The snp marker combination, primer combination and molecular identity card for identifying osmanthus fragrans varieties

Abstract

The application discloses a SNP marker combination for identifying Osmanthus fragrans varieties, a primer combination and a molecular identity card, and relates to the technical field of molecular markers. The application is based on 14 SNP markers screened out by combining high-throughput resequencing data with bioinformatics methods. The 14 SNP markers can be used for KASP typing by the primer combination, and 89 Osmanthus fragrans varieties covering four variety groups can be completely distinguished. The application of the primer combination in the establishment of the SNP molecular identity card of Osmanthus fragrans can effectively improve the detection efficiency of the purity and authenticity of the Osmanthus fragrans varieties. Meanwhile, the genotypes of the 14 sites of the Osmanthus fragrans varieties are expressed by using a barcode generator, which not only provides convenience for the quick and intelligent query of the identity of the Osmanthus fragrans varieties, but also provides a scientific basis for the evaluation of new variety approval and specificity.

Description

Technical Field

[0001] This invention relates to the field of molecular marker technology, and more specifically, to SNP marker combinations, primer combinations, and molecular identification for the identification of Osmanthus fragrans varieties. Background Technology

[0002] Osmanthus fragrans( Osmanthus fragrans Lour. belongs to the Oleaceae family and the Oleaceae genus. Osmanthus Osmanthus fragrans (also known as Osmanthus) is a woody economic tree species with both ornamental and practical value. It is also one of my country's ten traditional famous flowers, holding an important place in Chinese gardens and flower culture. In the long process of artificial introduction and domestication, Osmanthus has evolved from a wild plant to a cultivated one, expanding its application from south to north. Through the accumulation of intraspecific variation and hybridization with closely related species of the Osmanthus genus, Osmanthus has developed rich intraspecific variation and varietal resources, with approximately 160 varieties currently identified. However, existing Osmanthus germplasm resources lack phylogenetic records and suffer from serious issues of synonymy and homonymy, hindering the promotion and application of standardized cultivation techniques, the development of superior varietal characteristics, and the normal conduct of international exchange and trade. Therefore, establishing an economical, efficient, and accurate method for varietal identification is a crucial prerequisite for achieving varietal rights protection and scientific management, and is of great significance to the development of the Osmanthus industry.

[0003] In recent years, plant variety resource identification technology has evolved from morphological markers to high-throughput molecular identification techniques. DNA fingerprinting technology, with its advantages of being unaffected by the surrounding environment, speed, accuracy, and precision, is an important component of the plant variety protection technology system. Utilizing advanced biotechnology and information technologies such as the Internet of Things, establishing a variety DNA identity information database and a unified national query platform, and promoting the labeling of variety DNA identity information, can achieve rapid and intelligent querying of variety identities. Therefore, it is essential to select core primers using mainstream high-throughput typing techniques while using morphological methods to identify variety purity and authenticity, constructing molecular fingerprint maps and digital fingerprint identification cards for existing plant cultivars. This lays the foundation for further integrating the advantages of computer technology to establish an information platform for existing plant variety morphological data and fingerprint maps, enabling rapid retrieval and comparison of plant varieties. Among molecular markers, SSR and SNP markers, which exhibit co-dominance, have significant advantages in stability and effectiveness and are recommended by the International Union for the Protection of New Varieties of Plants (IUPAC) molecular testing guidelines as the preferred markers for constructing fingerprint databases. Compared to SSRs, SNP markers are third-generation molecular markers, possessing advantages such as high density, abundant sources of variation, enormous potential numbers, suitability for database integration and data sharing, and high correlation with functional genes and even plant phenotypes. Furthermore, with the emergence of various high-throughput SNP detection platforms, SNP markers are widely recognized as a highly promising molecular marker technology, and have been extensively applied in biology, agriculture, medicine, and evolutionary biology. Among them, LGC's KASP (kompetitive allele specific PCR) technology offers advantages such as higher efficiency, flexibility, accuracy, and lower cost, and has been successfully applied in variety identification and conservation work for crops such as grapes, cabbage, and maize.

[0004] However, to date, the application of SNP markers and KASP genotyping technology in the identification of Osmanthus fragrans varieties remains a blank. No research has yet screened out the fewest SNP locus combinations to distinguish more mainstream Osmanthus fragrans varieties and constructed molecular identity cards or barcodes for Osmanthus fragrans varieties to achieve efficient, accurate and economical identification.

[0005] In view of this, the present invention is proposed. Summary of the Invention

[0006] The purpose of this invention is to provide SNP marker combinations, primer combinations, and molecular identification methods for identifying Osmanthus fragrans varieties, so as to construct specific haplotypes with as few SNP marker combinations as possible, thereby achieving efficient, accurate, and economical identification of Osmanthus fragrans varieties.

