume of 25 μL. The PCR reaction program was as follows: 98℃, 1 min; 98℃, 10 s; 55℃, 20 s; 72℃, 30 s; 35 cycles; 72℃, 5 min.
[0045] c. Perform 1% agarose gel electrophoresis on the above PCR products. The electrophoresis results are as follows: Figure 1As shown, there is only a single band of about 300bp. It is identified as female, which is consistent with the results.
[0046] Example 4
[0047] The specific steps for quickly identifying the genetic sex of the ichthyosaur are as follows:
[0048] a. DNA extraction solution was prepared using a rapid nucleic acid lysis method. A small amount of tail fin tissue from a known female bryorrhiza (female No. 4) was cut and lysed in a 1.5 mL centrifuge tube. 200 μL of Universal DNAzol lysis buffer and 2 μL of 20 mg / mL Proteinase K were added. The mixture was incubated at 55 °C for 30 min, then heated in a 95 °C metal bath for 5 min and cooled to room temperature. The tissue material was then gently centrifuged at room temperature to precipitate the tissue material. The supernatant was the crude DNA extract.
[0049] b. Using the extracted nucleic acid solution as a template, PCR amplification was performed. The primers were specific molecular markers. The PCR reaction system was as follows: 2 μL DNA template; 12.5 μL 2x Super Pfx MasterMix (Beijing Kangwei); 2 μL each of forward and reverse primers; and sterile water to a final volume of 25 μL. The PCR reaction program was as follows: 98℃, 1 min; 98℃, 10 s; 55℃, 20 s; 72℃, 30 s; 35 cycles; 72℃, 5 min.
[0050] c. Perform 1% agarose gel electrophoresis on the above PCR products. The electrophoresis results are as follows: Figure 1 As shown, there is only a single band of about 300bp. It is identified as female, which is consistent with the results.
[0051] Example 5
[0052] The specific steps for quickly identifying the genetic sex of the ichthyosaur are as follows:
[0053] a. DNA extraction solution was prepared using a rapid nucleic acid lysis method. A small amount of tail fin tissue was cut from a known female bryorrhizoid culter (female No. 5), and the tissue was lysed in a 1.5 mL centrifuge tube. 200 μL of Universal DNAzol lysis buffer and 2 μL of 20 mg / mL Proteinase K were added. The mixture was incubated at 55 °C for 30 min, then heated in a 95 °C metal bath for 5 min and cooled to room temperature. The tissue material was then gently centrifuged at room temperature to precipitate the tissue material. The supernatant was the crude DNA extract.
[0054] b. Using the extracted nucleic acid solution as a template, PCR amplification was performed. The primers were specific molecular markers. The PCR reaction system was as follows: 2 μL DNA template; 12.5 μL 2x Super Pfx MasterMix (Beijing Kangwei); 2 μL each of forward and reverse primers; and sterile water to a final volume of 25 μL. The PCR reaction program was as follows: 98℃, 1 min; 98℃, 10 s; 55℃, 20 s; 72℃, 30 s; 35 cycles; 72℃, 5 min.
[0055] c. Perform 1% agarose gel electrophoresis on the above PCR products. The electrophoresis results are as follows: Figure 1 As shown, there is only a single band of about 300bp. It is identified as female, which is consistent with the results.
[0056] Example 6
[0057] The specific steps for quickly identifying the genetic sex of the ichthyosaur are as follows:
[0058] a. DNA extraction solution was prepared using a rapid nucleic acid lysis method. A small amount of tail fin tissue from a known male bryorrhizoid cultivar (male No. 1) was cut and lysed in a 1.5 mL centrifuge tube. 200 μL of Universal DNAzol lysis buffer and 2 μL of Proteinase K (20 mg / mL) were added. The mixture was incubated at 55 °C for 30 min, then heated in a 95 °C metal bath for 5 min and cooled to room temperature. The tissue material was then gently centrifuged at room temperature to precipitate the tissue material. The supernatant was the crude DNA extract.
[0059] b. Using the extracted nucleic acid solution as a template, PCR amplification was performed. The primers were specific molecular markers. The PCR reaction system was as follows: 2 μL DNA template; 12.5 μL 2x Super Pfx MasterMix (Beijing Kangwei); 2 μL each of forward and reverse primers; and sterile water to a final volume of 25 μL. The PCR reaction program was as follows: 98℃, 1 min; 98℃, 10 s; 55℃, 20 s; 72℃, 30 s; 35 cycles; 72℃, 5 min.
