Compounds and methods for modulating scn2a

By using modified oligonucleotide compounds to reduce the expression of SCN2A RNA and protein, the lack of effective treatments in existing technologies has been addressed, resulting in symptom improvement for developmental and epileptic encephalopathy, intellectual disability, and autism spectrum disorders.

CN116322707BActive Publication Date: 2026-02-03IOANNIS PHARM
View PDF 95 Cites 0 Cited by

Patent Information

Application Number
CN202180054048.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2020-08-07
Filing Date
2021-08-06
Publication Date
2026-02-03
Estimated Expiration
2041-08-06

AI Technical Summary

Technical Problem

Currently, there is a lack of effective treatments to reduce the amount of SCN2A RNA and protein for the treatment of diseases and disorders associated with voltage-gated sodium channel proteins, such as developmental and epileptic encephalopathy, intellectual disability and autism spectrum disorders, especially early-onset epileptic encephalopathy, late-onset epileptic encephalopathy and benign familial neonatal-infant epilepsy.

Method used

Oligomeric compounds, particularly modified oligonucleotides, are provided to reduce the expression of SCN2A RNA and protein by hybridizing with target nucleic acids to achieve antisense activity, thereby reducing their amount or activity and thus improving related symptoms and markers.

Benefits of technology

By reducing the amount of SCN2A RNA and protein, symptoms such as epileptic seizures, hypotonia, sensory integration dysfunction, and delayed motor development were significantly improved, providing therapeutic efficacy for these diseases and disorders.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004103790390000181
    Figure BDA0004103790390000181
  • Figure BDA0004103790390000191
    Figure BDA0004103790390000191
  • Figure BDA0004103790390000201
    Figure BDA0004103790390000201
Patent Text Reader

Abstract

Provided herein are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of SCN2A RNA, and in certain cases, the amount of SCN2A protein in a cell or subject. Such compounds, methods, and pharmaceutical compositions can be used to improve at least one symptom or indicia of a disease or disorder associated with a voltage-gated sodium channel protein, such as, for example, developmental and epileptic encephalopathies, intellectual disability, or an autism spectrum disorder. Such symptoms and indicia include, but are not limited to, seizures, hypotonia, sensory integration disorder, motor development delays and dysfunction, intellectual and cognitive dysfunction, motor and balance dysfunction, visual dysfunction, language and speech delays, gastrointestinal disorders, neurodevelopmental delays, sleep problems, and sudden unexpected death in epilepsy.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] sequence list

[0002] This application is submitted together with the electronic sequence listing. The sequence listing is provided as a file named BIOL0373WOSEQ_ST25.txt, created on August 2, 2021, and is 850KB in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety. Technical Field

[0003] This article provides compounds, methods, and pharmaceutical compositions for reducing the amount or activity of SCN2A RNA in cells or subjects, and in some cases, reducing the amount of SCN2A protein in cells or subjects. Such compounds, methods, and pharmaceutical compositions can be used to improve at least one symptom or marker of a disease or disorder associated with voltage-gated sodium channel proteins, such as, for example, developmental and epileptic encephalopathy, intellectual disability, or autism spectrum disorder. Such symptoms and markers include, but are not limited to, seizures, hypotonia, sensory integration dysfunction, delayed and impaired motor development, intellectual and cognitive impairment, motor and balance impairment, visual impairment, language and speech delay, gastrointestinal disorders, delayed neurodevelopment, sleep problems, and sudden unexpected death in epilepsy. Background Technology

[0004] The human gene SCN2A encodes the human SCN2A protein, the α-1 subunit of the voltage-gated sodium channel NaV1.2. Mutations in SCN2A are associated with a variety of neurodevelopmental and intellectual disorders and impairments, such as developmental and epileptic encephalopathy (DEE), including early-onset epileptic encephalopathy (EE), late-onset epileptic encephalopathy, and benign familial neonatal-infant seizures (BFNIS); mutations in SCN2A are also associated with intellectual disability (ID) and / or autism spectrum disorder (ASD), with or without seizures (Wolff, M., et al., 2019, Epilepsia 60, S59–S67; Sanders, S., et al., 2018, Trends in Neurosciences 41, 442–456; Wolff, M., et al., 2017, Brain 140, 1316–1336). DEE encompasses a wide range of conditions, including neonatal and early infant DEE, such as Ohtahara syndrome and epilepsy with migratory focal seizures of the infant (EIMFS); infantile and pediatric DEE, such as West syndrome and Lennon-Gastaut syndrome; Dravet syndrome; idiopathic / diffuse generalized epilepsy (IGE / GGE); temporal lobe epilepsy; myoclonic athetosis epilepsy (MAE); migratory partial epilepsy of the infant (MMPSI); and familial hemiplegic migraine, with or without epilepsy (Wolff, M., et al., 2019; Harkin, LA, et al., 2007, Brain 130, 843-852; Escayg, A., et al., 2010, Epilepsia 51, 1650-1658; Miller IO, et al., November 29, 2007 [Updated April 18, 2019]. Published in: Adam MP, Ardinger Edited by HH, Pagon RA, and others. [Internet]. Seattle (WA); University of Washington, Seattle; 1993–2020. Available at: www.ncbi.nlm.nih.gov / books / NBK1318 / .

[0005] Symptoms and signs associated with DEE include seizures, hypotonia, sensory integration dysfunction, delayed motor development and functional impairment, intellectual and cognitive impairment, motor and balance dysfunction, visual impairment, language and speech delay, gastrointestinal disturbances, neurodevelopmental delay, sleep problems, and sudden unexpected death in epilepsy. Seizures include focal, clonic, tonic, and generalized tonic and clonic seizures, prolonged seizures (usually lasting longer than 10 minutes), and frequent seizures (e.g., convulsions, myoclonus, absence seizures, focal, drowsy states, and tonic seizures) (Guzzetta, F., 2011, Epilepsia 52:S2, 35-38; Anwar et al., 2019, Cureus 11, e5006, Wolff et al., 2019). Symptoms and signs associated with ID and ASD include delayed motor development, social and language delay, repetitive movements, uncoordinated oral movements, gastrointestinal disturbances, sleep problems, and seizures (Wolff et al., 2019).

[0006] Currently, there is a lack of acceptable treatments for DEE (such as EE, late-onset EE, and BFNIS) and for treating ID and ASD. Therefore, the purpose of this article is to provide compounds, methods, and pharmaceutical compositions for treating such diseases and disorders. Summary of the Invention

[0007] This document provides compounds, methods, and pharmaceutical compositions for reducing the amount or activity of SCN2A RNA, and in some embodiments, for reducing the expression of SCN2A protein in cells or a subject. In some embodiments, the subject suffers from a disease or disorder associated with a voltage-gated sodium channel protein. In some embodiments, the voltage-gated sodium channel protein is SCN2A. In some embodiments, the subject suffers from a disease or disorder associated with a non-SCN2A voltage-gated sodium channel protein. In some embodiments, the subject suffers from a disease or disorder associated with SCN1A.

[0008] In some embodiments, the subject has developmental or epileptic encephalopathy; in some embodiments, the subject has early-onset epileptic encephalopathy; in some embodiments, the subject has late-onset epileptic encephalopathy; in some embodiments, the subject has benign familial neonatal-infant epilepsy; in some embodiments, the subject has intellectual disability (ID); in some embodiments, the subject has autism spectrum disorder (ASD); in some embodiments, the subject has Dravet syndrome seizures. In some embodiments, the compound that can be used to reduce the amount or activity of SCN2A RNA is an oligomeric compound. In some embodiments, the compound that can be used to reduce the amount or activity of SCN2A RNA is a modified oligonucleotide. In some embodiments, the compound that can be used to reduce SCN2A protein expression is an oligomeric compound. In some embodiments, the compound that can be used to reduce SCN2A protein expression is a modified oligonucleotide.

[0009] Methods are also provided for improving at least one symptom or marker of developmental or epileptic encephalopathy such as epilepsy (EE), late-onset epilepsy (EE), and BFNIS; intellectual disability; or autism spectrum disorder. In some embodiments, the symptom or marker includes seizures, hypotonia, sensory integration dysfunction, motor dysfunction, intellectual and cognitive dysfunction, motor and balance dysfunction, visual dysfunction, language and speech delay, neurodevelopmental delay, sudden unexpected death in epilepsy, motor developmental delay, social and language developmental delay, repetitive movements, uncoordinated oral movements, gastrointestinal disorders (e.g., gastroesophageal reflux, diarrhea, constipation, motility disorders, etc.), and sleep problems. In some embodiments, seizures include focal, clonic, tonic, and generalized tonic and clonic seizures, prolonged seizures (typically lasting more than 10 minutes), and frequent seizures (e.g., convulsions, myoclonus, absence seizures, focal, lethargic states, and tonic seizures). Detailed Implementation

[0010] It should be understood that the general description above and the detailed description below are merely exemplary and illustrative, and not restrictive. In this document, unless otherwise expressly stated, the use of the singular includes the plural. As used herein, unless otherwise stated, the use of "or" means "and / or". Furthermore, the term "including" and other forms of use, such as "includes" and "included", are not restrictive. Additionally, terms such as "element" or "part" cover elements and parts comprising one unit, as well as elements and parts comprising more than one subunit, unless specifically stated otherwise.

[0011] The chapter headings used in this document are for organizational purposes only and should not be construed as limiting the subject matter described. All references, or portions thereof, cited in this application include, but are not limited to, patents, patent applications, articles, books, papers, and GenBank, ENSEMBL, and NCBI reference sequence records. Certain references discussed herein and their entire contents are expressly incorporated herein by reference.

[0012] definition

[0013] Unless specifically defined, the terminology, procedures, and techniques used in relation to analytical chemistry, synthetic organic chemistry, medical chemistry, and medicinal chemistry described herein are those well-known and commonly used in the art. Where permitted, all patents, applications, published applications, and other publications, as well as other data, mentioned throughout this disclosure are incorporated herein by reference in their entirety.

[0014] Unless otherwise stated, the following terms have the following meanings:

[0015] definition

[0016] As used herein, “2’-deoxynucleoside” means a nucleoside containing a 2’-H(H)deoxyfuranosyl sugar moiety. In some embodiments, the 2’-deoxynucleoside is a 2’-β-D-deoxynucleoside and contains a 2’-β-D-deoxyribosyl sugar moiety having the β-D ribosyl conformation found in naturally occurring deoxyribonucleic acid (DNA). In some embodiments, the 2’-deoxynucleoside may contain modified nucleotides or may contain RNA nucleotides (uracil).

[0017] As used herein, “2’-MOE” refers to a 2’-OCH2CH2OCH3 group that substitutes for the 2’-OH group of the furanyl sugar moiety. “2’-MOE sugar moiety” refers to a sugar moiety having a 2’-OCH2CH2OCH3 group that substitutes for the 2’-OH group of the furanyl sugar moiety. Unless otherwise stated, the 2’-MOE sugar moiety is β-D-ribosyl. “MOE” refers to o-methoxyethyl.

[0018] As used in this article, "2'-MOE nucleoside" refers to a nucleoside containing the 2'-MOE sugar moiety.

[0019] As used herein, “2’-OMe” refers to a 2’-OCH3 group that replaces the 2’-OH group of the furanyl sugar moiety. “2’-O-methyl sugar moiety” or “2’-OMe sugar moiety” refers to a sugar moiety having a 2’-OCH3 group that replaces the 2’-OH group of the furanyl sugar moiety. Unless otherwise stated, the 2’-OMe sugar moiety is in the -D-ribosyl configuration.

[0020] As used in this article, "2'-OMe nucleoside" refers to a nucleoside containing the 2'-OMe sugar moiety.

[0021] As used herein, “2’-substituted nucleoside” means a nucleoside containing a 2’-substituted sugar moiety. As used herein, “2’-substituted” with respect to the sugar moiety means a sugar moiety containing at least one 2’-substituent group that is not H or OH.

[0022] As used herein, "5-methylcytosine" refers to cytosine modified with a methyl group attached to the 5-position. 5-methylcytosine is a modified nucleobase.

[0023] As used in this article, “administration” means providing the drug to the subject.

[0024] As used herein, “antisense activity” means any detectable and / or measurable change attributable to the hybridization of an antisense compound with its target nucleic acid. In some embodiments, antisense activity is a reduction or decrease in the amount or expression of a target nucleic acid or the protein encoded by such a target nucleic acid compared to the level of the target nucleic acid or the target protein in the absence of an antisense compound.

[0025] As used herein, "antense compound" means an oligomeric compound capable of achieving at least one antisense activity. An antisense compound comprises an antisense oligonucleotide and optionally one or more additional features, such as conjugation groups.

[0026] As used herein, “antisense reagent” means antisense compound and optionally one or more additional features, such as sense compound.

[0027] As used herein, “sense compound” means sense oligonucleotide and optionally one or more additional features, such as conjugation groups.

[0028] As used herein, “antisense oligonucleotide” means oligonucleotide, including the oligonucleotide moiety of an antisense compound, which is capable of hybridizing with a target nucleic acid and possesses at least one antisense activity. Antisense oligonucleotides include, but are not limited to, antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.

[0029] As used herein, “improvement” in relation to treatment means an improvement in at least one symptom or sign relative to the same symptom or sign without treatment. In some embodiments, improvement is a reduction in the severity or frequency of a symptom or sign, or a delay in the onset or slowing of the progression of a symptom or sign. In some embodiments, a symptom or sign is seizures, hypotonia, sensory integration dysfunction, motor dysfunction, intellectual and cognitive dysfunction, motor and balance dysfunction, visual dysfunction, language and speech delay, neurodevelopmental delay, sudden unexpected death in epilepsy, motor developmental delay, social and language developmental delay, repetitive movements, uncoordinated oral movements, gastrointestinal disorders (e.g., gastroesophageal reflux, diarrhea, constipation, motility disorders, etc.), or sleep problems. In some embodiments, a seizure is a focal, clonic, tonic, and generalized tonic and clonic seizure, a prolonged seizure (typically lasting more than 10 minutes), or a frequent seizure (e.g., convulsions, myoclonus, absence seizures, focal, drowsy states, or tonic seizures).

[0030] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two atoms in the first ring, thereby forming a bicyclic structure. In some embodiments, the first ring of the bicyclic sugar moiety is a furanyl moiety. In some embodiments, the furanyl sugar moiety is a ribosyl moiety. In some embodiments, the bicyclic sugar moiety does not contain a furanyl moiety.