[0007] This invention is implemented as follows: In a first aspect, the present invention provides a SNP marker combination for identifying Osmanthus fragrans varieties. The SNP marker combination includes 14 SNP markers, namely SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, SNP7, SNP8, SNP9, SNP10, SNP11, SNP12, SNP13, and SNP14. The SNP1 marker is located on chromosome 1 of Osmanthus fragrans, and its base at position 2570938 of the whole genome sequence of Osmanthus fragrans is either G or A; The SNP2 marker is located on chromosome 2 of Osmanthus fragrans, and its base at position 27947738 of the whole genome sequence of Osmanthus fragrans is C or T; The SNP3 marker is located on chromosome 3 of Osmanthus fragrans, and its base at position 24737420 of the whole genome sequence of Osmanthus fragrans is either G or A; The SNP4 marker is located on chromosome 6 of Osmanthus fragrans, and its base at position 3953530 of the whole genome sequence of Osmanthus fragrans is either G or A; The SNP5 marker is located on chromosome 7 of Osmanthus fragrans, and its base at position 4581291 of the whole genome sequence of Osmanthus fragrans is either C or G; The SNP6 marker is located on chromosome 9 of Osmanthus fragrans, and its base at position 11920715 of the whole genome sequence of Osmanthus fragrans is either G or A; The SNP7 marker is located on chromosome 11 of Osmanthus fragrans, and its base at position 7705120 of the whole genome sequence of Osmanthus fragrans is C or T; The SNP8 marker is located on chromosome 13 of Osmanthus fragrans, and its base at position 24914140 of the whole genome sequence of Osmanthus fragrans is either A or C; The SNP9 marker is located on chromosome 14 of Osmanthus fragrans, and its base at position 1455309 of the whole genome sequence of Osmanthus fragrans is C or T; The SNP10 marker is located on chromosome 15 of Osmanthus fragrans, and its base at position 27882455 of the whole genome sequence of Osmanthus fragrans is either T or A; The SNP11 marker is located on chromosome 18 of Osmanthus fragrans, and its base at position 26280736 of the whole genome sequence of Osmanthus fragrans is either G or T. The SNP12 marker is located on chromosome 23 of Osmanthus fragrans, and its base at position 10404919 of the whole genome sequence of Osmanthus fragrans is either A or C; The SNP13 marker is located on chromosome 23 of Osmanthus fragrans, and its base at position 17820664 of the whole genome sequence of Osmanthus fragrans is either C or T. The SNP14 marker is located on chromosome 23 of Osmanthus fragrans, and its base at position 20338374 of the whole genome sequence of Osmanthus fragrans is either T or G; The physical location of the SNP was determined based on the whole genome sequence of Osmanthus fragrans 'Rixiang Gui' (GenBank No. PRJNA529305).

[0008] The above-mentioned SNP marker combination was designed by the inventor based on 14 core SNP markers of Osmanthus fragrans selected by bioinformatics methods combined with scientific algorithms such as mathematical statistics. Using this set of marker primers for KASP typing, the typing results are stable and accurate, with high identification efficiency, and can completely distinguish 89 Osmanthus fragrans varieties covering four cultivar groups.

[0009] In one alternative implementation, the osmanthus varieties include at least two of the following groups: the Four Seasons Osmanthus group, the Golden Osmanthus group, the Silver Osmanthus group, and the Red Osmanthus group. For example, it includes the Four Seasons Osmanthus group, the Golden Osmanthus group, and the Silver Osmanthus group.

[0010] In one alternative implementation, the Osmanthus fragrans cultivar group includes 9 varieties, the Osmanthus fragrans cultivar group includes 29 varieties, the Osmanthus fragrans cultivar group includes 28 varieties, and the Osmanthus fragrans cultivar group includes 23 varieties.

[0011] The Osmanthus fragrans cultivar group includes: Orange-yellow Osmanthus fragrans, Light Makeup, Ink Treasure Fragrance, Sun-fragrant Osmanthus fragrans ... Osmanthus fragrans (tooth-leaf Osmanthus fragrans), Heavenly Maiden Scattering Flowers, Heavenly Fragrance Pavilion and Round-leaf Osmanthus fragrans; The Osmanthus fragrans cultivar group includes: Braided Osmanthus fragrans, Long-petaled Osmanthus fragrans, Long-stemmed Osmanthus fragrans, Smile in the Cluster, Large-flowered Osmanthus fragrans, Large-leaved Yellow, Large-leaved Osmanthus fragrans, Hibiscus Osmanthus, Hangzhou Yellow, Black Pearl, Osmanthus fragrans by the River, Golden Ball Osmanthus, Early Autumn Osmanthus, Golden Lion Osmanthus, Sickle-leaved Osmanthus fragrans, Willow-leaved Yellow, Willow-leaved Osmanthus fragrans, Willow-leaved Su Osmanthus, Lige Osmanthus fragrans, Ball Osmanthus, Soft-leaved Osmanthus fragrans, Camellia Osmanthus fragrans, Fast-growing Osmanthus fragrans, Small-flowered Osmanthus fragrans, Xiangjin, Small-leaved Osmanthus fragrans, Round-petaled Osmanthus fragrans, Columnar Osmanthus fragrans, and Early Autumn Red; The Osmanthus fragrans cultivar group includes: Bai Jie, Bo Ye Yin Gui, Chai Gui, Chang Ye Bi Zhu, Chuan Yin Qiu, Chang Ye Yin Gui, Da Ye Yin Gui, Kuan Ye Zi Yin, Lü Geng Zi Yin, Liu Ye Gui, Mi Jie Yin Gui, Qing Jian, Su Sheng Yin Gui, Wan Yin Gui, Wei Ye Yin Gui, Xiu Li Yin Gui, Xiang Yun, Xiao Ye Su Gui, Yu Lian Bi Zhu, Yu Ling Long, Yu Lian Yin Si, Yang Mei Ye Yin Gui, Yin Xing, Yin Zhan Bi Zhu, Yu Zhu, Zhong Hua Long Gui, Zi Yin Gui, and Zao Yin Gui; The Osmanthus fragrans cultivar group includes: Toothed Osmanthus fragrans, Orange-Red Osmanthus fragrans, Orange-Fragrant Osmanthus fragrans, E'cheng, Red Osmanthus fragrans, Fire-Refined Golden Elixir, Delicate Beauty, Lotus Seed Osmanthus fragrans, Full Striped Red, Flat Veined Osmanthus fragrans, Soft Leaf Osmanthus fragrans, Shanghai Osmanthus fragrans, Peach Leaf Osmanthus fragrans, Evening Glow, Wuyi Osmanthus fragrans, Realgar Osmanthus fragrans, Elephant Mountain Osmanthus fragrans, Small Leaf Osmanthus fragrans, Yanhong Osmanthus fragrans, Hard Leaf Osmanthus fragrans, Drunken Skin Red, Cinnabar Osmanthus fragrans, and Zhuangyuan Red.

