A quality control DNA sequence and its application
By designing quality control DNA with specific gene target sequences and using differences in amplification curves to determine false positives, the problem of quality control contamination in qRT-PCR detection has been solved, thus improving the accuracy of COVID-19 virus detection.
Patent Information
- Application Number
- CN202211404904.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-10
- Publication Date
- 2026-04-17
- Estimated Expiration
- 2042-11-10
AI Technical Summary
In existing COVID-19 virus testing, the quantitative reverse transcription PCR (qRT-PCR) method often results in false positives due to contamination of quality control materials, leading to erroneous test results.
A quality control DNA sequence was designed, comprising a vector DNA sequence, M copies of the target DNA sequence of gene A to be tested, and K copies of the target DNA sequence of gene B to be tested. The difference in detail Ct value distinguishes between quality control contamination and true virus samples. The amplification efficiency is similar when using pUC57 plasmid vector and specific gene target sequences such as orf1ab gene and N gene.
It can effectively distinguish between contaminated quality control samples and genuine virus samples, reduce false positive rates, and improve detection accuracy.
Smart Images

Figure CN116287440B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of virus detection technology, and specifically relates to a quality control DNA sequence and its application. Background Technology
[0002] The initial symptoms of infection are mainly fever, dry cough, and fatigue. Severe cases can rapidly progress to acute respiratory distress syndrome, septic shock, uncorrectable metabolic acidosis, and coagulation dysfunction. A small number of infected individuals only present with low-grade fever and mild fatigue, without pneumonia. The most commonly used rapid detection technology for COVID-19 is quantitative reverse transcription PCR (qRT-PCR). False positives frequently occur in qPCR testing, primarily due to contamination of quality control materials. False positives in qPCR can significantly complicate SARS-CoV-2 detection, leading to errors in testing. Summary of the Invention
[0003] To address the false positive issue in qPCR testing, this invention provides a quality control DNA sequence and its application, as follows:
[0004] On one hand, this invention provides a quality control DNA sequence, including a vector DNA sequence, M copies of the DNA sequence corresponding to the target gene A, and K copies of the DNA sequence corresponding to the target gene B. The target gene A and the target gene B are unique gene sequences of the virus being tested, and their quantities in the virus are X and Y, respectively, where X / Y ≠ M / K. Because X / Y ≠ M / K, and the target amplification efficiency is the same, the detection results will show a difference in the detailct values of the two targets, thus distinguishing whether the positive result is due to contamination of the quality control sample or a genuine virus sample.
[0005] The vector DNA sequence can be from common vectors, selected from plasmid vectors, phage vectors, Cos plasmid vectors, M13 phage vectors, or phage particle vectors, etc.; for example, the pUC57 plasmid vector. The vector DNA sequence must be dissimilar to the virus to be tested and the detection probe, and must not affect the detection.
[0006] Preferably, M*Y / X*K≥2, to more easily define the threshold.
[0007] Specifically, when the virus to be tested is SARS-CoV-2, the amplification efficiency of the N gene target sequence and the orf1ab gene target sequence in the kit is not much different. In SARS-CoV-2 virus, X / Y≤1; the A gene target to be tested is the SEQ ID NO:2 sequence of the orf1ab gene, M is 2; the B gene target to be tested is the N gene, K is 1.
[0008] Furthermore, M copies of the DNA sequence corresponding to the target gene A and K copies of the DNA sequence corresponding to the target gene B are ligated together in a specific order before being ligated to the vector. Preferably, the DNA sequences corresponding to the target gene A and the target gene B are ligated in a manner that avoids repetitive ligation of a single gene as much as possible to reduce the difficulty of synthesis.
[0009] Furthermore, when the virus to be tested is SARS-CoV-2, the DNA sequence of this quality control sample is transcribed into an RNA sequence for use.
[0010] More specifically, when the virus to be tested is SARS-CoV-2, the DNA sequence of the quality control sample includes a vector (specifically the pUC57 plasmid vector), two copies of the DNA sequence corresponding to the orf1ab gene (see SEQ ID NO:2), and one copy of the DNA sequence corresponding to the N gene (see SEQ ID NO:1). The DNA sequences corresponding to the two orf1ab genes are located at both ends of the DNA sequence corresponding to the N gene.
[0011] On the other hand, embodiments of the present invention also provide a method for preparing the aforementioned quality control DNA sequence, comprising the following steps:
[0012] S1: Analyze the genome sequence of the sample to be tested to obtain the DNA sequence corresponding to the target sequence of gene A and the target sequence of gene B. Then, through chemical synthesis, obtain DNA fragments of the target sequence of gene A (M copies) and the target sequence of gene B (K copies).