[0031] As used in this article, "bicyclic nucleoside" or "BNA" refers to a nucleoside that contains a bicyclic sugar moiety.

[0032] As used herein, "cerebrospinal fluid" or "CSF" refers to the fluid that fills the space surrounding the brain and spinal cord. "Artificial cerebrospinal fluid" or "aCSF" refers to a prepared or manufactured fluid that possesses some of the properties of cerebrospinal fluid.

[0033] As used in this article, "cuttable portion" means a bond or atomic group that can be cut under physiological conditions, such as within a cell, animal, or human body.

[0034] As used herein, “complementary” for an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more portions thereof and the nucleobases of the other nucleic acid or one or more portions thereof are hydrogen-bonded to each other when the nucleobase sequences of the oligonucleotide and another nucleic acid are arranged in opposite directions. As used herein, complementary nucleobases mean nucleobases that are capable of forming hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G). Complementary oligonucleotides and / or target nucleic acids do not need to have nucleobase complementarity at every nucleoside. Of course, some mismatches are tolerable. As used herein, “completely complementary” or “100% complementary” for an oligonucleotide or a portion thereof means that the oligonucleotide or a portion thereof is complementary to the other oligonucleotide or target nucleic acid at every nucleobase of the shorter of the two oligonucleotides, or, if the oligonucleotides are of the same length, complementary at every nucleoside.

[0035] As used herein, a "conjugation group" refers to a group of atoms directly or indirectly attached to an oligonucleotide. Conjugation groups include conjugation portions and conjugation linkers that attach the conjugation portions to the oligonucleotide.

[0036] As used in this article, "conjugation linker" means a single bond or group of atoms that contains at least one bond connecting the conjugation part and the oligonucleotide.

[0037] As used in this article, "conjugation portion" refers to a group of atoms attached to an oligonucleotide via a conjugation linker.

[0038] As used herein, “continuous” in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleotide bonds that are adjacent to each other. For example, “continuous nucleobases” means nucleobases that are adjacent to each other in the sequence.

[0039] As used herein, “cEt” refers to a 4’ to 2’ bridge of a substituted ribosyl sugar moiety with a substituted 2’OH group, wherein the bridge has the formula 4’-CH(CH3)-O-2’ and wherein the methyl group of the bridge is in the S configuration. “cEt sugar moiety” is a bicyclic sugar moiety having a 4’ to 2’ bridge of a substituted ribosyl sugar moiety with a substituted 2’OH group, wherein the bridge has the formula 4’-CH(CH3)-O-2’ and wherein the methyl group of the bridge is in the S configuration. “cEt” refers to a restricted ethyl group.

[0040] As used in this article, "cEt nucleoside" refers to a nucleoside containing a cEt-modified sugar moiety.

[0041] As used herein, a "chiral enrichment cluster" refers to a group of molecules having the same molecular formula, wherein if a particular chiral center is stereorandom, the number or percentage of molecules in the population containing a particular stereochemical configuration at that particular chiral center is greater than the expected number or percentage of molecules in the population containing the same particular stereochemical configuration at the same particular chiral center. A chiral enrichment cluster of molecules, each containing multiple chiral centers, may contain one or more stereorandom chiral centers. In some embodiments, the molecule is a modified oligonucleotide. In some embodiments, the molecule is a compound comprising a modified oligonucleotide.

[0042] As used in this article, the “chiral reference” for internucleotide bonds refers to the chiral enrichment of a specific stereochemical configuration at that bond location.

[0043] As used herein, a "deoxygenated region" refers to a region of 5-12 consecutive nucleotides in which at least 70% of the nucleotides are 2'-β-D-deoxynucleotides. In some embodiments, each nucleotide is selected from 2'-β-D-deoxynucleotides, bicyclic nucleotides, and 2'-substituted nucleotides. In some embodiments, the deoxygenated region supports RNase H activity. In some embodiments, the deoxygenated region is a gap or internal region of a gapmer.

[0044] As used herein, “gapmer” refers to an oligonucleotide comprising an internal region having multiple nucleotides that support RNase H cleavage between an external region comprising one or more nucleotides, wherein the nucleotide comprising the internal region is chemically different from the one or more nucleotides comprising the external region. The internal region may be referred to as a “gap,” and the external region may be referred to as a “flank” or “flank fragment.” In some embodiments, the internal region is a deoxygenated region. The location of the internal region or gap refers to the nucleotide sequence of the internal region, counted starting from the 5' end of the internal region. Unless otherwise stated, “gapmer” refers to a glycosylation motif. In some embodiments, each nucleotide of the gap is a 2'-β-D-deoxynucleotide. In some embodiments, the gap comprises a 2'-substituted nucleotide at position 1, 2, 3, 4, or 5 of the gap, the remainder of the gap being a 2'-β-D-deoxynucleotide. As used herein, the term “MOE gapmcr” indicates a gap having a gap comprising a 2'-β-D-deoxynucleotide and a flank comprising a 2'-MOE nucleotide. As used herein, the term "mixed flanking gapmer" refers to a gapmer having flanks containing modified nucleotides comprising at least two different sugar modifications. Unless otherwise stated, a gapmer may contain one or more modified nucleotide inter-bonds and / or modified nucleobases, and such modifications do not necessarily follow the sugar-modified gapmer pattern.

[0045] As used in this article, a “hotspot region” is a series of nucleobases on a target nucleic acid that are subject to a reduction in the amount or activity of the target nucleic acid mediated by oligomers.

[0046] As used in this article, “hybridization” means the pairing or annealing of complementary oligonucleotides and / or nucleic acids. While not limited to a specific mechanism, the most common hybridization mechanisms involve hydrogen bonds between complementary nucleobases, which can be Watson-Crick hydrogen bonds, Hoogsteen hydrogen bonds, or reverse Hoogsteen hydrogen bonds.

[0047] As used herein, “nucleoside bond” refers to a covalent bond between adjacent nucleosides in an oligonucleotide. As used herein, “modified nucleoside bond” refers to any nucleoside bond other than a phosphodiester nucleoside bond. A “phosphothiophosphate nucleoside bond” or “PS nucleoside bond” is a modified nucleoside bond in which a non-bridging oxygen atom of the phosphodiester nucleoside bond is replaced by a sulfur atom.

[0048] As used herein, "linker-nucleoside" refers to a nucleoside that directly or indirectly links an oligonucleotide to a conjugated portion. Linker-nucleosides reside within the conjugated linker of the oligomer. Linker-nucleosides are not considered part of the oligonucleotide moiety of the oligomer, even if they are adjacent to the oligonucleotide.

[0049] As used herein, “LNA” means locked nucleic acid. “LNA sugar moiety” is a bicyclic sugar moiety having a 4' to 2' bridge having a substituted 2'OH group for the furanyl sugar moiety, wherein said bridge has the formula 4'-CH2-O-2'. “LNA” means locked nucleic acid. In some embodiments, the furanyl sugar moiety is a ribosyl sugar moiety. As used herein, “LNA nucleoside” means a nucleoside containing an LNA sugar moiety.

[0050] As used herein, “non-bicyclic modified sugar moiety” means a sugar moiety that includes modifications (such as substituents) that do not form a bridge between the two atoms of the sugar to form a second ring.

[0051] As used in this article, “mismatch” or “non-complementary” means that when the first and second oligonucleotides are aligned, the nucleobases of the first oligonucleotide are not complementary to the corresponding nucleobases of the second oligonucleotide or the target nucleic acid.

[0052] As used in this article, "motif" refers to the pattern of unmodified and / or modified sugar moieties, nucleobases, and / or nucleoside bonds in an oligonucleotide.

[0053] As used herein, “nucleobase” refers to an unmodified nucleobase or a modified nucleobase. As used herein, “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleobase. “5-methylcytosine” is a modified nucleobase. A universal base is a modified nucleobase that can pair with any of the five unmodified nucleobases. As used herein, “nucleobase sequence” refers to the sequence of consecutive nucleobases in a target nucleic acid or oligonucleotide, independent of any sugar or nucleoside internucleotide modifications.

[0054] As used herein, "nucleoside" means a compound or fragment of a compound containing a nucleobase and a sugar moiety. The nucleobase and sugar moiety are either unmodified or modified independently. As used herein, "modified nucleoside" means a nucleoside containing a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include debased nucleosides lacking a nucleobase. "Linked nucleosides" are nucleosides linked by a continuous sequence (i.e., there are no other nucleosides between the linked nucleosides).

[0055] As used herein, "oligomeric compound" means oligonucleotide and optionally one or more additional features, such as conjugation groups or terminal groups. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound, or it may be unpaired. A "single-chain oligomeric compound" is an unpaired oligomeric compound. The term "oligodimer" refers to a duplex formed from two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound in an oligodimer may be referred to as a "double-chain oligomeric compound."

[0056] As used herein, “oligonucleotide” means a chain of linked nucleosides connected by nucleotide bonds, wherein each nucleoside and nucleotide bond may be modified or unmodified. Unless otherwise stated, an oligonucleotide consists of 8-50 linked nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide in which at least one nucleoside or nucleotide bond is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide that does not contain any nucleoside or nucleotide modifications.

[0057] As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for administration to a subject. Certain such carriers enable the pharmaceutical composition to be formulated, for example, into tablets, pills, sugar-coated pills, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In some embodiments, a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution, or sterile artificial cerebrospinal fluid.

[0058] As used herein, "pharmaceutically acceptable salt" means a compound that is physiologically and pharmaceutically acceptable. Pharmacologically acceptable salts retain the desired biological activity of the parent compound without imparting undesirable toxicological effects.

[0059] As used herein, "pharmaceutical composition" means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In some embodiments, the pharmaceutical composition shows activity in free uptake assays in certain cell lines.

[0060] As used herein, "prodrug" refers to a therapeutic agent in its in vitro form, which is converted into a different form within the subject or their cells. Typically, the conversion of a prodrug within the subject is facilitated by the action of enzymes (e.g., endogenous or viral enzymes) or chemicals present in the cells or tissues and / or by physiological conditions.

[0061] As used in this article, “reduced amount,” “reduced activity,” “lower amount,” or “lower activity” refers to a reduction or blockage of transcriptional expression or activity relative to untreated or control samples, and does not necessarily indicate the complete elimination of transcriptional expression or activity.

[0062] As used herein, “RNA” means RNA transcript and includes both precursor mRNA and mature mRNA, unless otherwise stated.

[0063] As used herein, "RNAi compound" means an antisense compound that regulates a target nucleic acid and / or the protein encoded by the target nucleic acid through at least partial RISC or Ago2 action. RNAi compounds include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNA), and microRNAs, including microRNA mimics. In some embodiments, RNAi compounds regulate the amount, activity, and / or splicing of the target nucleic acid. The term RNAi compound does not include antisense compounds that act via RNase H.

[0064] As used in this article, “self-complementarity” in the context of oligonucleotides means oligonucleotides that hybridize with themselves at least partially.

[0065] As used herein, “standard in vitro assay” means the assay described in Example 1 and its reasonable variations.

[0066] As used herein, “in vivo assay” means the assay described in Example 8 and its reasonable variations.

[0067] As used herein, "stereorandom chiral center" in the context of a group of molecules with the same molecular formula refers to a chiral center having a random stereochemical configuration. For example, in a group of molecules containing a stereorandom chiral center, the number of molecules with the (S) configuration of the stereorandom chiral center may, but is not necessarily, the same as the number of molecules with the (R) configuration of the stereorandom chiral center. When the stereochemical configuration of the chiral center is a result of the synthetic method rather than designed to control the stereochemical configuration, it is considered random. In some embodiments, the stereorandom chiral center is a stereorandom phosphate thioester nucleoside bond.

[0068] As used herein, "subject" refers to a human or a non-human animal. In some implementations, the subject is a human.

[0069] As used herein, “glycan” refers to an unmodified or modified sugar moiety. As used herein, “unmodified sugar moiety” refers to the 2'-OH(H)β-D-ribosyl moiety found in RNA (“unmodified RNA sugar moiety”) or the 2'-H(H)β-D-deoxyribosyl sugar moiety found in DNA (“unmodified DNA sugar moiety”). An unmodified sugar moiety has one hydrogen atom at each of the 1', 3', and 4' positions, one oxygen atom at the 3' position, and two hydrogen atoms at the 5' position. As used herein, “modified sugar moiety” or “modified sugar” refers to a modified furanyl sugar moiety or a sugar substitute.

[0070] As used herein, “sugar substitute” means a sugar moiety modified in addition to the furanyl moiety, which can link a nucleobase to another group, such as a nucleoside internucleotide, a conjugation group, or a terminal group in an oligonucleotide. Nucleosides containing sugar substitutes can be incorporated into one or more positions in an oligonucleotide, and such oligonucleotides can hybridize with complementary oligomers or target nucleic acids.

[0071] As used herein, “symptom or sign” means any physical feature or test result that indicates the presence or extent of a disease or disorder. In some embodiments, the symptom is obvious to the subject or a medical professional examining or testing the subject. In some embodiments, the sign is obvious in invasive diagnostic tests, including but not limited to post-mortem tests. In some embodiments, the sign is obvious on a brain MRI scan.

[0072] As used herein, “target nucleic acid” and “target RNA” refer to the nucleic acid that the antisense compound is intended to affect. Target RNA refers to RNA transcripts, including pre-mRNA and mature mRNA, unless otherwise stated.

[0073] As used in this article, "target region" refers to the portion of the target nucleic acid in the design hybridization of oligomeric compounds.

[0074] As used in this article, "terminal group" refers to a chemical group or group of atoms covalently attached to the end of an oligonucleotide.

[0075] As used in this article, "therapeutic effective amount" refers to the amount of medicine that provides therapeutic benefit to the subject. For example, a therapeutically effective amount improves the symptoms or signs of a disease or disorder.

[0076] As used herein, “treatment” means improving a subject’s disease or disorder by administering the oligomers or oligomers described herein. In some embodiments, the treated subject improves the same symptoms relative to the symptoms without treatment. In some embodiments, the treatment reduces the severity or frequency of symptoms, or delays the onset of symptoms, slows the progression of symptoms, or slows the severity or frequency of symptoms.