[0012] Secondly, this invention also provides primer combinations for detecting the SNP marker combinations used in the identification of the above-mentioned Osmanthus fragrans varieties. The 14 SNP marker combinations, SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, SNP7, SNP8, SNP9, SNP10, SNP11, SNP12, SNP13, and SNP14, were sequentially amplified using the following primers: SEQ ID NO: 1–3, SEQ ID NO: 4–6, SEQ ID NO: 7–9, SEQ ID NO: 10–12, SEQ ID NO: 13–15, SEQ ID NO: 16–18, SEQ ID NO: 19–21, SEQ ID NO: 22–24, SEQ ID NO: 25–27, SEQ ID NO: 28–30, SEQ ID NO: 31–33, SEQ ID NO: 34–36, SEQ ID NO: 37–39, SEQ ID NO: 40–42.

[0013] Each primer combination for detecting SNP markers includes two forward PCR primers and one reverse PCR primer. These three primers, combined with fluorescent PCR, are used to confirm the possible genotype of the SNP locus, thereby identifying the variety.

[0014] In one alternative implementation, the primer combination is the KASP primer combination.

[0015] Thirdly, the present invention also provides a kit comprising the primer combination described above; In one alternative implementation, the kit also includes a PCR buffer.

[0016] In an alternative embodiment, the kit further includes a probe labeled with a fluorescent group at the 5' end and a quenching group labeled at the 3' end.

[0017] Fourthly, the present invention also provides a method for constructing a molecular identity card for Osmanthus fragrans varieties, comprising the following steps: S1. Resequencing technology was used to sequence the genomic DNA of the target Osmanthus variety and screen out the core SNP sites. S2. Based on the screened core SNP sites, design and synthesize KASP primer combinations, perform PCR amplification using the designed KASP primer combinations, and detect the PCR amplification products. S3. Based on the test results, core KASP markers are selected, and R language scripts are used to filter out SNP marker combinations that can identify all varieties. Then, molecular identity cards for Osmanthus varieties are constructed based on the selected SNP marker combinations.

[0018] In a preferred embodiment of the present invention, the above-mentioned target osmanthus varieties include at least two of the following variety groups: four-season osmanthus variety group, golden osmanthus variety group, silver osmanthus variety group, and red osmanthus variety group. In one optional implementation, the Osmanthus fragrans cultivar group includes 9 varieties, the Osmanthus fragrans cultivar group includes 29 varieties, the Osmanthus fragrans cultivar group includes 28 varieties, and the Osmanthus fragrans cultivar group includes 23 varieties. The Osmanthus fragrans cultivar group includes: Orange-yellow Osmanthus fragrans, Light Makeup, Ink Treasure Fragrance, Sun-fragrant Osmanthus fragrans ... Osmanthus fragrans (tooth-leaf Osmanthus fragrans), Heavenly Maiden Scattering Flowers, Heavenly Fragrance Pavilion and Round-leaf Osmanthus fragrans; The Osmanthus fragrans cultivar group includes: Braided Osmanthus fragrans, Long-petaled Osmanthus fragrans, Long-stemmed Osmanthus fragrans, Smile in the Cluster, Large-flowered Osmanthus fragrans, Large-leaved Yellow, Large-leaved Osmanthus fragrans, Hibiscus Osmanthus, Hangzhou Yellow, Black Pearl, Osmanthus fragrans by the River, Golden Ball Osmanthus, Early Autumn Osmanthus, Golden Lion Osmanthus, Sickle-leaved Osmanthus fragrans, Willow-leaved Yellow, Willow-leaved Osmanthus fragrans, Willow-leaved Su Osmanthus, Lige Osmanthus fragrans, Ball Osmanthus, Soft-leaved Osmanthus fragrans, Camellia Osmanthus fragrans, Fast-growing Osmanthus fragrans, Small-flowered Osmanthus fragrans, Xiangjin, Small-leaved Osmanthus fragrans, Round-petaled Osmanthus fragrans, Columnar Osmanthus fragrans, and Early Autumn Red; The Osmanthus fragrans cultivar group includes: Bai Jie, Bo Ye Yin Gui, Chai Gui, Chang Ye Bi Zhu, Chuan Yin Qiu, Chang Ye Yin Gui, Da Ye Yin Gui, Kuan Ye Zi Yin, Lü Geng Zi Yin, Liu Ye Gui, Mi Jie Yin Gui, Qing Jian, Su Sheng Yin Gui, Wan Yin Gui, Wei Ye Yin Gui, Xiu Li Yin Gui, Xiang Yun, Xiao Ye Su Gui, Yu Lian Bi Zhu, Yu Ling Long, Yu Lian Yin Si, Yang Mei Ye Yin Gui, Yin Xing, Yin Zhan Bi Zhu, Yu Zhu, Zhong Hua Long Gui, Zi Yin Gui, and Zao Yin Gui; The Osmanthus fragrans cultivar group includes: Toothed Osmanthus fragrans, Orange-Red Osmanthus fragrans, Orange-Fragrant Osmanthus fragrans, E'cheng, Red Osmanthus fragrans, Fire-Refined Golden Elixir, Delicate Beauty, Lotus Seed Osmanthus fragrans, Full Striped Red, Flat Veined Osmanthus fragrans, Soft Leaf Osmanthus fragrans, Shanghai Osmanthus fragrans, Peach Leaf Osmanthus fragrans, Evening Glow, Wuyi Osmanthus fragrans, Realgar Osmanthus fragrans, Elephant Mountain Osmanthus fragrans, Small Leaf Osmanthus fragrans, Yanhong Osmanthus fragrans, Hard Leaf Osmanthus fragrans, Drunken Skin Red, Cinnabar Osmanthus fragrans, and Zhuangyuan Red.