[0013] S2: Clone the DNA fragment obtained in step S1 into the pUC57 plasmid vector. Select positive clones for amplification culture, and extract the plasmid to obtain the positive control plasmid.
[0014] In another aspect, embodiments of the present invention also provide the application of the aforementioned quality control DNA sequence and its transcribed RNA sequence in distinguishing qPCR false positives.
[0015] False positives are determined by the difference in detail Ct values between the target gene A and the target gene B. The difference in detail Ct values varies depending on the gene target used; a threshold for this difference can be determined through extensive experimentation and statistical analysis.
[0016] Specifically, the application of the RNA sequence corresponding to the DNA sequence of the quality control sample in distinguishing false positives in qPCR during SARS-CoV-2 detection.
[0017] In SARS-CoV-2 detection, the amplification efficiencies of the N gene target sequence and the orf1ab gene target sequence in the kit are not significantly different. The target of gene A to be tested is the SEQ ID NO:2 sequence of the orf1ab gene, with M=2; the target of gene B to be tested is gene N, with K=1. If the difference between the detail Ct value of gene A and gene B (with a threshold of 0) is less than 0, it is considered a positive quality control contamination; otherwise, it is considered a true positive. In SARS-CoV-2 detection, using the SEQ ID NO:2 sequences of the N gene and orf1ab gene as targets, the false positive judgment threshold of 0 is conveniently set.
[0018] In this patent, the difference in detail ct values between two targets distinguishes whether a positive result is due to contamination of a quality control sample or a genuine virus sample. Specifically, in SARS-CoV-2 detection, the difference between the detail ct value of the target gene A and the target gene B is directly determined by whether it is less than 0. Attached Figure Description
[0019] Figure 1 This is a schematic diagram of the combination of the orf1ab gene and the N gene during SARS-CoV-2 testing.
[0020] Figure 2 This is the amplification curve of the orf1ab gene and the N gene at 143-A3.
[0021] Figure 3 The CT values of the orf1ab and N genes are at 143-A3.
[0022] Figure 4 This is the amplification curve of the orf1ab gene and the N gene at 84-03.
[0023] Figure 5 The CT values of the orf1ab and N genes at 84-03;
[0024] Figure 6 The amplification curves of the orf1ab gene and the N gene at 56-A3 are shown.
[0025] Figure 7 The CT values of the orf1ab and N genes at 56-A3;
[0026] Figure 8 This is the amplification curve of the orf1ab gene and the N gene at 18-CT.
[0027] Figure 9The CT values of the orf1ab and N genes at 18-CT are used.
[0028] Figure 10 This is the amplification curve of the orf1ab gene and the N gene during SLD-quality control.
[0029] Figure 11 This refers to the CT values of the orf1ab and N genes during SLD-quality control.
[0030] Figure 12 This is the amplification curve of the orf1ab gene and the N gene at a plasmid concentration of 1.
[0031] Figure 13 This refers to the CT values of the orf1ab and N genes at a plasmid concentration of 1.
[0032] Figure 14 This is the amplification curve of the orf1ab gene and the N gene at a plasmid concentration of 2.
[0033] Figure 15 This refers to the CT values of the orf1ab and N genes at a plasmid concentration of 2. Detailed Implementation
[0034] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below with reference to the accompanying drawings.
[0035] Example 1
[0036] Example 1 provides a method for preparing quality control DNA sequences, including the following steps:
[0037] S1: Select the target sequences (N gene and Orf1ab gene) of the SARS-CoV-2 nucleic acid detection kit, convert the corresponding genome RNA sequence into DNA sequence, and obtain DNA fragments through chemical synthesis methods.
[0038] S101: The selected N gene RNA sequence was converted into a DNA sequence, which is SEQ ID NO:1:
[0039]
[0040] S102: The selected target Orf1ab gene RNA sequence was converted into a DNA sequence, which is SEQ ID NO:2:
[0041] Atcctttggtggtgcatcgtgttgtctgtactgccgttgccacatagatcatccaaatcctaaaggattttgtgacttaaaaggtaagtatgtacaaatacctacaacttgtgctaatgaccctgtgggtttta cacttaaaaacacagtctgtaccgtctgcggtatgtggaaaggttatggctgtagttgtgatcaactccgcgaacccatgcttcagtcagctgatgcacaatcgtttttaaacgggtttgcggtgtaagtgcag.
[0042] S103: Assemble this sequence into a quality control DNA sequence, with the structure as follows: Figure 1 As shown, the sequence is SEQ ID NO:3:
[0043]
[0044] S2: The combined DNA fragment was cloned into the pUC57 cloning plasmid vector. Positive clones were selected for amplification culture, and the plasmid was extracted to obtain the positive control plasmid.