[0077] Some implementation schemes

[0078] This disclosure provides implementation schemes with the following non-restrictive designations:

[0079] Implementation Scheme 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an isolength portion of an SCN2A nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside inter-bond.

[0080] Implementation Scheme 2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, and having a nucleobase sequence of at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases comprising any nucleobase sequence comprising SEQ ID NO: 16-2531, wherein said modified oligonucleotide comprises at least one modification selected from modified sugar moieties and modified nucleoside internucleotides.

[0081] Implementation Scheme 3. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, and having a nucleobase sequence of at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 consecutive nucleobases comprising any nucleobase sequence comprising SEQ ID NO: 2532-2539, wherein said modified oligonucleotide comprises at least one modification selected from modified sugar moieties and modified nucleoside internucleotides.

[0082] Implementation Scheme 4. The oligomeric compound of any one of Implementation Schemes 1 to 3, wherein the modified oligonucleotide is at least 90% complementary to the isolength portion of SEQ ID NO: 2 and no more than 50% complementary to the isolength portion of SEQ ID NO: 1.

[0083] Implementation Scheme 5. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein

[0084] a) The modified oligonucleotide sequence comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 bases that are identical to SEQ ID. NO:2 consists of consecutive nucleobases of equal length complementary portions of the following nucleotides: 199863-199905, 227493-22755, 243124-243204, 247823-247921, 254142-254177, 168911-168945, 170026-170061, 183519-183562, 188630-188668, 199912-199962, 227419-227450, or 238173-238192, provided that the modified oligonucleotide does not contain more than six LNA nucleotides; or

[0085] b) The modified oligonucleotide's nucleotide sequence comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides complementary to the equal-length portions of nucleotides 243917-244073, 170174-170200, 176724-176751, 180772-180801, 183968-184016, 202877-202906, 224198-224217, 224199-224218, or 243918-243937 of SEQ ID NO: 2.

[0086] The modified oligonucleotide contains at least one modification selected from the modified sugar moiety and the modified nucleoside internucleotide bond.

[0087] Implementation Scheme 6. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein

[0088] a) The nucleobase sequence of the modified oligonucleotide comprises the sequence selected from SEQ ID NO: 336, 488, 2021, 2097, 2174, 2250, 2326, 2403, 2499, 2500, 2501, 2502, 2526; 181, 259, 643, 720, 796, 2504, 2505, 2506, 2507, 2508, 2509, 2510, 2511, 2512, 2513, 2514, 2521; 491, 567, 644, 721, 797, 2177, 2253, 2315, 2329, 24 06, 2527; 29, 30, 107, 108, 185, 186, 263, 264, 341, 342, 419, 420, 1796, 1871, 1948, 2025, 2101, 2178, 2254, 2330, 2503, 2517, 2522; 1016, 1093, 1104, 1169, 1246, 1323, 1400, 1477, 1554, 1708, 1785, 1860, 1937, 2014, 1631, 2090, 2539; 18, 96, 485, 561, 638, 715, 791, 868, 2247, 2323, 2400; 174, 1328, 1405, 1482, 1559, 1636, 1713, 1790, 1865, 1942, 2019; 20, 98, 253, 332, 410, 1406, 1483, 1560, 1637, 1714, 1791, 1866, 1943; 21, 411, 1407, 1484, 1561, 1638 1715; 24, 414, 871, 948, 1025, 1100; 25, 337, 415, 490, 566, 2099, 2176, 2252, 2328, 2405; and 182 of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases; provided that the modified oligonucleotide does not contain more than six LNA nucleosides; or

[0089] b) The nucleobase sequence of the modified oligonucleotide comprises the sequence selected from SEQ ID NO: 1090, 1166, 2484, 2485, 2487, 2493, 2496, 2497, 2498, 2533, 2534, 2535, 2537; 302, 1513, 1667, 1744, 1819, 1896, 1973; 148, 226, 1364, 1441, 1518, 1595, 1672, 1749; 227, 1292, 1369, 1446, 1523, 1600, 1677, 1754, 18 The sequences 29; 228, 1679, 1756, 1831, 1908, 1985, 2061, 2138, 2214, 2290; 1226, 1303, 1380, 1457, 1534, 1611; 2079; 2523; and 2477 contain at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleobases.

[0090] The modified oligonucleotide contains at least one modification selected from the modified sugar moiety and the modified nucleoside internucleotide bond.

[0091] Implementation Scheme 7. The oligomeric compound of any one of Implementation Schemes 1 to 6, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or 20 consecutive nucleobases of any one of SEQ ID NO: 2487, 2493, 2510 or 2514.

[0092] Implementation Scheme 8. An oligomeric compound as described in any one of Implementation Schemes 1 to 6, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17 or 18 consecutive nucleobases of SEQ ID NO: 2534.

[0093] Implementation Scheme 9. The oligomeric compound of any one of Implementation Schemes 1 to 8, wherein, when measured over the entire nucleobase sequence of the modified oligonucleotide, the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

[0094] Implementation Scheme 10. The oligomeric compound as described in Implementation Scheme 9, wherein the modified oligonucleotide is...

[0095] The intragene region of the nucleobase sequence of SEQ ID NO: 2;

[0096] The untranslated region of the nucleobase sequence of SEQ ID NO: 2; or

[0097] The intron / exon linking regions of the nucleobase sequence of SEQ ID NO: 2 are at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary.

[0098] Implementation Scheme 11. The oligomeric compound of any one of Implementation Schemes 1-10, wherein the nucleobase sequence of the modified oligonucleotide is complementary to the exon region of the nucleobase sequence of SEQ ID NO: 2 by no more than 50%, no more than 60%, no more than 70%, no more than 80%, no more than 90%, or no more than 95%.

[0099] Implementation Scheme 12. The oligomeric compound as described in any one of Implementation Schemes 1 to 11, wherein the modified oligonucleotide comprises 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25 Composed of 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.

[0100] Implementation Scheme 13. An oligomeric compound as described in any one of Implementation Schemes 1 to 11, wherein the modified oligonucleotide consists of 17 to 19 or 21 to 30 linked nucleosides.

[0101] Implementation Scheme 14. An oligomeric compound as described in any one of Implementation Schemes 1 to 13, wherein the modified oligonucleotide is composed of 16, 17, 18, 19 or 20 linked nucleosides.

[0102] Implementation Scheme 15. The oligomeric compound as described in Implementation Scheme 14, wherein the modified oligonucleotide consists of 20 linked nucleosides.

[0103] Implementation Scheme 16. The oligomeric compound as described in Implementation Scheme 14, wherein the modified oligonucleotide consists of 18 linked nucleosides.

[0104] Implementation Scheme 17. An oligomeric compound as described in any one of Implementation Schemes 1 to 16, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.

[0105] Implementation Scheme 18. The oligomeric compound of Implementation Scheme 17, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.

[0106] Implementation Scheme 19. The oligomeric compound as described in Implementation Scheme 18, wherein the bicyclic sugar moiety comprises a 4'-2' bridge, wherein the 4'-2' bridge is selected from -CH2-O- and -CH(CH3)-O-.

[0107] Implementation Scheme 20. An oligomeric compound as described in any one of Implementation Schemes 17 to 19, wherein the modified oligonucleotide does not contain more than six bicyclic sugar moieties.

[0108] Implementation Scheme 21. The oligomeric compound as described in Implementation Scheme 17, wherein the modified oligonucleotide does not contain a bicyclic sugar moiety.

[0109] Implementation Scheme 22. The oligomeric compound of any one of Implementation Schemes 17 to 20, wherein the modified oligonucleotide does not contain more than six LNA sugar moieties.

[0110] Implementation Scheme 23. The oligomeric compound of any one of Implementation Schemes 17 to 21, wherein the modified oligonucleotide does not contain an LNA sugar moiety.

[0111] Implementation Scheme 24. An oligomeric compound as described in any one of Implementation Schemes 17 to 23, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety.

[0112] Implementation Scheme 25. The oligomeric compound as described in Implementation Scheme 24, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe sugar moiety.

[0113] Implementation Scheme 26. An oligomeric compound as described in any one of Implementation Schemes 17 to 25, wherein the modified oligonucleotide comprises at least one modified nucleoside containing a sugar substitute.

[0114] Implementation Scheme 27. The oligomeric compound as described in Implementation Scheme 26, wherein the sugar substitute is any one of morpholino, modified morpholino, PNA, THP, and F-HNA.

[0115] Implementation Scheme 28. An oligomeric compound as described in any one of Implementation Schemes 1 to 27, wherein the modified oligonucleotide is a gapmer.

[0116] Implementation Scheme 29. The oligomeric compound of any one of Implementation Schemes 1 to 28, wherein the modified oligonucleotide comprises:

[0117] A 5'-region consisting of 1 to 6 linked 5'-regional nucleotides;

[0118] A central region consisting of 6 to 10 linked central nucleotides; and

[0119] A 3'-region consists of 1 to 6 linked 3'-regional nucleosides;

[0120] Each of the 5'-regional nucleotides and each of the 3'-regional nucleotides comprises a modified sugar moiety, and at least six of the central region nucleotides comprise a 2'-β-D-deoxyribosyl sugar moiety.

[0121] Implementation Scheme 30. The oligomeric compound of any one of Implementation Schemes 1 to 28, wherein the modified oligonucleotide comprises:

[0122] A 5'-region consisting of 1 to 6 linked 5'-regional nucleotides;

[0123] A central region consisting of 6 to 10 linked central nucleotides; and

[0124] A 3'-region consists of 1 to 6 linked 3'-regional nucleosides;

[0125] Each of the 5'-regional nucleotides and each of the 3'-regional nucleotides comprises a modified sugar moiety, and each of the central region nucleotides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0126] Implementation Scheme 31. The oligomeric compound of Implementation Scheme 29, wherein the modified oligonucleotide comprises:

[0127] The 5'-region consists of five linked 5'-regional nucleotides;

[0128] The central region consists of 10 connected central nucleotides; and

[0129] The 3'-region consists of 5 linked 3'-regional nucleosides; among which

[0130] Each of the 5'-regional nucleotides and each of the 3'-regional nucleotides comprises a 2'-MOE-modified sugar moiety, and at least six of the central region nucleotides comprise a 2'-β-D-deoxyribosyl sugar moiety.

[0131] Implementation Scheme 32. The oligomeric compound of Implementation Scheme 30, wherein the modified oligonucleotide comprises:

[0132] The 5'-region consists of five linked 5'-regional nucleotides;

[0133] The central region consists of 10 connected central nucleotides; and

[0134] The 3'-region consists of 5 linked 3'-regional nucleosides; among which

[0135] Each of the 5'-regional nucleotides and each of the 3'-regional nucleotides comprises a 2'-MOE-modified sugar moiety, and each of the central region nucleotides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0136] Implementation Scheme 33. The oligomeric compound of Implementation Scheme 29, wherein the modified oligonucleotide comprises:

[0137] The 5'-region consists of 6 linked 5'-regional nucleotides;

[0138] The central region consists of 10 connected central nucleotides; and

[0139] The 3'-region consists of four linked 3'-regional nucleosides; among which

[0140] Each of the 5'-regional nucleotides and each of the 3'-regional nucleotides comprises a 2'-MOE-modified sugar moiety, and at least six of the central region nucleotides comprise a 2'-β-D-deoxyribosyl sugar moiety.

[0141] Implementation Scheme 34. The oligomeric compound of Implementation Scheme 30, wherein the modified oligonucleotide comprises:

[0142] The 5'-region consists of 6 linked 5'-regional nucleotides;

[0143] The central region consists of 10 connected central nucleotides; and

[0144] The 3'-region consists of four linked 3'-regional nucleosides; among which

[0145] Each of the 5'-regional nucleotides and each of the 3'-regional nucleotides comprises a 2'-MOE-modified sugar moiety, and each of the central region nucleotides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0146] Implementation Scheme 35. The oligomeric compound of Implementation Scheme 29, wherein the modified oligonucleotide comprises:

[0147] The 5'-region consists of four linked 5'-regional nucleotides;

[0148] The central region consists of 10 connected central nucleotides; and

[0149] The 3'-region consists of 6 linked 3'-regional nucleosides; among which

[0150] Each of the 5'-regional nucleotides and each of the 3'-regional nucleotides comprises a 2'-MOE-modified sugar moiety, and at least six of the central region nucleotides comprise a 2'-β-D-deoxyribosyl sugar moiety.

[0151] Implementation Scheme 36. The oligomeric compound of Implementation Scheme 30, wherein the modified oligonucleotide comprises:

[0152] The 5'-region consists of four linked 5'-regional nucleotides;

[0153] The central region consists of 10 connected central nucleotides; and

[0154] The 3'-region consists of 6 linked 3'-regional nucleosides; among which

[0155] Each of the 5'-regional nucleotides and each of the 3'-regional nucleotides comprises a 2'-MOE-modified sugar moiety, and each of the central region nucleotides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0156] Implementation Scheme 37. The oligomeric compound of Implementation Scheme 29, wherein the modified oligonucleotide comprises:

[0157] The 5'-region consists of four linked 5'-regional nucleotides;

[0158] The central region consists of 8 connected central nucleotides; and

[0159] The 3'-region consists of 6 linked 3'-regional nucleosides; among which

[0160] Each of the 5'-regional nucleotides and each of the 3'-regional nucleotides comprises a 2'-MOE-modified sugar moiety, and at least six of the central region nucleotides comprise a 2'-β-D-deoxyribosyl sugar moiety.

[0161] Implementation Scheme 38. The oligomeric compound of Implementation Scheme 30, wherein the modified oligonucleotide comprises:

[0162] The 5'-region consists of four linked 5'-regional nucleotides;

[0163] The central region consists of 8 connected central nucleotides; and

[0164] The 3'-region consists of 6 linked 3'-regional nucleosides; among which

[0165] Each of the 5'-regional nucleotides and each of the 3'-regional nucleotides comprises a 2'-MOE-modified sugar moiety, and each of the central region nucleotides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0166] Implementation Scheme 39. The oligomeric compound of Implementation Scheme 29, wherein the modified oligonucleotide comprises:

[0167] The 5'-region consists of 6 linked 5'-regional nucleotides;

[0168] The central region consists of 8 connected central nucleotides; and

[0169] The 3'-region consists of four linked 3'-regional nucleosides; among which

[0170] Each of the 5'-regional nucleotides and each of the 3'-regional nucleotides comprises a 2'-MOE-modified sugar moiety, and at least six of the central region nucleotides comprise a 2'-β-D-deoxyribosyl sugar moiety.