[0019] In a preferred embodiment of the present invention, step S1 includes: Resequencing technology was used to sequence the target Osmanthus variety to obtain whole-genome SNP variant sites; the obtained whole-genome SNP sites were subjected to four specific screenings to obtain core SNP sites.

[0020] In a preferred embodiment of the present invention, the above-mentioned four specific screenings include: (1) Screening out SNP loci with no genotype deletion and minor allele frequency MAF>0.05 in 89 Osmanthus varieties to complete the first screening; (2) Remove SNP sites with other variations within 50 bp before and after the SNP site to complete the second screening; (3) Select SNP sites with a polymorphism information content (PIC) between 0.2 and 0.5 to complete the third screening; (4) Only SNP sites located in the exon region of the gene and evenly distributed on the chromosome are retained to complete the fourth screening.

[0021] In a preferred embodiment of the present invention, the reaction conditions for PCR amplification in step S2 above include: pre-denaturation at 95°C for 10 min; gradient cooling amplification at 95°C for 15 s, 55°C–61°C for 60 s, for 10 cycles (each cycle decreasing by 0.6°C); and normal amplification at 95°C for 15 s, 55°C for 60 s, for 30–32 cycles. In one alternative implementation, step S3 includes: Based on the typing results, markers that are accurately typed and evenly distributed on chromosomes are selected as core markers; Then, using R scripts, based on the genotype data of 89 Osmanthus varieties sequenced with 87 core SNPs, the SNP identification combinations that can identify all tested Osmanthus varieties were first "screened". Then, based on the "screening", the SNPs in the SNP identification combinations were "reduced" to achieve the purpose of "removing redundancy". Finally, the marker combination with the minimum number of SNPs that can identify all tested Osmanthus varieties was selected.

[0022] Furthermore, this invention also provides a method for constructing fingerprint profiles of Osmanthus fragrans varieties, comprising the following steps: S1. Resequencing technology was used to sequence the genomic DNA of the target Osmanthus variety and screen out the core SNP sites. S2. Based on the screened core SNP sites, design and synthesize KASP primer combinations, perform PCR amplification using the designed KASP primer combinations, and detect the PCR amplification products. S3. Based on the test results, core KASP markers are selected, and R language scripts are used to filter out SNP marker combinations that can identify all varieties.

[0023] Fifthly, this invention also provides a molecular identity card for Osmanthus fragrans varieties, which is constructed using the aforementioned method for constructing molecular identity cards for Osmanthus fragrans varieties. Using this set of SNP marker combinations to construct molecular identity cards for Osmanthus fragrans varieties can effectively improve the detection efficiency of Osmanthus fragrans variety purity and authenticity. Simultaneously, a barcode generator is used to barcode the genotypes of Osmanthus fragrans varieties at 14 loci, providing convenience for rapid and intelligent querying of Osmanthus fragrans variety identities, and also providing a scientific basis for new variety approval and specificity evaluation.

[0024] In one optional implementation, the molecular identity card of the osmanthus variety includes a molecular fingerprint code representing the variety in the form of a one-dimensional barcode and a two-dimensional barcode. In one optional implementation, the molecular identity card of the osmanthus variety also includes a variety commodity information code; the variety commodity information code includes data on variety group category, place of origin and morphological characteristics.

[0025] Sixthly, the present invention also provides a method for identifying Osmanthus varieties, comprising the following steps: The genotypes of the DNA of the Osmanthus fragrans to be tested were determined at 14 SNP loci in the above-mentioned SNP marker combination for Osmanthus fragrans variety identification, and compared with the genotypes of all Osmanthus fragrans varieties in the above-mentioned molecular identity card. If the molecular fingerprint of the sample to be tested is completely consistent with the molecular fingerprint of any Osmanthus variety in the molecular ID card of Osmanthus, then the comparison is continued through morphological characteristics such as plant shape, lenticels, flower color, flower fragrance, and fruit; if they are consistent, then the Osmanthus variety to be tested is or is a candidate for that Osmanthus variety. If the molecular fingerprint comparison results of the two are inconsistent, then the morphological characteristics are compared with varieties with similar genotypes. If there are differences, the Osmanthus to be tested is determined to be a new variety. In one alternative implementation, the new variety is added to the molecular fingerprint.

[0026] In a seventh aspect, the present invention also provides the application of SNP marker combinations, primer combinations, or molecular identification methods for osmanthus variety identification in molecular-assisted breeding of osmanthus.