[0045] Example 2
[0046] Example 2 discloses the application of a nucleic acid detection kit and the quality control DNA sequence prepared in Example 1 in the detection of SARS-CoV-2 virus.
[0047] Select the SARS-CoV-2 nucleic acid detection kit (which has obtained a registration certificate), extract the SARS-CoV-2 positive samples, and use the kit's built-in quality control (corresponding to SLD-quality control in Table 2, usually a bacteriophage, used to determine whether the kit can be used normally). Detect the positive samples 143-A3, 84-03, 56-A3, 18-CT, SLD-quality control, and positive control plasmid sample concentrations 1 and 2 according to the instructions. Plasmid concentrations 1 and 2 are RNA sequences prepared from the positive control plasmid prepared in Example 1 after transcription, and are prepared at different concentrations (the concentrations of plasmid concentrations 1 and 2 differ by approximately 10 times; the concentrations must meet the usage requirements). The detection requirements of the SARS-CoV-2 nucleic acid detection kit are shown in Table 1, and the Ct value detection results are shown in Table 2.
[0048] Table 1
[0049]
[0050] Table 2
[0051]
[0052] From Table 2, we can conclude that:
[0053] For positive sample 143-A3, CtFAM-CtROX=2.398.
[0054] For positive sample 84-03, CtFAM-CtROX=1.758.
[0055] For positive sample 56-A3, CtFAM-CtROX=0.844.
[0056] For the positive sample 18-CT, CtFAM-CtROX=2.086.
[0057] For SLD-quality control, CtFAM-CtROX = -0.31.
[0058] For plasmid 1, CtFAM-CtROX = -0.813.
[0059] For plasmid 2, CtFAM-CtROX = -0.836.
[0060] Table 2 shows that the CtFAM-CtROX values of the plasmid did not differ significantly at different concentrations, indicating that concentration had virtually no effect on CtFAM-CtROX. The amplification efficiencies of the N gene target sequence and the orf1ab gene target were also similar. Table 2 concludes that CtFAM-CtROX < 0 indicates a positive quality control contamination in the sample. Repeated testing of the original positive sample further supports the conclusion that the positive sample was indeed a positive quality control contamination.
[0061] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A quality control DNA sequence, characterized in that, It includes a vector DNA sequence, M copies of the DNA sequence corresponding to the target gene A and K copies of the DNA sequence corresponding to the target gene B. The target gene A and the target gene B are unique gene sequences of the virus to be tested, and their quantities in the virus to be tested are X and Y, respectively, wherein X / Y ≠ M / K.
2. The quality control DNA sequence according to claim 1, characterized in that, The vector is selected from plasmid vectors, phage vectors, Cos plasmid vectors, M13 phage vectors, or phage particle vectors.
3. The quality control DNA sequence according to claim 1, characterized in that, M*Y / X*K≥2.
4. The quality control DNA sequence according to claim 1, characterized in that, When the virus to be tested is SARS-CoV-2, the target of the A gene to be tested is the orf1ab gene, and M is 2; the target of the B gene to be tested is the N gene, and K is 1.
5. The quality control DNA sequence according to claim 4, characterized in that, When the virus to be tested is SARS-CoV-2, the DNA sequence of the quality control sample includes a vector, two copies of the DNA sequence corresponding to the orf1ab gene, and one copy of the DNA sequence corresponding to the N gene. The DNA sequences corresponding to the two orf1ab genes are located at both ends of the DNA sequence corresponding to the N gene.
6. The use of the quality control DNA sequence and its transcribed RNA sequence as described in any one of claims 1-5 in distinguishing false positives in qPCR.
7. The application according to claim 6, characterized in that, False positives are determined by the difference in detail Ct values between the target gene A and the target gene B.
8. The application according to claim 7, characterized in that, The RNA sequence corresponding to the DNA sequence of the quality control sample is used to distinguish false positives in qPCR during SARS-CoV-2 detection. In SARS-CoV-2 detection, the target of gene A to be tested is the orf1ab gene, M is 2; the target of gene B to be tested is gene N, K is 1; if the difference between the detail Ct value of the target of gene A to be tested and the detail Ct value of the target of gene B to be tested is less than 0, it is a positive quality control contamination; otherwise, it is a true positive.
Citation Information
Patent Citations
Novel coronavirus quality control material as well as preparation method and application thereof
CN112662812A
Pseudovirus positive standard substance suitable for multi-site novel coronavirus nucleic acid detection
CN115125271A