[0171] Implementation Scheme 40. The oligomeric compound of Implementation Scheme 30, wherein the modified oligonucleotide comprises:

[0172] The 5'-region consists of 6 linked 5'-regional nucleotides;

[0173] The central region consists of 8 connected central nucleotides; and

[0174] The 3'-region consists of four linked 3'-regional nucleosides; among which

[0175] Each of the 5'-regional nucleotides and each of the 3'-regional nucleotides comprises a 2'-MOE-modified sugar moiety, and each of the central region nucleotides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0176] Implementation Scheme 41. The oligomeric compound of Implementation Scheme 29, wherein the modified oligonucleotide comprises:

[0177] The 5'-region consists of five linked 5'-regional nucleotides;

[0178] The central region consists of 8 connected central nucleotides; and

[0179] The 3'-region consists of 5 linked 3'-regional nucleosides; among which

[0180] Each of the 5'-regional nucleotides and each of the 3'-regional nucleotides comprises a 2'-MOE-modified sugar moiety, and at least six of the central region nucleotides comprise a 2'-β-D-deoxyribosyl sugar moiety.

[0181] Implementation Scheme 42. The oligomeric compound of Implementation Scheme 30, wherein the modified oligonucleotide comprises:

[0182] The 5'-region consists of five linked 5'-regional nucleotides;

[0183] The central region consists of 8 connected central nucleotides; and

[0184] The 3'-region consists of 5 linked 3'-regional nucleosides; among which

[0185] Each of the 5'-regional nucleotides and each of the 3'-regional nucleotides comprises a 2'-MOE-modified sugar moiety, and each of the central region nucleotides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0186] Implementation Scheme 43. An oligomeric compound as described in Implementation Scheme 29 or Implementation Scheme 30, wherein the 5'-region or the 3'-region comprises at least one bicyclic nucleoside.

[0187] Implementation Scheme 44. An oligomeric compound as described in Implementation Scheme 29 or Implementation Scheme 30, wherein the 5'-region or the 3'-region comprises at least one nucleoside that is not a bicyclic nucleoside.

[0188] Implementation Scheme 45. An oligomeric compound as described in Implementation Scheme 29 or Implementation Scheme 30, wherein the 5'-region or the 3'-region comprises at least one nucleoside that is not an LNA nucleoside.

[0189] Implementation Scheme 46. An oligomeric compound as described in any one of Implementation Schemes 1 to 45, wherein the modified oligonucleotide comprises at least one modified nucleoside internucleotide bond.

[0190] Implementation Scheme 47. The oligomeric compound as described in Implementation Scheme 46, wherein at least one modified nucleoside inter-bond is a thiophosphate nucleoside inter-bond.

[0191] Implementation scheme 48. An oligomeric compound as described in implementation scheme 46 or 47, wherein each nucleoside interbond is a modified nucleoside interbond.

[0192] Implementation Scheme 49. An oligomeric compound as described in Implementation Scheme 48, wherein each nucleoside internucleotide bond is a thiophosphate nucleoside internucleotide bond.

[0193] Implementation Scheme 50. The oligomeric compound of any one of Implementation Schemes 46 to 47, wherein at least one nucleoside internucleotide bond of the modified oligonucleotide is a phosphodiester nucleoside internucleotide bond.

[0194] Implementation Scheme 51. An oligomeric compound as described in any one of Schemes 1 to 46, wherein each nucleoside internucleotide bond of the modified oligonucleotide is independently selected from a phosphodiester bond or a thiophosphate nucleoside internucleotide bond.

[0195] Implementation Scheme 52. An oligomeric compound as described in any one of Implementation Schemes 1 to 47 or 50 to 51, wherein at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17 or at least 18 nucleotide inter-bonds of the modified oligonucleotide are phosphate thioester nucleotide inter-bonds.

[0196] Implementation Scheme 53. An oligomeric compound as described in Implementation Scheme 46, wherein the nucleoside internucleotide motif of the modified oligonucleotide is selected from sooooossssssssssooss, soooosssssssssssssoss, soooosssssssssssoooss, soooosssssssssssoooss, soooosssssssssssss, and soooossssssssssss.

[0197] Where s = thiophosphate nucleoside inter-bond, o = phosphate diester nucleoside inter-bond.

[0198] Implementation Scheme 54. The oligomeric compound of any one of Implementation Schemes 1 to 53, wherein the modified oligonucleotide comprises at least one modified nucleobase.

[0199] Implementation Scheme 55. The oligomeric compound as described in Implementation Scheme 54, wherein the modified nucleobase is 5-methylcytosine.

[0200] Implementation Scheme 56. The oligomeric compound of any one of Implementation Schemes 1 to 55, wherein when administered according to a standard in vitro assay, the oligomeric compound is capable of reducing the amount of SCN2A RNA in vitro by at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

[0201] Implementation Scheme 57. An oligomeric compound comprising an oligonucleotide modified according to the following chemical symbol: G es m C eo A eo T eo Aeo A ds T ds m C ds m C ds m C ds A ds T ds T ds A ds T ds A eo m C eo A es A es A e (SEQ ID NO: 2493), where:

[0202] A = adenine nucleobase,

[0203] m C = 5-methylcytosine nucleobase,

[0204] G = guanine nucleobase

[0205] T = thymine nucleobase,

[0206] e = 2'-MOE sugar moiety,

[0207] d = 2'-β-D-deoxyribosyl sugar moiety,

[0208] s = thiophosphate nucleoside bond, and

[0209] o = phosphate diester nucleoside bond.

[0210] Implementation Scheme 58. An oligomeric compound comprising an oligonucleotide modified according to the following chemical symbols: m C e s A eo m C eo G eo A eo m C eo A ds T ds A ds T ds T ds T ds T ds T ds m C ds T ds A eo m C esA es m C e (SEQ ID NO: 2514), where:

[0211] A = adenine nucleobase,

[0212] m C = 5-methylcytosine nucleobase,

[0213] G = guanine nucleobase

[0214] T = thymine nucleobase,

[0215] e = 2'-MOE sugar moiety,

[0216] d = 2'-β-D-deoxyribosyl sugar moiety,

[0217] s = thiophosphate nucleoside bond, and

[0218] o = Phosphodiester nucleoside bond.

[0219] Implementation Scheme 59. An oligomeric compound comprising an oligonucleotide modified according to the following chemical symbols: m C es m C eo A eo m C eo G eo A eo m C ds A ds T ds A ds T ds T ds T ds T ds T ds m C ds T eo A es m C es A e (SEQ ID NO: 2510), where:

[0220] A = adenine nucleobase,

[0221] m C = 5-methylcytosine nucleobase,

[0222] G = guanine nucleobase

[0223] T = thymine nucleobase,

[0224] e = 2'-MOE sugar moiety,

[0225] d = 2'-β-D-deoxyribosyl sugar moiety,

[0226] s = thiophosphate nucleoside bond, and

[0227] o = phosphate diester nucleoside bond.

[0228] Implementation Scheme 60. An oligomeric compound comprising an oligonucleotide modified according to the following chemical symbol: T es m C eo T eo G eo m C eo A eo T ds G ds T ds A ds A ds m C ds m C ds T ds T ds T ds A eo T es A es m C e (SEQ ID NO: 2487), where:

[0229] A = adenine nucleobase,

[0230] m C = 5-methylcytosine nucleobase,

[0231] G = guanine nucleobase

[0232] T = thymine nucleobase,

[0233] e = 2'-MOE sugar moiety,

[0234] d = 2'-β-D-deoxyribosyl sugar moiety,

[0235] s = thiophosphate nucleoside bond, and

[0236] o = phosphate diester nucleoside bond.

[0237] Implementation Scheme 61. An oligomeric compound comprising an oligonucleotide modified according to the following chemical symbol: G es m C eo A eoT eo A eo A eo T ds m C ds m C ds m C ds A ds T ds T ds A ds T ds A ds m C eo A es A es A e (SEQ ID NO: 2493), where:

[0238] A = adenine nucleobase,

[0239] m C = 5-methylcytosine nucleobase,

[0240] G = guanine nucleobase

[0241] T = thymine nucleobase,

[0242] e = 2'-MOE sugar moiety,

[0243] d = 2'-β-D-deoxyribosyl sugar moiety,

[0244] s = thiophosphate nucleoside bond, and

[0245] o = phosphate diester nucleoside bond.

[0246] Implementation Scheme 62. An oligomeric compound comprising an oligonucleotide modified according to the following chemical symbol: GT m C es T eo G eo m C eo A es T ds G ds T ds A ds A ds m C ds m C ds T ds T eo T eo A es T es A e(SEQ ID NO: 2534), where:

[0247] A = adenine nucleobase,

[0248] m C = 5-methylcytosine nucleobase,

[0249] G = guanine nucleobase

[0250] T = thymine nucleobase,

[0251] e = 2'-MOE sugar moiety,

[0252] d = 2'-β-D-deoxyribosyl sugar moiety,

[0253] s = thiophosphate nucleoside bond, and

[0254] o = phosphate diester nucleoside bond.

[0255] Implementation Scheme 63. An oligomeric compound as described in any one of Implementation Schemes 1 to 62, wherein the oligomeric compound is a single-chain oligomeric compound.

[0256] Implementation Scheme 64. An oligomeric compound as described in any one of Implementation Schemes 1 to 63, wherein the modified oligonucleotide of the oligomeric compound is a salt, and wherein the salt is a sodium salt or a potassium salt.

[0257] Implementation Scheme 65. An oligomeric compound as described in any one of Implementation Schemes 1 to 64, comprising modified oligonucleotides.

[0258] Implementation Scheme 66. An oligomeric compound as described in any one of Implementation Schemes 1 to 62, wherein the modified oligonucleotide is an RNAi compound.

[0259] Implementation Scheme 67. The oligomeric compound as described in any one of Implementation Schemes 1 to 66, further comprising a conjugating group.

[0260] Implementation Scheme 68. The oligomeric compound of Implementation Scheme 67, wherein the conjugating group comprises a conjugating portion and a conjugating linker.

[0261] Implementation Scheme 69. An oligomeric compound as described in Implementation Scheme 68, wherein the conjugating group comprises a GalNAc cluster, the GalNAc cluster comprising 1-3 GalNAc ligands.

[0262] Implementation Scheme 70. The oligomeric compound as described in Implementation Scheme 68, wherein the conjugated linker is composed of a single bond.

[0263] Implementation Scheme 71. The oligomeric compound as described in Implementation Scheme 68, wherein the conjugation linker is cleavable.

[0264] Implementation Scheme 72. The oligomeric compound as described in Implementation Scheme 68, wherein the conjugated linker comprises one to three linker-nucleosides.

[0265] Implementation Scheme 73. An oligomeric compound as described in any one of Implementation Schemes 67 to 72, wherein the conjugating group is attached to the modified oligonucleotide at the 5'-end of the modified oligonucleotide.

[0266] Implementation Scheme 74. An oligomeric compound as described in any one of Implementation Schemes 67 to 72, wherein the conjugating group is attached to the modified oligonucleotide at the 3'-end of the modified oligonucleotide.

[0267] Implementation Scheme 75. The oligomeric compound as described in any one of Implementation Schemes 1 to 74, further comprising a terminal group.

[0268] Implementation Scheme 76. An oligomeric compound as described in any one of Implementation Schemes 1 to 71 or 73 to 75, wherein the oligomeric compound does not contain a linker-nucleoside.

[0269] Implementation Scheme 77. An oligonucleotide modified according to the following chemical structure:

[0270]

[0271] (SEQ ID NO: 2493) or its salt.

[0272] Implementation Scheme 78. The modified oligonucleotide as described in Implementation Scheme 77 is a sodium or potassium salt.

[0273] Implementation Scheme 79. An oligonucleotide modified according to the following chemical structure:

[0274]

[0275] (SEQ ID NO: 2493).

[0276] Implementation Scheme 80. An oligonucleotide modified according to the following chemical structure:

[0277]

[0278] (SEQ ID NO: 2514) or its salt.

[0279] Implementation Scheme 81. The modified oligonucleotide as described in Implementation Scheme 80, which is a sodium or potassium salt.

[0280] Implementation Scheme 82. An oligonucleotide modified according to the following chemical structure:

[0281]

[0282] (SEQ ID NO: 2514).

[0283] Implementation Scheme 83. An oligonucleotide modified according to the following chemical structure:

[0284]

[0285] (SEQ ID NO: 2510) or its salt.

[0286] Implementation Scheme 84. The modified oligonucleotide as described in Implementation Scheme 83, which is a sodium or potassium salt.

[0287] Implementation Scheme 85. An oligonucleotide modified according to the following chemical structure:

[0288]

[0289] (SEQ ID NO: 2510).

[0290] Implementation Scheme 86. An oligonucleotide modified according to the following chemical structure:

[0291]

[0292] (SEQ ID NO: 2487) or its salt.

[0293] Implementation Scheme 87. The modified oligonucleotide as described in Implementation Scheme 86, which is a sodium or potassium salt.

[0294] Implementation Scheme 88. An oligonucleotide modified according to the following chemical structure:

[0295]

[0296] (SEQ ID NO: 2487).

[0297] Implementation Scheme 89. An oligonucleotide modified according to the following chemical structure:

[0298]

[0299] (SEQ ID NO: 2493) or its salt.

[0300] Implementation scheme 90. The modified oligonucleotide as described in implementation scheme 89, which is a sodium or potassium salt.

[0301] Implementation Scheme 91. An oligonucleotide modified according to the following chemical structure:

[0302]

[0303] (SEQ ID NO: 2493).

[0304] Implementation Scheme 92. An oligonucleotide modified according to the following chemical structure:

[0305]

[0306] (SEQ ID NO: 2534) or its salt.

[0307] Implementation scheme 93. The modified oligonucleotide as described in implementation scheme 92, which is a sodium or potassium salt.

[0308] Implementation Scheme 94. An oligonucleotide modified according to the following chemical structure:

[0309]

[0310] (SEQ ID NO: 2534).