[0027] The present invention has the following beneficial effects: This invention discloses a SNP marker combination for identifying Osmanthus fragrans varieties. This marker combination was designed based on 14 core SNP markers selected from Osmanthus fragrans using bioinformatics methods combined with mathematical statistics and other scientific algorithms. KASP genotyping was performed using this marker-primer combination, resulting in stable and accurate genotyping results with high identification efficiency, capable of completely distinguishing 89 Osmanthus fragrans varieties covering four varietal groups. Constructing a molecular identity card for Osmanthus fragrans varieties using this SNP marker combination can effectively improve the detection efficiency of Osmanthus fragrans variety purity and authenticity. Simultaneously, a barcode generator was used to barcode the genotypes of Osmanthus fragrans varieties at the 14 loci, providing convenience for rapid and intelligent querying of Osmanthus fragrans variety identities and offering a scientific basis for new variety approval and specificity evaluation. Attached Figure Description

[0028] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0029] Figure 1This is a detection map for KASP genotyping using primers corresponding to SNP 7. Figure 2 This is a detection map for KASP genotyping using primers corresponding to SNP 9. Figure 3 The identification efficiency for 14 SNP sites. Detailed Implementation

[0030] Reference will now be made to detailed embodiments of the present invention, one or more of which are described below. Each example is provided for explanation and not for limitation of the invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made to the invention without departing from its scope or spirit. For example, features described or illustrated as part of one embodiment may be used in another embodiment to produce further embodiments.

[0031] Unless otherwise specified, the practice of this invention will employ conventional techniques of cell biology, molecular biology (including recombinant technologies), microbiology, biochemistry, and immunology, which are within the capabilities of those skilled in the art. This technique is well explained in the literature, such as *Molecular Cloning: A Laboratory Manual*, 2nd edition (Sambrook et al., 1989); *Oligonucleotide Synthesis* (edited by M.J. Gait, 1984); *Animal Cell Culture* (edited by R.R. Freshney, 1987); *Methods in Enzymology* (Academic Press, Inc.); *Handbook of Experimental Immunology* (edited by D.M. Weir and C.C. Blackwell); *Gene Transfer Vectors for Mammalian Cells* (edited by J.M. Miller and M.P. Calos, 1987); *Current Protocols in Molecular Biology* (edited by F.M. Mausubel et al., 1987); and *PCR: The Polymerase Chain Reaction*. The references cited in the references are: "Reaction" (Mullis et al., ed., 1994); and "Current Protocols in Immunology" (JEColigan et al., ed., 1991), each of which is explicitly incorporated herein by reference.

[0032] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0033] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0034] Example 1 This embodiment provides a combination of SNP sites for constructing molecular identity cards for Osmanthus fragrans, and primers for obtaining Osmanthus-specific SNP markers at the corresponding sites. The SNP sites SNP1 to SNP14 are shown in Table 1: Table 1. Genomic location information of SNP1 to SNP14

[0035] The primer combination sequences are SEQ ID NO:1 to SEQ ID NO:42, and their marker names and sequence composition are shown in Table 2. Table 2. KASP primer information for 14 SNP sites SEQ ID NO:1 to SEQ ID NO:42

[0036] Example 2 This embodiment provides an Osmanthus SNP fingerprint library containing the KASP primer combinations used for constructing Osmanthus molecular identity cards as described in Embodiment 1, and the method for constructing this fingerprint library includes the following steps: S1, Extract genomic DNA from all experimental varieties; in this example, there are a total of 89 varieties. S2, high-throughput resequencing was performed on the 89 samples to obtain 10,320,901 whole-genome SNP markers. At the same time, software such as GATK, Vcftools, and Plink were used to filter and screen out high-quality SNP sites. S3. Based on the selected high-quality SNP sites, KASP primer combinations were designed and synthesized. PCR amplification was performed using the designed KASP primer combinations, and the PCR amplification products were detected. S4. Based on the typing results, markers that are accurately typed and evenly distributed on chromosomes are selected as core markers. R language scripts are used to screen out SNP marker combinations that can identify all varieties. This embodiment uses 89 representative Osmanthus varieties as experimental subjects, specifically 9 varieties of Osmanthus fragrans in four seasons, 29 varieties of Osmanthus fragrans in golden form, 28 varieties of Osmanthus fragrans in silver form, and 23 varieties of Osmanthus fragrans in red form (see Table 3, these 89 Osmanthus varieties are from the National Osmanthus Germplasm Resource Bank in Yuhang District, Hangzhou City, Zhejiang Province).

[0037] Table 389 Osmanthus Varieties Information

[0038] In step S1, DNA was extracted from Osmanthus fragrans leaves using the CTAB method. The concentration and purity of the DNA were detected using a NanoDrop 1000 spectrophotometer (Themo) (OD 260 / 280 = 1.7–2.1). The concentration was diluted to 100 ng·μL-1 with ultrapure water and loaded into 96-well PCR plates according to their numbers for high-throughput amplification and detection.

[0039] In step S2, whole-genome resequencing technology was used to sequence all experimental Osmanthus varieties (the average sequencing depth of each sample was 8.09×). The sequencing results were compared with the 'Rixianggui' genome draft (GenBank No. PRJNA529305), yielding 10,320,901 SNP loci. Based on these 10,320,901 SNPs, the following four specificity screenings were performed sequentially: (1) SNP loci with no genotype deletion and minor allele frequency MAF>0.05 were screened out in 89 Osmanthus varieties. 9,202,331 SNPs were screened out, and the first screening was completed. (2) Remove SNP sites with other variations within 50 bp before and after the SNP site, leaving 929,606 SNPs, and complete the second screening; (3) SNP sites with polymorphism information content (PIC) between 0.2 and 0.5 were selected, and 467,736 SNPs were selected to complete the third screening; (4) Only SNP sites located in the exon regions of genes and evenly distributed on chromosomes were retained to complete the fourth screening, and a total of 533 high-quality SNP sites were screened out.