[0060] c. Perform 1% agarose gel electrophoresis on the above PCR products. The electrophoresis results are as follows: Figure 1 As shown, bands of approximately 300 bp and 500 bp were obtained. The result indicates a male, consistent with the findings.
[0061] Example 7
[0062] The specific steps for quickly identifying the genetic sex of the ichthyosaur are as follows:
[0063] a. DNA extraction solution was prepared using a rapid nucleic acid lysis method. A small amount of tail fin tissue from a known male bryorrhizoid cultivar (male No. 2) was cut and lysed in a 1.5 mL centrifuge tube. 200 μL of Universal DNAzol lysis buffer and 2 μL of 20 mg / mL Proteinase K were added. The mixture was incubated at 55 °C for 30 min, then heated in a 95 °C metal bath for 5 min and cooled to room temperature. The tissue material was then gently centrifuged at room temperature to precipitate the tissue material. The supernatant was the crude DNA extract.
[0064] b. Using the extracted nucleic acid solution as a template, PCR amplification was performed. The primers were specific molecular markers. The PCR reaction system was as follows: 2 μL DNA template; 12.5 μL 2x Super Pfx MasterMix (Beijing Kangwei); 2 μL each of forward and reverse primers; and sterile water to a final volume of 25 μL. The PCR reaction program was as follows: 98℃, 1 min; 98℃, 10 s; 55℃, 20 s; 72℃, 30 s; 35 cycles; 72℃, 5 min.
[0065] c. Perform 1% agarose gel electrophoresis on the above PCR products. The electrophoresis results are as follows: Figure 1 As shown, bands of approximately 300 bp and 500 bp were obtained. The result indicates a male, consistent with the findings.
[0066] Example 8
[0067] The specific steps for quickly identifying the genetic sex of the ichthyosaur are as follows:
[0068] a. DNA extraction solution was prepared using a rapid nucleic acid lysis method. A small amount of tail fin tissue from a known male bryorrhizoid culter (male No. 3) was cut and lysed in a 1.5 mL centrifuge tube. 200 μL of Universal DNAzol lysis buffer and 2 μL of 20 mg / mL Proteinase K were added. The mixture was incubated at 55 °C for 30 min, then heated in a 95 °C metal bath for 5 min and cooled to room temperature. The tissue material was then gently centrifuged at room temperature to precipitate the tissue material. The supernatant was the crude DNA extract.
[0069] b. Using the extracted nucleic acid solution as a template, PCR amplification was performed. The primers were specific molecular markers. The PCR reaction system was as follows: 2 μL DNA template; 12.5 μL 2x Super Pfx MasterMix (Beijing Kangwei); 2 μL each of forward and reverse primers; and sterile water to a final volume of 25 μL. The PCR reaction program was as follows: 98℃, 1 min; 98℃, 10 s; 55℃, 20 s; 72℃, 30 s; 35 cycles; 72℃, 5 min.
[0070] c. Perform 1% agarose gel electrophoresis on the above PCR products. The electrophoresis results are as follows: Figure 1 As shown, bands of approximately 300 bp and 500 bp were obtained. The result indicates a male, consistent with the findings.
[0071] Example 9
[0072] The specific steps for quickly identifying the genetic sex of the ichthyosaur are as follows:
[0073] a. DNA extraction solution was prepared using a rapid nucleic acid lysis method. A small amount of tail fin tissue from a known male bryorrhizoid culter (male No. 4) was cut and lysed in a 1.5 mL centrifuge tube. 200 μL of Universal DNAzol lysis buffer and 2 μL of 20 mg / mL Proteinase K were added. The mixture was incubated at 55 °C for 30 min, then heated in a 95 °C metal bath for 5 min and cooled to room temperature. The tissue material was then gently centrifuged at room temperature to precipitate the tissue material. The supernatant was the crude DNA extract.
[0074] b. Using the extracted nucleic acid solution as a template, PCR amplification was performed. The primers were specific molecular markers. The PCR reaction system was as follows: 2 μL DNA template; 12.5 μL 2x Super Pfx MasterMix (Beijing Kangwei); 2 μL each of forward and reverse primers; and sterile water to a final volume of 25 μL. The PCR reaction program was as follows: 98℃, 1 min; 98℃, 10 s; 55℃, 20 s; 72℃, 30 s; 35 cycles; 72℃, 5 min.