[0311] Implementation Scheme 95. An oligomeric compound as described in any one of Schemes 1 to 76 or a chiral enrichment cluster of a modified oligonucleotide as described in any one of Schemes 77 to 94, wherein the enrichment cluster comprises at least one modified oligonucleotide having a specific thiophosphate nucleoside bond with a specific stereochemical configuration.

[0312] Implementation Scheme 96. The chiral enrichment cluster as described in Implementation Scheme 95, wherein the enrichment cluster comprises at least one oligonucleotide modified with a specific thiophosphate nucleoside internucleotide bond having a (Sp) configuration.

[0313] Implementation Scheme 97. The chiral enrichment cluster as described in Implementation Scheme 95, wherein the enrichment comprises at least one oligonucleotide modified with a specific thiophosphate nucleoside internucleotide bond having an (Rp) configuration.

[0314] Implementation Scheme 98. The chiral enriched clusters as described in Implementation Scheme 95, wherein the clusters are enriched in oligonucleotides modified with specific, independently selected stereochemical configurations at each thiophosphate nucleoside internucleotide bond.

[0315] Implementation Scheme 99. The chiral enriched clusters as described in Implementation Scheme 98, wherein the clusters are enriched in oligonucleotides modified with a (Sp) configuration at each thiophosphate nucleoside internucleotide bond or oligonucleotides modified with a (Rp) configuration at each thiophosphate nucleoside internucleotide bond.

[0316] Implementation Scheme 100. A chiral enriched cluster as described in Implementation Scheme 98, wherein the cluster is enriched in modified oligonucleotides having an (Rp) configuration at a specific thiophosphate nucleoside inter-bond and an (Sp) configuration at each of the remaining thiophosphate nucleoside inter-bonds.

[0317] Implementation Scheme 101. The chiral enriched clusters as described in Implementation Scheme 98, wherein the clusters are enriched in oligonucleotides modified with at least three consecutive phosphate-thioester nucleoside internucleotide bonds in the 5' to 3' directions in the Sp, Sp, and Rp configurations.

[0318] Implementation Scheme 102. A group of oligomeric compounds as described in any one of Implementation Schemes 1 to 76 or modified oligonucleotides as described in any one of Implementation Schemes 77 to 94, wherein all phosphate thioester nucleoside bonds of said modified oligonucleotides are stereorandom.

[0319] Implementation Scheme 103. An oligomeric duplex comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is an oligomeric compound as described in any one of Implementation Schemes 1-76.

[0320] Implementation Scheme 104. The oligoduplex as described in Implementation Scheme 103, wherein the second oligomer compound comprises a second modified oligonucleotide consisting of 8 to 80 linked nucleosides, and wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleosides that is at least 90% complementary to the isolength portion of the first modified oligonucleotide.

[0321] Implementation Scheme 105. An antisense reagent comprising an antisense compound, wherein the antisense compound is an oligomeric compound as described in any one of Implementation Schemes 1-76 or a modified oligonucleotide as described in any one of Implementation Schemes 77-94.

[0322] Implementation Scheme 106. The antisense reagent as described in Implementation Scheme 103, wherein the antisense reagent is an oligomeric duplex as described in Implementation Scheme 103 or Implementation Scheme 104.

[0323] Implementation Scheme 107. The antisense reagent as described in Implementation Scheme 105 or Implementation Scheme 106, wherein the antisense reagent is:

[0324] i. RNase H reagents that can reduce the amount of SCN2A nucleic acid by activating RNase H; or

[0325] ii. An RNAi reagent that can reduce the amount of SCN2A nucleic acid by activating RISC / Ago2.

[0326] Implementation Scheme 108. A pharmaceutical composition comprising an oligomeric compound as described in any one of Implementation Schemes 1 to 76, a modified oligonucleotide as described in any one of Implementation Schemes 77 to 94, a group as described in any one of Implementation Schemes 95 to 102, an oligomeric duplex as described in Implementation Scheme 103 or Implementation Scheme 104, or an antisense agent as described in any one of Implementation Schemes 105 to 107, and a pharmaceutically acceptable diluent or carrier.

[0327] Implementation Scheme 109. The pharmaceutical composition of Implementation Scheme 108, comprising a pharmaceutically acceptable diluent, wherein said pharmaceutically acceptable diluent is artificial CSF (aCSF) or phosphate-buffered saline (PBS).

[0328] Implementation Scheme 110. The pharmaceutical composition of Implementation Scheme 109, wherein the pharmaceutical composition comprises substantially the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex or the antisense agent, and aCSF.

[0329] Implementation Scheme 111. The pharmaceutical composition of Implementation Scheme 109, wherein the pharmaceutical composition comprises substantially the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex or the antisense agent and PBS.

[0330] Implementation Scheme 112. A pharmaceutical composition comprising a modified oligonucleotide as described in any one of Implementation Schemes 77-94 and a pharmaceutically acceptable diluent.

[0331] Implementation Scheme 113. The pharmaceutical composition as described in Implementation Scheme 112, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate-buffered saline (PBS).

[0332] Implementation Scheme 114. The pharmaceutical composition as described in Implementation Scheme 113, wherein the pharmaceutical composition consists essentially of modified oligonucleotides and aCSF.

[0333] Implementation Scheme 115. The pharmaceutical composition as described in Implementation Scheme 113, wherein the pharmaceutical composition consists essentially of modified oligonucleotides and PBS.

[0334] Implementation Scheme 116. A method comprising administering to a subject an oligomeric compound as described in any one of Implementation Schemes 1 to 76, a modified oligonucleotide as described in any one of Implementation Schemes 77 to 94, a group as described in any one of Implementation Schemes 95 to 102, an oligomeric duplex as described in Implementation Scheme 103 or 104, an antisense agent as described in any one of Implementation Schemes 105 to 107, or a pharmaceutical composition as described in any one of Implementation Schemes 108 to 115.

[0335] Implementation Scheme 117. A method for treating a disease or disorder associated with a voltage-gated sodium channel protein, the method comprising administering to a subject suffering from or at risk of developing a disease or disorder associated with a voltage-gated sodium channel protein, or an oligomeric compound as described in any one of Implementation Schemes 1 to 76, a modified oligonucleotide as described in any one of Implementation Schemes 77 to 94, a group as described in any one of Implementation Schemes 95 to 102, an oligomeric duplex as described in Implementation Scheme 103 or 104, an antisense agent as described in any one of Implementation Schemes 105 to 107, or a pharmaceutical composition as described in any one of Implementation Schemes 108 to 115, thereby treating a disease or disorder associated with a voltage-gated sodium channel protein.

[0336] Implementation Scheme 118. A method for reducing the amount of SCN2A protein in the CSF of a subject suffering from or at risk of developing a voltage-gated sodium channel protein-related disease or disorder, by treating an effective amount of an oligomeric compound as described in any one of Implementation Schemes 1 to 76, a modified oligonucleotide as described in any one of Implementation Schemes 77 to 94, a population as described in any one of Implementation Schemes 95 to 102, an oligomeric duplex as described in Implementation Scheme 103 or 104, an antisense agent as described in any one of Implementation Schemes 105 to 107, or a pharmaceutical composition as described in any one of Implementation Schemes 108 to 115, thereby reducing the amount of SCN2A protein in the CSF.

[0337] Implementation Scheme 119. The method as described in Implementation Scheme 117 or Implementation Scheme 118, wherein the disease or disorder is a neurodevelopmental disorder.

[0338] Implementation scheme 120. The method as described in implementation scheme 117 or implementation scheme 118, wherein the disease or disorder is associated with SCN1A or SCN2A.

[0339] Implementation Scheme 121. A method for treating an SCN2A-related disease or disorder, the method comprising administering to a subject suffering from or at risk of developing an SCN2A-related disease or disorder a therapeutically effective amount of an oligomeric compound as described in any one of Implementation Schemes 1 to 76, a modified oligonucleotide as described in any one of Implementation Schemes 77 to 94, a group as described in any one of Implementation Schemes 95 to 102, an oligomeric duplex as described in any one of Implementation Schemes 103 or 104, an antisense agent as described in any one of Implementation Schemes 105 to 107, or a pharmaceutical composition as described in any one of Implementation Schemes 108 to 115, thereby treating an SCN2A-related disease or disorder.

[0340] Implementation Scheme 122. The method as described in Implementation Scheme 121, wherein the disease or disorder associated with SCN2A is developmental and epileptic encephalopathy, intellectual disability, or autism spectrum disorder.

[0341] Implementation Scheme 123. The method as described in Implementation Scheme 122, wherein the developmental and epileptic encephalopathy is any one of early-onset epileptic encephalopathy (EE), late-onset epileptic encephalopathy, or benign familial neonatal-infant epilepsy.

[0342] Implementation Scheme 124. The method as described in Implementation Scheme 121, wherein the disease or disorder associated with SCN2A is any one of Ōtahara syndrome, epilepsy with infantile migratory focal seizures, West syndrome, Lennon-Gastaut syndrome; Dravet syndrome; idiopathic / diffuse generalized epilepsy, temporal lobe epilepsy, myoclonic agnosia epilepsy, infantile migratory partial epilepsy, or familial hemiplegic migraine.

[0343] Implementation Scheme 125. The method of any one of Implementation Schemes 118 to 120, wherein the disease or disorder is associated with SCN1A.

[0344] Implementation scheme 126. The method as described in implementation scheme 125, wherein the disease or disorder associated with SCN1A is a developmental and epileptic encephalopathy.

[0345] Implementation scheme 127. The method as described in implementation scheme 125 or implementation scheme 126, wherein the developmental and epileptic encephalopathy is Dravet syndrome.

[0346] Implementation Scheme 128. The method as described in Implementation Scheme 126 or Implementation Scheme 127, wherein the developmental and epileptic encephalopathy is any one of Ōtahara syndrome, epilepsy with migratory focal seizures in infants, West syndrome, Lennon-Gastaut syndrome; Dravet syndrome; idiopathic / diffuse generalized epilepsy, temporal lobe epilepsy, myoclonic agnosia epilepsy, migratory partial epilepsy in infants, or familial hemiplegic migraine.

[0347] Implementation Scheme 129. The method of any one of Implementation Schemes 117 to 128, wherein at least one symptom or sign of the disease or disorder is improved.

[0348] Implementation scheme 130. The method as described in implementation scheme 129, wherein the symptom or sign is an epileptic seizure.

[0349] Implementation Scheme 131. The method of any one of Implementation Scheme 130, wherein the epileptic seizure is any one of focal, clonic, tonic, generalized tonic and clonic, convulsive, myoclonic, absence, or lethargic states.

[0350] Implementation Scheme 132. The method as described in Implementation Scheme 130, wherein the epileptic seizure is any one of focal, clonic, tonic, or generalized tonic seizures.

[0351] Implementation Scheme 133. The method as described in Implementation Scheme 129, wherein the symptom or sign is any one of epileptic seizures, hypotonia, sensory integration dysfunction, motor dysfunction, intellectual and cognitive dysfunction, motor and balance dysfunction, visual dysfunction, language and speech delay, gastrointestinal disorder, neurodevelopmental delay, or sudden unexpected death in epilepsy.

[0352] Implementation Scheme 134. The method as described in Implementation Scheme 129, wherein the symptom or sign is any one of delayed motor development, delayed social and language development, repetitive movements, uncoordinated oral movements, gastrointestinal disorders, sleep problems, or seizures.

[0353] Implementation Scheme 135. The method of any one of Implementation Schemes 130 to 134, wherein the epileptic seizures are frequent or last for a long time.

[0354] Implementation Scheme 136. The method of any one of Implementation Schemes 116 to 135, wherein the administration of the modified oligonucleotide reduces seizures, sensory integration dysfunction, motor dysfunction, intellectual and cognitive dysfunction, motor and balance dysfunction, visual dysfunction, language and speech delay, gastrointestinal disorders, neurodevelopmental delay, motor developmental delay, social developmental delay, repetitive movements, uncoordinated oral movements or sleep problems, or delays death in the subject.

[0355] Implementation Scheme 137. The method of any one of Implementation Schemes 116 to 136, wherein the oligomeric compound, the modified oligonucleotide, the population, the oligoduplex, the antisense agent, or the pharmaceutical composition is administered to the central nervous system or systemically.

[0356] Implementation Scheme 138. The method of any one of Implementation Schemes 116 to 136, wherein the oligomeric compound, the modified oligonucleotide, the population, the oligoduplex, the antisense agent, or the pharmaceutical composition is administered to the central nervous system and systemically.

[0357] Implementation Scheme 139. The method of any one of Implementation Schemes 111 to 131, wherein the oligomeric compound, the modified oligonucleotide, the population, the oligoduplex, the antisense agent, or the pharmaceutical composition is administered via any of the intrathecal, systemic, subcutaneous, or intramuscular routes.

[0358] Implementation scheme 140. The method of any one of implementation schemes 116 to 139, wherein the subject is a human.

[0359] Implementation Scheme 141. A method for reducing the amount of SCN2A RNA in cells, the method comprising contacting cells with an oligomeric compound as described in any one of embodiments 1 to 76, a modified oligonucleotide as described in any one of embodiments 77 to 94, a population as described in any one of embodiments 95 to 102, an oligomeric duplex as described in embodiments 103 or 104, an antisense agent as described in any one of embodiments 105 to 107, or a pharmaceutical composition as described in any one of embodiments 108 to 115, thereby reducing the amount of SCN2A RNA in cells.

[0360] Implementation Scheme 142. A method for reducing the amount of SCN2A protein in cells, the method comprising contacting cells with an oligomeric compound as described in any one of embodiments 1 to 76, a modified oligonucleotide as described in any one of embodiments 77 to 94, a population as described in any one of embodiments 95 to 102, an oligomeric duplex as described in embodiments 103 or 104, an antisense agent as described in any one of embodiments 105 to 107, or a pharmaceutical composition as described in any one of embodiments 108 to 115, thereby reducing the amount of SCN2A protein in cells.

[0361] Implementation Scheme 143. The method as described in Implementation Scheme 141 or Implementation Scheme 142, wherein the cells are cortical cells, hippocampal cells or spinal cord cells.

[0362] Implementation Scheme 144. The method of any one of Implementation Schemes 141 to 143, wherein the cells are in an animal.

[0363] Implementation Scheme 145. The method of any one of Implementation Schemes 141 to 144, wherein the cell is a human cell.