[0040] To verify the accuracy and stability of the high-quality SNP markers mentioned above, KASP technology was used to perform genotyping verification on 89 Osmanthus varieties.

[0041] In step S3, by comparing the genome of the Osmanthus cultivar 'Rixianggui', 533 high-quality SNP loci with 100 bp flanking sequences before and after them were obtained. KASP primers were designed and synthesized, and KASP primers were successfully designed for 521 loci, which can be used for KASP genotyping. During primer synthesis, the 5' end of all forward primers 1 was augmented with the GAAGGTGACCAAGTTCATGCT adapter sequence; the 5' end of forward primer 2 was augmented with the GAAGGTCGGAGTCAACGGATT adapter sequence. Forward primers 1, 2, and the reverse primers carried different fluorescent groups: FAM, HEX, and REV, respectively.

[0042] When performing real-time quantitative PCR amplification, the reaction system should be prepared according to the table below (as shown in Table 4), and then placed in the ABI QuantStudio 5 real-time PCR instrument for amplification and data analysis. The PCR reaction conditions used are shown in Table 5.

[0043] Table 4. KASP Genotyping PCR Reaction System

[0044] Table 5. Reaction conditions for real-time quantitative PCR

[0045] The specific process for reading the fluorescence results of PCR amplification products is as follows: When the temperature of the PCR amplification product drops below 30℃, the fluorescence value is read by scanning with FAM and HEX beams of an enzyme-linked immunosorbent assay (ELISA) reader (the FAM fluorescent tag sequence is read at an excitation wavelength of 485nm and an emission wavelength of 520nm, and the HEX fluorescent tag sequence is read at an excitation wavelength of 528nm and an emission wavelength of 560nm). The genotype of 89 Osmanthus varieties based on each SNP locus is determined according to the fluorescence signal color.

[0046] The specific genotype determination principles are as follows: the genotypes of samples aggregated on the X-axis and displayed in red are alleles linked to the FAM fluorescent tag sequence; the genotypes of samples aggregated near the Y-axis and displayed in blue are alleles linked to the HEX fluorescent tag sequence; the genotypes of samples displayed in green in the middle are heterozygous for both alleles; and the samples displayed in black are negative controls.

[0047] Based on the above criteria, SNPs that are accurately genotyped and evenly distributed on chromosomes were selected as core markers from the genotyping results. Finally, 87 core SNP sites were screened out from 521 SNP sites.

[0048] Further, an R script was used to screen for the identification combination with the minimum number of SNPs required to identify all tested Osmanthus varieties, based on the genotyping results of 87 core SNPs in 89 Osmanthus cultivars. This meant a marker combination using only 14 coding region SNPs that could completely distinguish all tested Osmanthus cultivars. The analysis results for each SNP locus for each Osmanthus cultivar are shown in Table 6, with the genotyping results for SNP7 and SNP9 loci as shown below. Figure 1 , Figure 2 As shown.

[0049] Table 6. Genotyping of 14 SNP loci in the genomes of 89 Osmanthus varieties

[0050] Eighty-nine Osmanthus varieties were identified using SNPs 1–SNP 14. The minor allele frequencies of the 14 SNPs ranged from 0.174 to 0.489, with a mean of 0.352; the polymorphism information content (PIC) ranged from 0.246 to 0.375, with a mean of 0.335; and the expected heterozygosity (HE) index ranged from 0.288 to 0.500, with a mean of 0.431. Among the 14 SNP markers, there were 4 non-synonymous mutations, 10 synonymous mutations, 6 SNP transversions, and 8 SNP transitions. (See Table 7.) Table 7. Information on 14 SNP markers in the fingerprint spectrum

[0051] Example 3 This embodiment provides a method for constructing an "identity card" for Osmanthus fragrans varieties. Based on the Osmanthus fingerprint spectrum in Embodiment 2, this method uses 35 digits to form the Osmanthus fragrans variety identity card. The first 1-7 digits are the variety's commercial information code, including the variety group category, origin, and stable morphological characteristics. The last 8-35 digits are the variety's molecular fingerprint code, representing the variety's unique molecular information. This is ultimately represented in the form of a one-dimensional barcode and a two-dimensional barcode, providing an effective way for the simplified management and protection of variety resources. The method includes the following steps: 1) Construction of Osmanthus Variety Commodity Code The commodity code of Osmanthus varieties represents the basic commodity information of the variety. The following three parts are selected for coding: (1) Variety group code. It is represented by a single digit, namely, golden Osmanthus is 1, silver Osmanthus is 2, red Osmanthus is 3, and four-season Osmanthus is 4. (2) Regional code. It is used to indicate the origin of Osmanthus varieties. It is composed of the standard codes of various provinces in my country, namely, Henan is 41, Hubei is 37, Zhejiang is 33, etc. The origin of the variety is not clear, and it is represented by 00. (3) Morphological characteristic code. Four stable morphological characteristic data are selected: flower color, fragrance, flower quantity and fruit set. “1, 2, 3” represents the three types of Osmanthus flower color: “white, yellow and red”. “0, 1, 2, 3” represents the four types of Osmanthus fragrance: “no fragrance, slightly fragrant, medium fragrance and strong fragrance”. “1, 2, 3” represents the three types of Osmanthus flower quantity: “sparse, medium and dense”. “0, 1” represents the two types of Osmanthus that do not set fruit and set fruit. For example, the product code for the Osmanthus variety "Zhuangyuanhong" is "3333220". The first "3" indicates the Osmanthus cultivar group; the second and third "33" are the regional code, indicating that the variety originated in Zhejiang Province; the fourth "3" indicates the flower color is red; the fifth "2" indicates a moderate fragrance; the sixth "2" indicates a moderate number of flowers; and the seventh "0" indicates that it does not produce fruit.