[0075] c. Perform 1% agarose gel electrophoresis on the above PCR products. The electrophoresis results are as follows: Figure 1 As shown, bands of approximately 300 bp and 500 bp were obtained. The result indicates a male, consistent with the findings.
[0076] Example 10
[0077] The specific steps for quickly identifying the genetic sex of the ichthyosaur are as follows:
[0078] a. DNA extraction solution was prepared using a rapid nucleic acid lysis method. A small amount of tail fin tissue from a known male bryorrhizoid cultivar (male No. 5) was cut and lysed in a 1.5 mL centrifuge tube. 200 μL of Universal DNAzol lysis buffer and 2 μL of 20 mg / mL Proteinase K were added. The mixture was incubated at 55 °C for 30 min, then heated in a 95 °C metal bath for 5 min and cooled to room temperature. The tissue material was then gently centrifuged at room temperature to precipitate the tissue material. The supernatant was the crude DNA extract.
[0079] b. Using the extracted nucleic acid solution as a template, PCR amplification was performed. The primers were specific molecular markers. The PCR reaction system was as follows: 2 μL DNA template; 12.5 μL 2x Super Pfx MasterMix (Beijing Kangwei); 2 μL each of forward and reverse primers; and sterile water to a final volume of 25 μL. The PCR reaction program was as follows: 98℃, 1 min; 98℃, 10 s; 55℃, 20 s; 72℃, 30 s; 35 cycles; 72℃, 5 min.
[0080] c. Perform 1% agarose gel electrophoresis on the above PCR products. The electrophoresis results are as follows: Figure 1 As shown, bands of approximately 300 bp and 500 bp were obtained. The result indicates a male, consistent with the findings.
[0081] Electrophoresis results showed that bands of approximately 500 bp and 300 bp were amplified in all male individuals of known sex, while only a band of approximately 300 bp was amplified in all female individuals tested, failing to amplify the target band of 500 bp. The results indicate that the molecular marker obtained in this invention can accurately identify the genetic sex of the *Scleroderma glaucoma*. Agarose gel electrophoresis of the PCR amplification products showed two bands, indicating a male, while a single band indicated a female. The molecular marker provided by this invention can be used for breeding all-female or high-female-ratio *Scleroderma glaucoma*, contributing to the rapid development of this industry chain.
Claims
1. A method for identifying the genetic sex of a bryophyll fish, comprising the following steps: a. Preparation of DNA extraction solution: Tissue is disrupted in a centrifuge tube, DNA lysis buffer and Proteinase K are added, incubated, heated in a metal bath, cooled to room temperature, centrifuged, and the supernatant is the crude DNA extraction solution. b. Using the crude DNA extract as a template, perform PCR amplification to obtain PCR products; the nucleotide sequence of the upstream primer for PCR amplification is SEQ ID NO 2: TTTCAACGTCTTGTGCAAAGAGTC, and the nucleotide sequence of the downstream primer is SEQ ID NO 3: GCCATTCCTGAAAATCTGCATAAC. c. Perform agarose gel electrophoresis on the above PCR products. Determine the results: if the electrophoresis results show two bands, it is male; if there is only one band, it is female.
2. The method according to claim 1, characterized in that: In step a), the DNA lysis buffer is universal DNAzol, and the volume is 200 μL; Proteinase K has a specification of 20 mg / mL and the volume is 2 μL.
3. The method according to claim 2, characterized in that: In step a), the specific operation is as follows: a small amount of tail fin tissue is cut out, the tissue is lysed in a 1.5 mL centrifuge tube, 200 μL of universal DNAzol lysis buffer and 2 μL of 20 mg / mL Proteinase K are added, and the mixture is incubated at 55 °C for 30 min. Then, it is heated in a 95 °C metal bath for 5 min and then cooled to room temperature. The tissue material is then gently centrifuged at room temperature to precipitate, and the supernatant is the crude DNA extract.
4. The method according to claim 1, characterized in that: In step b), the PCR reaction system is as follows: 2 μL DNA template; 12.5 μL 2x Super Pfx MasterMix; 2 μL each of the upstream and downstream primers; and sterile water to a final volume of 25 μL.
5. The method according to claim 1, characterized in that: In step b), the PCR reaction program is as follows: 98℃, 1 min; 98℃, 10 s; 55℃, 20 s; 72℃, 30 s; 35 cycles; 72℃, 5 min.
6. The method according to claim 1, characterized in that: In step c), the agarose gel concentration is 1%.