[0364] Implementation Scheme 146. Use of an oligomeric compound as described in any one of Implementation Schemes 1 to 76, a modified oligonucleotide as described in any one of Implementation Schemes 77 to 94, a group as described in any one of Implementation Schemes 95 to 102, an oligomeric duplex as described in Implementation Scheme 103 or Implementation Scheme 104, an antisense agent as described in any one of Implementation Schemes 105 to 107, or a pharmaceutical composition as described in any one of Implementation Schemes 108 to 115 for reducing SCN2A expression in cells.

[0365] Implementation Scheme 147. Use as described in Implementation Scheme 146, wherein the level of SCN2A RNA in the cells is reduced.

[0366] Implementation Scheme 148. Use as described in Implementation Scheme 146 or Implementation Scheme 147, wherein the level of SCN2A protein in the cells is reduced.

[0367] Implementation Scheme 149. The use as described in any one of Implementation Schemes 146 to 148, wherein the cell is a cortical cell, hippocampal cell, or spinal cord cell.

[0368] I. certain oligonucleotides

[0369] In some embodiments, this document provides oligomeric compounds comprising oligonucleotides, which are composed of linked nucleosides. The oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. Modified oligonucleotides, relative to unmodified RNA or DNA, contain at least one modification. That is, modified oligonucleotides contain at least one modified nucleoside (comprising a modified sugar moiety and / or modified nucleobases) and / or at least one modified internucleotide bond.

[0370] A. certain modified nucleosides

[0371] Modified nucleosides contain either a modified sugar moiety or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase.

[0372] 1. Some sugar portions

[0373] In some embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In some embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In some embodiments, the modified sugar moiety is a sugar substitute. Such sugar substitutes may contain one or more substitutions corresponding to other types of modified sugar moiety substitutions.

[0374] In some embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety comprising a furanyl ring having one or more substituent groups, wherein none of the substituents bridges the two atoms of the furanyl ring to form a bicyclic structure. Such unbridged substituents can be at any position on the furanyl ring, including but not limited to substituents at the 2', 4', and / or 5' positions. In some embodiments, one or more unbridged substituents of the non-bicyclic modified sugar moiety are branched. Examples of suitable 2'-substituent groups for the non-bicyclic modified sugar moiety include, but are not limited to, 2'-F, 2′-OCH3 (“OMe” or “O-methyl”), and 2′-O(CH2)2OCH3 (“MOE” or “O-methoxyethyl”). In some embodiments, the 2'-substituent group is selected from: halogen, allyl, amino, azide, SH, CN, OCN, CF3, OCF3, O-C1-C. 10 Alkoxy, O-C1-C 10 Substituted alkoxy groups, O-C1-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R) m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-Alkenyl, O-alkynyl, S-alkynyl, N(R m )-Alkyne, O-alkylene-O-alkyl, alkynyl, aryl, aralkyl, O-aryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m (R) n ) or OCH2C(=O)-N(R m (R) n ), where R m and R n Each is independently an H, an amino protecting group, or a substituted or unsubstituted C1-C. 10Alkyl and 2'-substituted groups, as described in Cook et al., US6,531,584; Cook et al., US5,859,221; and Cook et al., US6,005,087. Certain embodiments of these 2'-substituted groups may be further substituted by one or more substituents independently selected from: hydroxyl, amino, alkoxy, carboxyl, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of 4'-substituted groups suitable for non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128. Examples of 5'-substituted groups suitable for non-bicyclic modified sugar moieties include, but are not limited to: 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In some embodiments, the non-bicyclic modified sugar moiety comprises more than one non-bridging sugar substituent, such as a 2'-F-5'-methyl sugar moiety and a modified sugar moiety and a modified nucleoside, as described in Migawa et al. WO 2008 / 101157 and Rajeev et al. US2013 / 0203836.

[0375] In some embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety containing a non-bridging 2'-substituent group selected from the following: F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(R) m (R) n O(CH2)2O(CH2)2N(CH3)2 and N-substituted acetamides (OCH2C(=O)-N(R) m (R) n )), where R m and R n Each is independently an H, an amino protecting group, or a substituted or unsubstituted C1-C. 10 alkyl.

[0376] In some embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety containing a non-bridging 2'-substituent group selected from the following: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 (“NMA”).

[0377] In some embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety containing a non-bridging 2'-substituent group selected from the following: F, OCH3, and OCH2CH2OCH3.

[0378] In some embodiments, the modified furanyl sugar moiety and the nucleoside incorporated into such a modified furanyl sugar moiety are further defined by isomerism. For example, in addition to the naturally occurring β-D-deoxyribosyl configuration, the 2'-deoxyfuranyl sugar moiety can have seven isomerisms. Such modified sugar moieties are described, for example, in WO 2019 / 157531, which is incorporated herein by reference. The 2'-modified sugar moiety has an additional stereocenter at the 2'-position relative to the 2'-deoxyfuranyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible isomerisms. Unless otherwise stated, the 2'-modified sugar moiety described herein is the β-D-ribosyl isomerism.

[0379] Certain modified sugar moieties contain substituents bridging two atoms of the furanyl ring to form a second ring, resulting in a bicyclic sugar moiety. Nucleosides containing such bicyclic sugar moieties are called bicyclic nucleosides (BNAs), locked nucleosides, or conformation-restricted nucleotides (CRNs). Certain such compounds are described in U.S. Patent Publication No. 2013 / 0190383 and PCT Publication WO 2013 / 036868. In some such embodiments, the bicyclic sugar moieties contain bridges between the 4' and 2' furanyl ring atoms. In some such embodiments, the furanyl ring is a ribose ring. Examples of such 4' to 2' bridging sugar substituents include, but are not limited to: 4′-CH2-2′, 4′-(CH2)2-2′, 4′-(CH2)3-2′, 4′-CH2-O-2′ (“LNA”), 4′-CH2-S-2′, 4′-(CH2)2-O-2′ (“ENA”), 4′-CH(CH3)-O-2′ (referred to as “restricted ethyl” or “cEt” when in the S configuration), 4′-CH2-O-CH2-2′, 4′-CH2-N(R)-2′, 4′-CH(CH2OCH3)-O-2′ (“restricted MOE” or “cMOE”) and their analogues (see, for example, Seth et al., US7,399,845, Bhat et al., US7,569,686, Swayze et al., US7,741,457 and Swayze et al.). Human, US8,022,193), 4′-C(CH3)(CH3)-O-2′ and its analogues (see, for example, Seth et al., US8,278,283), 4′-CH2-N(OCH3)-2′ and its analogues (see, for example, Prakash et al., US8,278,425), 4′-CH2-ON(CH3)-2′ (see, for example, Allenson et al., US7,696,345 and Allenson et al., US8,124,745), 4′-CH2-C(H)(CH3)-2 (see, for example, Zhou et al., J. Org. Chem., 2009, 74, 118-134), 4′-CH2-C(=CH2)-2′ and its analogues (see, for example, Seth et al., US8,278,426), 4′-C(R a R b )-N(R)-O-2'、4'-C(R a R b )-ON(R)-2', 4′-CH2-ON(R)-2′ and 4′-CH2-N(R)-O-2′, where R, R a and R b Each is independently an H, a protecting group, or a C1-C group. 12Alkyl groups (see, for example, Imanishi et al., US7,427,672). In some embodiments, such 4' to 2' bridges independently comprise 1 to 4 linking groups independently selected from: -[C(R a (R) b )] n -、-[C(R a (R) b )] n -O-、-C(R a )=C(R b )-、-C(R a ) = N-、-C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-、-S(=O) x -and-N(R) a )-;

[0380] in:

[0381] x is 0, 1, or 2;

[0382] n is 1, 2, 3 or 4;

[0383] R a and R b Each of the following is independent: H, protecting group, hydroxyl group, C1-C. 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 alkenyl, C2-C 12 Alkyne group, substituted C2-C 12 alkynyl group, C5-C 20 Aryl, substituted C5-C 20 Aryl, heterocyclic group, substituted heterocyclic group, heteroaryl, substituted heteroaryl, C5-C7 alicyclic group, substituted C5-C7 alicyclic group, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or thionyl (S(=O)-J1); and

[0384] J1 and J2 are independent of H and C1-C respectively. 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 alkenyl, C2-C 12 Alkyne group, substituted C2-C 12 alkynyl group, C5-C 20Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic group, substituted heterocyclic group, C1-C 12 Aminoalkyl, substituted C1-C 12 Aminoalkyl groups, or protecting groups.

[0385] The other bicyclic sugar moiety is known in the art; see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443; Albaek et al., J. Org. Chem., 2006, 71, 7731-7740; Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahllestedt et al., Proc. Natl. Acad. S Ci. USA, 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379; Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; Wengel et al., US7,053,207; Imanishi et al., US6,268,490; Imanishi et al., US6,770,748; Imanishi et al., USRE44,779; Wengel et al., US6,794,499; Wengel et al., US6,670,461; Wengel et al., US7,034,133; Wengel et al., US8,080,644; Wengel et al., US8,034,909; Wengel et al., US8,153,365; Wengel et al., US7,572,582; and Ramasamy et al., US6,525,191; Torsten et al., WO2004 / 106356; Wengel et al., WO 1999 / 014226; Seth et al., WO 2007 / 134181; Seth et al., US7,547,684; Seth et al., US7,666,854; Seth et al., US8,088,746; Seth et al., US7,750,131; Seth et al., US8,030,467; Seth et al., US8,268,980; Seth et al., USUS 8,546,556; Seth et al., US 8,530,640; Migawa et al., US 9,012,421; Seth et al., US 8,501,805; Allenson et al., US 2008 / 0039618; and Migawa et al., US 2015 / 0191727.

[0386] In some embodiments, the bicyclic sugar moiety and the nucleotide incorporated into such a bicyclic sugar moiety are further defined by isomer configuration. For example, the LNA nucleotide (described herein) can be either the α-L configuration or the β-D configuration.

[0387]

[0388] α-L-methyleneoxy(4'-CH2-O-2') or α-L-LNA bicyclic nucleotides have been incorporated into oligonucleotides exhibiting antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In this document, the general description of bicyclic nucleotides includes two isomer configurations. When the position of a particular bicyclic nucleotide (e.g., LNA or cEt) is identified in the exemplary embodiments herein, they are in the β-D configuration unless otherwise stated.

[0389] In some embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (e.g., 5'-substituted and 4'-2' bridging sugars).

[0390] In some embodiments, the modified sugar moiety is a sugar substitute. In some such embodiments, the oxygen atom of the sugar moiety is replaced by, for example, a sulfur, carbon, or nitrogen atom. In some such embodiments, the modified sugar moiety also contains bridging and / or non-bridging substituents as described herein. For example, some sugar substitutes contain a 4'-sulfur atom and substitutions at the 2'-position (see, for example, Bhat et al., US7,875,733 and Bhat et al., US7,939,677) and / or the 5'-position.

[0391] In some embodiments, the sugar substitute comprises a ring having atoms other than five atoms. For example, in some embodiments, the sugar substitute comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), mannitol nucleic acid (“MNA”) (see, for example, Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA:

[0392]

[0393] (“F-HNA”, see, for example, Swayze et al., US8,088,904; Swayze et al., US8,440,803; Swayze et al., US8,796,437; and Swayze et al., US9,005,906; F-HNA may also be referred to as F-THP or 3'-fluorotetrahydropyran), and nucleosides comprising THP compounds with further modifications having the following formula:

[0394]

[0395] Specifically, for each modified THP nucleotide:

[0396] Bx is the nucleobase portion;

[0397] T3 and T4 are each independently an inter-nucleoside linker group that links the modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an inter-nucleoside linker group that links the modified THP nucleoside to the remainder of the oligonucleotide, and the other of T3 and T4 is an H, a hydroxyl protecting group, a linked conjugate group, or a 5′ or 3′ terminal group.

[0398] q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 ynyl, or substituted C2-C6 ynyl; and

[0399] R1 and R2 are each independently selected from: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2 and CN, wherein X is O, S or NJ1, and J1, J2 and J3 are each independently H or C1-C6 alkyl.

[0400] In some embodiments, a modified THP nucleoside is provided, wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In some embodiments, q1, q2, q3, q4, q5, q6, and q7 are not H. In some embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In some embodiments, a modified THP nucleoside is provided, wherein one of R1 and R2 is F. In some embodiments, R1 is F and R2 is H; in some embodiments, R1 is methoxy and R2 is H; and in some embodiments, R1 is methoxyethoxy and R2 is H.

[0401] In some embodiments, the sugar substitute comprises a ring having more than five atoms and more than one heteroatom. For example, nucleosides comprising a morpholine sugar moiety and their use in oligonucleotides have been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., US5,698,685; Summerton et al., US5,166,315; Summerton et al., US5,185,444; and Summerton et al., US5,034,506). As used herein, the term "morpholine" refers to a sugar substitute having the following structure:

[0402]

[0403] In some embodiments, the morpholino group can be modified, for example by adding or altering various substituent groups in the morpholino structure described above. Such sugar substitutes are referred to herein as "modified morpholino".

[0404] In some embodiments, the sugar substitute comprises an acyclic moiety. Examples of nucleosides and oligonucleotides comprising such acyclic sugar substitutes include, but are not limited to, peptide nucleic acids (“PNA”), acyclic butyl nucleic acids (see, for example, Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in WO2011 / 133876 by Manoharan et al.

[0405] Many other bicyclic and tricyclic sugars and sugar substitution ring systems are known in the art and can be used to modify nucleosides.

[0406] 2. certain modified nucleobases

[0407] In some embodiments, the modified oligonucleotide comprises one or more nucleosides containing unmodified nucleosides. In some embodiments, the modified oligonucleotide comprises one or more nucleosides containing modified nucleosides. In some embodiments, the modified oligonucleotide comprises one or more nucleosides that do not contain nucleosides, referred to as debased nucleosides.