[0052] 2) SNP fingerprint construction To construct an identification system, the SNP data of Osmanthus varieties were digitally encoded. Among the 14 SNP markers, there are 10 genotypes: AA, GG, CC, TT, CA, GT, AG, CT, GC, and TA. The bases A, G, C, and T are encoded using numbers 1–4. For example, the 14 SNP marker genotypes of "Zhuangyuanhong" are GA, CT, GA, AA, CC, GG, CT, AA, CC, TA, TT, CC, CT, and GG. This is converted into a 28-bit fingerprint code: 2134211133223411334144333422. Here, "2134" in positions 1–4 indicates that the genotypes of the first two SNP sites, SNP1 and SNP2, are GA and CT, respectively. "2111" in positions 5–8 indicates that the genotypes of the 3rd and 4th SNP sites are GA and AA, respectively. The remaining 20 positions are encoded similarly.

[0053] 3) Construction of Osmanthus Variety Identification The osmanthus variety ID card consists of the aforementioned product code and fingerprint code, totaling 35 digits. Taking the "Zhuangyuanhong" variety ID card as an example, the ID number is 33332202134211133223411334144333422, which is the product code "3333220" and the variety SNP fingerprint code is 2134211133223411334144333422. Following this method, the product information and SNP data of 89 osmanthus varieties were digitized, resulting in 89 osmanthus variety ID cards (Table 8). Using an online barcode generator (https: / / www.hlcode.cn / batch), the QR codes were converted, completing the construction of the 89 osmanthus variety ID cards in Example 2. As shown in Table 8, the 14 SNP loci disclosed in this invention can be used to construct and identify osmanthus variety ID cards, distinguishing different osmanthus varieties.

[0054] Table 8. 89 Osmanthus Variety ID Cards

[0055] Example 4 This embodiment uses the osmanthus variety identification card to detect whether the osmanthus variety to be tested is "Zhuangyuanhong".

[0056] Based on the above 14 Osmanthus molecular markers, the SNP fingerprint of the Osmanthus variety "Zhuangyuanhong" was constructed as: GACTGAAACCGGCTAACCTATTCCCTGG.

[0057] Osmanthus varieties were randomly selected for testing, and DNA preparation was performed according to the steps in Example 2. Simultaneously, genotyping was performed using a 14-core SNP marker set to obtain SNP fingerprints. The SNP genotyping steps using the PCR platform were the same as described in Example 2.

[0058] Results Analysis: The SNP fingerprint profile of the tested Osmanthus variety was compared with that of the authentic Osmanthus variety "Zhuangyuanhong". If they were identical, further comparisons were made based on morphological characteristics such as plant shape, lenticels, flower color, fragrance, and fruit. If they matched, the tested Osmanthus variety was identified as "Zhuangyuanhong". If the SNP fingerprint profiles were inconsistent, morphological comparisons were made with varieties with similar genotypes. If differences were found, the tested Osmanthus variety was identified as a novel variety not covered in this invention, and its addition to the fingerprint database could be considered.

[0059] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A primer set for detecting SNP marker combinations for osmanthus variety identification, characterized in that, The SNP marker combination for the identification of Osmanthus fragrans varieties consists of 14 SNP markers. These 14 SNP markers, SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, SNP7, SNP8, SNP9, SNP10, SNP11, SNP12, SNP13, and SNP14, were obtained sequentially using the following primers: SEQ ID NO: 1–3, SEQ ID NO: 4–6, SEQ ID NO: 7–9, SEQ ID NO: 10–12, SEQ ID NO: 13–15, SEQ ID NO: 16–18, SEQ ID NO: 19–21, SEQ ID NO: 22–24, SEQ ID NO: 25–27, SEQ ID NO: 28–30, SEQ ID NO: 31–33, SEQ ID NO: 34–36, SEQ ID NO: 37–39, SEQ ID NO: 40–42; The SNP1 marker is located on chromosome 1 of Osmanthus fragrans, and its base at position 2570938 of the whole genome sequence of Osmanthus fragrans is either G or A; The SNP2 marker is located on chromosome 2 of Osmanthus fragrans, and its base at position 27947738 of the whole genome sequence of Osmanthus fragrans is C or T; The SNP3 marker is located on chromosome 3 of Osmanthus fragrans, and its base at position 24737420 of the whole genome sequence of Osmanthus fragrans is either G or A; The SNP4 marker is located on chromosome 6 of Osmanthus fragrans, and its base at position 3953530 of the whole genome sequence of Osmanthus fragrans is either G or A; The SNP5 marker is located on chromosome 7 of Osmanthus fragrans, and its base at position 4581291 of the whole genome sequence of Osmanthus fragrans is either C or G; The SNP6 marker is located on chromosome 9 of Osmanthus fragrans, and its base at position 11920715 of the whole genome sequence of Osmanthus fragrans is either G or A; The SNP7 marker is located on chromosome 11 of Osmanthus fragrans, and its base at position 7705120 of the whole genome sequence of Osmanthus fragrans is C or T; The SNP8 marker is located on chromosome 13 of Osmanthus fragrans, and its base at position 24914140 of the whole genome sequence of Osmanthus fragrans is either A or C; The SNP9 marker is located on chromosome 14 of Osmanthus fragrans, and its base at position 1455309 of the whole genome sequence of Osmanthus fragrans is C or T; The SNP10 marker is located on chromosome 15 of Osmanthus fragrans, and its base at position 27882455 of the whole genome sequence of Osmanthus fragrans is either T or A; The SNP11 marker is located on chromosome 18 of Osmanthus fragrans, and its base at position 26280736 of the whole genome sequence of Osmanthus fragrans is either G or T. The SNP12 marker is located on chromosome 23 of Osmanthus fragrans, and its base at position 10404919 of the whole genome sequence of Osmanthus fragrans is either A or C; The SNP13 marker is located on chromosome 23 of Osmanthus fragrans, and its base at position 17820664 of the whole genome sequence of Osmanthus fragrans is either C or T. The SNP14 marker is located on chromosome 23 of Osmanthus fragrans, and its base at position 20338374 of the whole genome sequence of Osmanthus fragrans is either T or G; The physical location of the SNP was determined based on the whole genome sequence of Osmanthus fragrans 'Rixianggui' (GenBank No. PRJNA529305).