[0408] In some embodiments, the modified nucleobase is selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6-substituted purines. In some embodiments, the modified nucleobase is selected from: 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymidine and 2-thiocytosine, 5-propynyl(-C≡C-CH3)uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymidine, 5-ribonyluracil (pseudouracil), 4-thiouracil, 8-halogenated, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy, 8-aza, and others. It includes 8-substituted purines, 5-halogenated (especially 5-bromo, 5-trifluoromethyl, 5-halogenuridine, and 5-halogencytosine), 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deadenine, 7-deadenine, 3-deadenine, 3-deadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluridine, 5-methyl4-N-benzoylcytosine, 5-methyl4-N-benzoyluridine, universal bases, hydrophobic bases, hybrid bases, amplified bases, and fluorinated bases. Further modifications to the nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenthiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is substituted with other heterocycles, such as 7-deadenine, 7-deadenine, 2-aminopyridine, and 2-pyridone.Other nucleobases include those disclosed in Merigan et al., US 3,687,808; those disclosed in The Concise Encyclopedia of Polymer Science and Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, YS, Chapter 15 of Antisense Research and Applications, Crooke, ST and Lebleu, B. eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15 of Antisense Drug Technology, Crooke ST ed., CRC Press, 2008, pp. 163-166 and 442-443.

[0409] Publications teaching the preparation of certain of the above-described modified nucleosides and other modified nucleosides include, but are not limited to, Manoharan et al., US2003 / 0158403; Manoharan et al., US2003 / 0175906; Dinh et al., US4,845,205; Spielvogel et al., US5,130,302; Rogers et al., US5,134,066; Bischofberger et al., US5,175. 273; Urdea et al., US5,367,066; Benner et al., US5,432,272; Matteucci et al., US5,434,257; Gmeiner et al., US5,457,187; Cook et al., US5,459,255; Froehler et al., US5,484,908; Matteucci et al., US5,502,177; Hawkins et al., US5,525,711 Haralambidis et al., US5,552,540; Cook et al., US5,587,469; Froehler et al., US5,594,121; Switcher et al., US5,596,091; Cook et al., US5,614,617; Froehler et al., US5,645,985; Cook et al., US5,681,941; Cook et al., US5,811,534; Cook et al. US5,750,692; Cook et al., US5,948,903; Cook et al., US5,587,470; Cook et al., US5,457,191; Matteucci et al., US5,763,588; Froehler et al., US5,830,653; Cook et al., US5,808,027; Cook et al., US6,166,199; and Matteucci et al., US6,005,096.

[0410] 3. certain modified nucleoside bonds

[0411] In some embodiments, the nucleosides of the modified oligonucleotides can be linked together using any internucleotide bond. Two main classes of internucleotide linkers are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleotide bonds include, but are not limited to, phosphodiesters containing a phosphodiester bond (“P(O2)=O”) (also known as an unmodified or naturally occurring bond), phosphotriesters, methylphosphonates, aminophosphates, thiophosphates (“P(O2)=S”), and dithiophosphates (“HS-P=S”). Representative phosphorus-free internucleotide linkers include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2), thiodiesters, thiocarbamates (-OC(=O)(NH)-S-); siloxanes (-O-SiH2-O-); and N,N′-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified nucleoside bonds can be used to alter, typically increase, the nuclease resistance of oligonucleotides compared to naturally occurring phosphodiester nucleoside bonds. In some embodiments, nucleoside bonds with chiral atoms can be prepared as racemic mixtures or as individual enantiomers. Methods for preparing phosphorus-containing and phosphorus-free nucleoside bonds are well known to those skilled in the art.

[0412] Representative internucleotide bonds with chiral centers include, but are not limited to, alkylphosphonates and thiophosphates. Modified oligonucleotides containing internucleotide bonds with chiral centers can be prepared as populations of modified oligonucleotides containing stereorandom internucleotide bonds, or populations of modified oligonucleotides containing thiophosphate internucleotide bonds with specific stereochemical configurations. In some embodiments, the population of modified oligonucleotides contains thiophosphate internucleotide bonds, wherein all thiophosphate internucleotide bonds are stereorandom. Such modified oligonucleotides can be produced using synthetic methods that result in the random selection of the stereochemical configuration of each thiophosphate internucleotide bond. However, as is well known to those skilled in the art, each individual thiophosphate of each individual oligonucleotide molecule has a defined stereochemical configuration. In some embodiments, the enrichment of the population of modified oligonucleotides occurs in modified oligonucleotides containing one or more specific thiophosphate internucleotide bonds with specific, independently selected stereochemical configurations. In some embodiments, the specific configuration of a specific thiophosphate internucleotide bond is present in at least 65% of the molecules in the population. In some embodiments, a specific configuration of a particular thiophosphate nucleoside bond is present in at least 70% of the molecules in the population. In some embodiments, a specific configuration of a particular thiophosphate nucleoside bond is present in at least 80% of the molecules in the population. In some embodiments, a specific configuration of a particular thiophosphate nucleoside bond is present in at least 90% of the molecules in the population. In some embodiments, a specific configuration of a particular thiophosphate nucleoside bond is present in at least 99% of the molecules in the population. Such chiral-rich clusters of modified oligonucleotides can be generated using synthetic methods known in the art, for example, those described in Oka et al., JACS 2003, 125, 8307, Wan et al., Nuc. Acid. Res., 2014, 42, 13456, and WO2017 / 015555. In some embodiments, the modified oligonucleotide population is enriched in modified oligonucleotides having at least one indicative thiophosphate in the (Sp) configuration. In some embodiments, the modified oligonucleotide population is enriched in modified oligonucleotides having at least one phosphate thioester in the (Rp) configuration. In some embodiments, the modified oligonucleotides comprising (Rp) and / or (Sp) phosphate thioesters each comprise one or more of the following formula, where "B" represents a nucleobase:

[0413]

[0414] Unless otherwise stated, the chiral nucleoside bonds of the modified oligonucleotides described herein may be stereorandom or have a specific stereochemical configuration.

[0415] Neutral nucleoside interbonds include, but are not limited to, phosphate triesters, methylphosphonates, MMI (3′-CH2-N(CH3)-O-5′), amide-3 (3′-CH2-C(=O)-N(H)-5′), amide-4 (3′-CH2-N(H)-C(=O)-5′), methyl acetal (3′-O-CH2-O-5′), methoxypropyl (MOP), and thiomethyl acetal (3′-S-CH2-O-5′). Other neutral nucleoside interbonds include nonionic bonds comprising siloxanes (dialkylsiloxanes), carboxylic esters, carboxamides, sulfides, sulfonates, and amides (see, for example: Carbohydrate Modifications in Antisense Research; edited by YSSanghvi and PDCook, ACS Symposium Series 580; Chapters 3 and 4, Chapters 40–65). Other neutral nucleoside interbonds include nonionic bonds comprising a mixture of N, O, S, and CH2 components.

[0416] B. certain motifs

[0417] In some embodiments, the modified oligonucleotide comprises one or more modified nucleosides comprising a modified sugar moiety. In some embodiments, the modified oligonucleotide comprises one or more modified nucleosides comprising a modified nucleotide. In some embodiments, the modified oligonucleotide comprises one or more modified internucleotide bonds. In such embodiments, the modified, unmodified, and differently modified sugar moiety, nucleotide, and / or internucleotide bonds of the modified oligonucleotide define a pattern or motif. In some embodiments, the patterns of the sugar moiety, nucleotide, and internucleotide bonds are independent of each other. Therefore, the modified oligonucleotide can be described by its sugar motif, nucleotide motif, and / or internucleotide bond motif (as used herein, the nucleotide motif describes modifications of the nucleotides independent of the nucleotide sequence).

[0418] 1. certain glycosylations

[0419] In some embodiments, the oligonucleotide comprises one or more types of modified sugars and / or unmodified sugar motifs arranged in a defined pattern or glycomotif along the oligonucleotide or a portion thereof. In some cases, such glycomotifs include, but are not limited to, any sugar modifications discussed herein.

[0420] In some embodiments, the modified oligonucleotide has a gapmer motif defined by two outer regions or "flanks" and a central or inner region or "gap". The three regions of the gapmer motif (5'-flank, gap, and 3'-flank) form a continuous sequence of nucleotides, wherein at least some sugar moieties of the nucleotides in each flanking flank differ from at least some sugar moieties of the nucleotides in the gap. Specifically, the sugar moieties of at least the nucleotides closest to the gap (the 3'-terminal nucleotide of the 5'-flank and the 5'-terminal nucleotide of the 3'-flank) differ from the sugar moieties of the adjacent gap nucleotide, thus defining the boundary between the flanking flank and the gap (i.e., flanking / gap connection). In some embodiments, the sugar moieties within the gap are identical to each other. In some embodiments, the gap comprises one or more nucleotides whose sugar moieties differ from the sugar moieties of one or more other nucleotides in the gap. In some embodiments, the sugar motifs of the two flanking flanks are identical to each other (symmetric gapmer). In some embodiments, the sugar motif of the 5'-flank differs from the sugar motif of the 3'-flank (asymmetric gapmer).

[0421] In some embodiments, the gapmer has 1 to 6 nucleotides on each flank. In some embodiments, each nucleotide on each flank of the gapmer contains a modified sugar moiety. In some embodiments, at least one nucleotide on each flank of the gapmer contains a modified sugar moiety. In some embodiments, at least two nucleotides on each flank of the gapmer contain a modified sugar moiety. In some embodiments, at least three nucleotides on each flank of the gapmer contain a modified sugar moiety. In some embodiments, at least four nucleotides on each flank of the gapmer contain a modified sugar moiety. In some embodiments, at least five nucleotides on each flank of the gapmer contain a modified sugar moiety.

[0422] In some embodiments, the gapmer contains 7-12 nucleotides. In some embodiments, each nucleotide in the gapmer contains a 2'-deoxyribosyl sugar moiety. In some embodiments, at least six nucleotides in the gapmer contain a 2'-β-D-deoxyribosyl sugar moiety. In some embodiments, each nucleotide in the gapmer contains a 2'-β-D-deoxyribosyl sugar moiety. In some embodiments, at least one nucleotide in the gapmer contains a modified sugar moiety. In some embodiments, at least one nucleotide in the gapmer contains a 2'-OMe sugar moiety.

[0423] In some embodiments, the gapmer is a deoxygapmer. In some embodiments, the nucleotide on the gap side of each flank / gap junction comprises a 2'-deoxyribosyl sugar moiety, and the nucleotide on the flank side of each flank / gap junction comprises a modified sugar moiety. In some embodiments, at least six nucleotides of the gap of the gapmer comprise a 2'-β-D-deoxyribosyl sugar moiety. In some embodiments, each nucleotide of the gap of the gap comprises a 2'-deoxyribosyl sugar moiety. In some embodiments, each nucleotide of each flank of the gapmer comprises a modified sugar moiety. In some embodiments, one nucleotide of the gap comprises a modified sugar moiety, and each remaining nucleotide of the gap comprises a 2'-deoxyribosyl sugar moiety.

[0424] In some embodiments, the modified oligonucleotide comprises or consists of a portion having a fully modified glycomolecular motif. In such embodiments, each nucleotide of the fully modified portion of the modified oligonucleotide comprises a modified glycomolecular motif. In some embodiments, each nucleotide of the entire modified oligonucleotide comprises a modified glycomolecular motif. In some embodiments, the modified oligonucleotide comprises or consists of a portion having a fully modified glycomolecular motif, wherein each nucleotide in the fully modified portion comprises the same modified glycomolecular motif, referred herein as a uniformly modified glycomolecular motif. In some embodiments, the fully modified oligonucleotide is a uniformly modified oligonucleotide. In some embodiments, each nucleotide of the uniformly modified oligonucleotide comprises the same 2'-modification.

[0425] In this paper, the lengths (number of nucleotides) of the three regions of a gapmer can be provided using the notation [number of nucleotides in the 5'-flank]-[number of nucleotides in the interstitial space]-[number of nucleotides in the 3'-flank]. Therefore, a 5-10-5 gapmer consists of 5 linked nucleotides in each flank and 10 linked nucleotides in the interstitial space. When this nomenclature is followed by a specific modification, that modification is in each sugar moiety of each flank, and the interstitial nucleotides contain the 2'-β-D-deoxyribosyl sugar moiety. Thus, a 5-10-5 MOE gapmer consists of 5 linked 2'-MOE nucleotides in the 5'-flank, 10 linked 2'-β-D-deoxyribosyl nucleotides in the interstitial space, and 5 linked 2'-MOE nucleotides in the 3'-flank. A 3-10-3 cEt gapmer consists of three linked cEt nucleotides in the 5'-flank, ten linked 2'-β-D-deoxynucleotides in the interstitial space, and three linked cEt nucleotides in the 3'-flank. A 5-8-5 gapmer consists of five linked nucleotides (containing modified sugar moieties) in the 5'-flank, eight linked 2'-β-D-deoxynucleotides in the interstitial space, and five linked nucleotides (containing modified sugar moieties) in the 3'-flank. Mixed flanking gapmers have at least two different modified sugar moieties in the 5'- and / or 3'-flanks. Mixed 5-8-5 or 5-8-4 flanking gapmers have at least two different modified sugar moieties in the 5'- and / or 3'-flanks.

[0426] In some embodiments, the modified oligonucleotide is a 5-10-5 MOE gapmer. In some embodiments, the modified oligonucleotide is a 4-10-6 MOE gapmer. In some embodiments, the modified oligonucleotide is a 6-10-4 MOE gapmer. In some embodiments, the modified oligonucleotide is a 4-8-6 MOE gapmer. In some embodiments, the modified oligonucleotide is a 6-8-4 MOE gapmer. In some embodiments, the modified oligonucleotide is a 5-8-5 MOE gapmer. In some embodiments, the modified oligonucleotide is an XYZ MOE gapmer, wherein X and Z are independently selected from 1, 2, 3, 4, 5, 6, or 7 linked 2'-MOE nucleosides, and Y is selected from 7, 8, 9, 10, or 11 linked deoxynucleosides.

[0427] In some embodiments, the modified oligonucleotide has the following glycomolecular motif (5' to 3'): eeeeeedyddddddddeeeee, eeeeeeddddddddddeeeee, eeeeeeddddddddddeeeeee, eeeeddddddddddeeeeee, eeeeeeddddddddeeeeee, eeeeeeddddddddeeeeee, or eeeeeeddddddddeeeee, where 'd' represents the 2'-deoxyribosyl sugar motif, 'e' represents the 2'-MOE sugar motif, and 'y' represents the 2'-OMe sugar motif.