2. The primer combination according to claim 1, characterized in that, The primer combination is the KASP primer combination.

3. A reagent kit, characterized in that, It includes the primer combination as described in claim 1 or 2.

4. The reagent kit according to claim 3, characterized in that, The kit also includes PCR Buffer.

5. A method for identifying Osmanthus fragrans varieties, characterized in that, Includes the following steps: The genotype of the DNA of the Osmanthus fragrans to be tested is determined in the SNP marker combination of 14 SNP loci in the Osmanthus fragrans variety identification described in claim 1, and compared with the genotypes of all Osmanthus fragrans varieties in the molecular identity card of Osmanthus fragrans varieties; if the molecular fingerprint code of the sample to be tested is completely consistent with the molecular fingerprint code of any Osmanthus fragrans variety in the molecular identity card of Osmanthus fragrans, then the comparison is continued through morphological characteristics such as plant shape, lenticels, flower color, flower fragrance, and fruit; if they are consistent, then the Osmanthus fragrans to be tested is or is a candidate for that Osmanthus fragrans variety; If the molecular fingerprint comparison results of the two are inconsistent, then the morphological characteristics are compared with varieties with similar genotypes. If there are differences, the Osmanthus to be tested is determined to be a new variety. The molecular identity card for the Osmanthus variety is constructed by combining SNP markers for Osmanthus variety identification as described in claim 1.

6. The method for identifying Osmanthus varieties according to claim 5, characterized in that, The varieties of osmanthus mentioned include at least two of the following variety groups: Four Seasons Osmanthus, Golden Osmanthus, Silver Osmanthus, and Red Osmanthus.

7. The method for identifying Osmanthus varieties according to claim 6, characterized in that, The four-season osmanthus variety group includes 9 varieties, the golden osmanthus variety group includes 29 varieties, the silver osmanthus variety group includes 28 varieties, and the red osmanthus variety group includes 23 varieties. The four-season osmanthus cultivar group includes: orange-yellow four-season osmanthus, light makeup, ink treasure fragrance, fragrant osmanthus yellow, fragrant osmanthus, four-season osmanthus, heavenly maiden scattering flowers, heavenly fragrance pavilion and round-leaf four-season osmanthus; The Osmanthus fragrans cultivar group includes: Osmanthus fragrans var. brevicornu, Osmanthus fragrans var. longpetalus, Osmanthus fragrans var. longpetalus, Osmanthus fragrans var. spp. ... The group of silver osmanthus varieties includes: Bai Jie, Bo Ye Yin Gui, Chai Gui, Chang Ye Bi Zhu, Chuan Yin Qiu, Chang Ye Yin Gui, Da Ye Yin Gui, Kuan Ye Zi Yin, Lü Geng Zi Yin, Liu Ye Gui, Mi Jie Yin Gui, Qing Jian, Su Sheng Yin Gui, Wan Yin Gui, Wei Ye Yin Gui, Xiu Li Yin Gui, Xiang Yun, Xiao Ye Su Gui, Yu Lian Bi Zhu, Yu Ling Long, Yu Lian Yin Si, Yang Mei Ye Yin Gui, Yin Xing, Yin Zhan Bi Zhu, Yu Zhu, Zhong Hua Long Gui, Zi Yin Gui, and Zao Yin Gui; The Osmanthus fragrans cultivar group includes: Tooth Osmanthus, Orange-Red Osmanthus, Orange-Fragrant Osmanthus, E'cheng, Red Osmanthus, Fire-Refined Golden Elixir, Delicate Beauty, Lotus Seed Osmanthus, Full Strip Red, Flat Vein Osmanthus, Soft Leaf Osmanthus, Shanghai Osmanthus, Peach Leaf Osmanthus, Evening Glow, Wuyi Osmanthus, Realgar Osmanthus, Elephant Mountain Osmanthus, Small Leaf Osmanthus, Yanhong Osmanthus, Hard Leaf Osmanthus, Drunken Skin Red, Cinnabar Osmanthus, and Zhuangyuan Red.

8. The method for identifying Osmanthus varieties according to claim 5, characterized in that, The new variety was added to the molecular fingerprint.

Images