[0428] 2. Some nucleobase sequences

[0429] In some embodiments, the oligonucleotide comprises modified and / or unmodified nucleobases arranged in a defined pattern or motif along the oligonucleotide or a portion thereof. In some embodiments, each nucleobase is modified. In some embodiments, no nucleobase is modified. In some embodiments, each purine or each pyrimidine is modified. In some embodiments, each adenine is modified. In some embodiments, each guanine is modified. In some embodiments, each thymine is modified. In some embodiments, each uracil is modified. In some embodiments, each cytosine is modified. In some embodiments, some or all of the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine. In some embodiments, all cytosine nucleobases are 5-methylcytosine, and all other nucleobases in the modified oligonucleotide are unmodified nucleobases.

[0430] In some embodiments, the modified oligonucleotide comprises a set of modified nucleobases. In some such embodiments, the block is located at the 3' end of the oligonucleotide. In some embodiments, the block is located within the three nucleosides at the 3' end of the oligonucleotide. In some embodiments, the block is located at the 5' end of the oligonucleotide. In some embodiments, the block is located within the three nucleosides at the 5' end of the oligonucleotide.

[0431] In some embodiments, the oligonucleotide having a gapmer motif comprises a nucleoside containing a modified nucleobase. In some such embodiments, a nucleoside containing a modified nucleobase is located in the interstitial space of the oligonucleotide having the gapmer motif. In some such embodiments, the sugar moiety of the nucleoside is a 2'-β-D-deoxyribosyl sugar motif. In some embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynylpyrimidine.

[0432] 3. certain nucleoside interbond motifs

[0433] In some embodiments, the oligonucleotide comprises modified and / or unmodified internucleotide links arranged in a defined pattern or motif along the oligonucleotide or a portion thereof. In some embodiments, each internucleotide linker is a phosphodiester internucleotide linker ((P=O). In some embodiments, each internucleotide linker of the modified oligonucleotide is a phosphate thioester internucleotide linker ((P=S). In some embodiments, each internucleotide linker of the modified oligonucleotide is independently selected from phosphate thioester internucleotide links and phosphodiester internucleotide links. In some embodiments, each phosphate thioester internucleotide linker is independently selected from stereorandom phosphate thioester, (Sp) phosphate thioester, and (Rp) phosphate thioester. In some embodiments, the glycosyl motif of the modified oligonucleotide is a gapmer, and all internucleotide links within the gap are modified. In some such embodiments, some or all of the internucleotide links in the flanks are unmodified phosphodiester links. Nucleoside internucleotides. In some embodiments, the terminal nucleoside internucleotides are modified. In some embodiments, the modified oligonucleotide has a gapmer glycosyl motif, and the nucleoside internucleotide motif contains at least one phosphodiester nucleoside internucleotide in at least one flanking position, wherein the at least one phosphodiester nucleoside internucleotide is not a terminal nucleoside internucleotide, and the remaining nucleoside internucleotides are phosphate thioses. In some such embodiments, all phosphate thioses are stereorandom. In some embodiments, all phosphate thioses in the flanking positions are (Sp) phosphate thioses, and the gap contains at least one Sp, Sp, Rp motif. In some embodiments, the population enrichment of modified oligonucleotides includes modified oligonucleotides with such nucleoside internucleotide motifs.

[0434] In some embodiments, the modified oligonucleotide has a nucleoside internucleotide motif (5' to 3') of soooossssssssssssssss, soooossssssssssssssss, soooossssssssssssss, soooosssssssssssss, or soooossssssssssss, where each "S" represents a phosphate thioester nucleoside internucleotide and each "o" represents a phosphate diester nucleoside internucleotide.

[0435] C. certain length

[0436] It is possible to increase or decrease the length of oligonucleotides without eliminating their activity. For example, Woolf et al. (Proc. Natl. Acad. Sci. USA 89: 7305-7309, 1992) tested the ability of a series of oligonucleotides of 13–25 nucleotides in length to induce target nucleic acid cleavage in an oocyte injection model. Oligonucleotides of 25 nucleotides with 8 or 11 mismatched bases near their ends were able to direct specific cleavage of the target nucleic acid, although to a lesser extent than oligonucleotides without mismatches. Similarly, target-specific cleavage was achieved using 13 nucleotide oligonucleotides, including those with 1 or 3 mismatches.

[0437] In some embodiments, the oligonucleotide (including modified oligonucleotide 1) can have any of a variety of length ranges. In some embodiments, the oligonucleotide consists of nucleosides linked from X to Y, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In some such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; the condition is that X ≤Y. For example, in some embodiments, the oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 2... 4, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 1 4 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24 1, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 Up to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 2817 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 1 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26 Composed of 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, or 29 to 30 linked nucleosides.

[0438] D. certain modified oligonucleotides

[0439] In some embodiments, the above modifications (sugars, nucleotides, internucleotide bonds) are integrated into the modified oligonucleotide. In some embodiments, the modified oligonucleotides are characterized by their modification motifs and total length. In some embodiments, such parameters are independent of each other. Therefore, unless otherwise stated, each internucleotide bond of an oligonucleotide having a gapmer sugar motif can be modified or unmodified, and can follow or not follow a sugar-modified gapmer modification pattern. For example, internucleotide bonds in the flanking regions of the sugar gapmer can be the same or different from each other, and can also be the same or different from the internucleotide bonds in the sugar motif interstitial regions. Similarly, such sugar gapmer oligonucleotides can contain one or more modified nucleotides independent of the sugar-modified gapmer pattern. Unless otherwise stated, all modifications are independent of the nucleotide sequence.

[0440] E. Certain modified oligonucleotide groups

[0441] A group of modified oligonucleotides having the same molecular formula can be a stereorandom group or a chiral enriched group. In a stereorandom group, all chiral centers of all modified oligonucleotides are stereorandom. In a chiral enriched group, at least one specific chiral center is not stereorandom in the modified oligonucleotides of the group. In some embodiments, the modified oligonucleotides of the chiral enriched group are enriched in the β-D-ribosyl sugar moiety, and all phosphate thioester nucleoside bonds are stereorandom. In some embodiments, the modified oligonucleotides of the chiral enriched group are enriched in the β-D-ribosyl sugar moiety and at least one specific phosphate thioester nucleoside bond in a specific stereochemical configuration.

[0442] F. Nucleobase sequence

[0443] In some embodiments, the oligonucleotide is further described by the nucleotide sequence of the oligonucleotide (unmodified or modified). In some embodiments, the oligonucleotide has a nucleotide sequence complementary to a second oligonucleotide or an identified reference nucleic acid (such as a target nucleic acid). In some such embodiments, a portion of the oligonucleotide has a nucleotide sequence complementary to a second oligonucleotide or an identified reference nucleic acid (such as a target nucleic acid). In some embodiments, a portion or the full length of the oligonucleotide's nucleotide sequence is complementary to the second oligonucleotide or nucleic acid (such as a target nucleic acid) by at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%.

[0444] II. Some oligomers

[0445] In some embodiments, this document provides oligomeric compounds comprising an oligonucleotide (modified or unmodified) and optionally one or more conjugating groups and / or terminal groups. A conjugating group consists of one or more conjugated moieties and a linker group that attaches the conjugated moieties to the oligonucleotide. The conjugating group may be attached to either end or both ends and / or any internal position of the oligonucleotide. In some embodiments, the conjugating group is attached to the 2'-position of the nucleoside of the modified oligonucleotide. In some embodiments, the conjugating group attached to either end or both ends of the oligonucleotide is a terminal group. In some such embodiments, the conjugating group or terminal group is attached to the 3' and / or 5' end of the oligonucleotide. In some such embodiments, the conjugating group (or terminal group) is attached to the 3' end of the oligonucleotide. In some embodiments, the conjugating group is attached near the 3' end of the oligonucleotide. In some embodiments, the conjugating group (or terminal group) is attached to the 5' end of the oligonucleotide. In some embodiments, the conjugating group is attached near the 5' end of the oligonucleotide.

[0446] Examples of terminal groups include, but are not limited to, conjugated groups, capped groups, phosphate moieties, protecting groups, debased nucleosides, modified or unmodified nucleosides, and two or more independently modified or unmodified nucleosides.

[0447] A. Certain conjugated groups.

[0448] In some embodiments, the oligonucleotide is covalently linked to one or more conjugation groups. In some embodiments, the conjugation groups modify one or more properties of the linked oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In some embodiments, the conjugation groups impart novel properties to the linked oligonucleotide (e.g., a fluorophore or reporter group), enabling the detection of the oligonucleotide.Certain conjugated groups and conjugated moieties have been previously described, such as: cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), bile acids (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers such as hexyl-S-triphenylmethanethiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), mercaptocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), and aliphatic chains such as dodecyl glycol or undecyl residues (Saison-Behmoaras et al., EMBO). J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-propanetrioxy-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973) or adamantane acetate palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), stearylamine or hexylamino-carbonyl-hydroxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol groups (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220). Therapy, 2008, 16, 734-740), or N-acetylgalactosamine (GalNAc) clusters (e.g., WO2014 / 179620).

[0449] In some embodiments, the conjugating group may be selected from C22alkyl, C20alkyl, C16alkyl, C10alkyl, C21alkyl, C19alkyl, C18alkyl, C15alkyl, C14alkyl, C13alkyl, C12alkyl, C11alkyl, C9alkyl, C8alkyl, C7alkyl, C6alkyl, C5alkyl, C22alken, C20alken, C16alken, C10alken, C21alken, C19alken, C18alken, C15alken, C14alken, C13alken, C12alken, C11alken, C9alken, C8alken, C7alken, C6alken, or C5alken.

[0450] In some embodiments, the conjugating group may be selected from any of C22alkyl, C20alkyl, C16alkyl, C10alkyl, C21alkyl, C19alkyl, C18alkyl, C15alkyl, C14alkyl, C13alkyl, C12alkyl, C11alkyl, C9alkyl, C8alkyl, C7alkyl, C6alkyl, and C5alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0451] 1. Joining part

[0452] The conjugated portion includes, but is not limited to, intercalating agents, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin portions, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, bile acid portions, folic acid, lipids, lipophilic groups, phospholipids, biotin, phenazine, phenanthridine, anthraquinones, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and dyes.

[0453] In some embodiments, the conjugate portion comprises an active pharmaceutical ingredient, such as aspirin, warfarin, phenylbutazone, ibuprofen, sulprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carboprofen, dansyl sarcosinate, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, leucovorin, benzothiazide, chlorothiazide, azazolide, indomethacin, barbiturates, cephalosporins, sulfonamides, antidiabetic drugs, antibacterial drugs, or antibiotics.

[0454] 2. Fibre Connector

[0455] The conjugated portion is attached to the oligonucleotide via a conjugation linker. In some oligomers, the conjugation linker is a single chemical bond (i.e., the conjugated portion is directly attached to the oligonucleotide via a single bond). In some oligomers, the conjugated portion is attached to the oligonucleotide via a more complex conjugation linker comprising one or more conjugation linker portions, which are subunits constituting the conjugation linker. In some embodiments, the conjugation linker comprises an oligomer with a chain structure (such as a hydrocarbon chain) or repeating units (such as ethylene glycol, nucleoside, or amino acid units).

[0456] In some embodiments, the linker group comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino groups. In some such embodiments, the linker group comprises groups selected from alkyl, amino, oxo, amide, and ether groups. In some embodiments, the linker group comprises groups selected from alkyl and amide groups. In some embodiments, the linker group comprises groups selected from alkyl and ether groups. In some embodiments, the linker group comprises at least one phosphorus moiety. In some embodiments, the linker group comprises at least one phosphate group. In some embodiments, the linker group comprises at least one neutral linker group.

[0457] In some embodiments, the conjugating linker (including the conjugating linker described above) is a bifunctional linker, such as those known in the art for attaching a conjugating group to a parent compound, such as the oligonucleotides provided herein. Typically, a bifunctional linker contains at least two functional groups. One of the functional groups is selected to bind to a specific site on the parent compound, and the other functional group is selected to bind to the conjugating group. Examples of functional groups used in a bifunctional linker include, but are not limited to, electrophiles for reacting with nucleophiles and nucleophiles for reacting with electrophiles. In some embodiments, the bifunctional linker contains one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl groups.

[0458] Examples of conjugated linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxanoic acid (ADO), succinimide-4-(N-maleimidemethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugated linkers include, but are not limited to, substituted or unsubstituted C1-C... 10 Alkyl, substituted or unsubstituted C2-C 10 alkenyl or substituted or unsubstituted C2-C 10 Alkyne group, wherein a non-limiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxyl, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

[0459] In some embodiments, the conjugated linker comprises 1 to 10 linker-nucleosides. In some embodiments, the conjugated linker comprises 2 to 5 linker-nucleosides. In some embodiments, the conjugated linker comprises exactly 3 linker-nucleosides. In some embodiments, the conjugated linker comprises a TCA motif. In some embodiments, such linker-nucleosides are modified nucleosides. In some embodiments, such linker-nucleosides comprise a modified sugar moiety. In some embodiments, the linker-nucleosides are unmodified. In some embodiments, the linker-nucleosides comprise optionally protected heterocyclic bases selected from purines, substituted purines, pyrimidines, or substituted pyrimidines. In some embodiments, the cleavable portion is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. It is generally desirable that the linker-nucleoside be cleaved from the oligomer compound upon reaching the target tissue. Therefore, the linker-nucleosides are typically interconnected and linked to the remaining portion of the oligomer compound via a cleavable bond. In some embodiments, such a cleavable bond is a phosphodiester bond.

[0460] Here, linker-nucleosides are not considered part of the oligonucleotide. Therefore, in embodiments where the oligomer compound comprises an oligonucleotide consisting of a specific number or range of linked nucleosides and / or a specific percentage complementary to a reference nucleic acid, and the oligomer compound also comprises a conjugation group (which contains a conjugated linker (which contains a linker-nucleoside)), these linker-nucleosides are not counted in the length of the oligonucleotide and are not used to determine the percentage of complementarity between the oligonucleotide and the reference nucleic acid. For example, the oligomer compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugation group comprising 1-10 linker-nucleosides adjacent to the nucleosides of the modified oligonucleotide. The total number of consecutively linked nucleosides in such an oligomer compound exceeds 30. Alternatively, the oligomer compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides without a conjugation group. The total number of consecutively linked nucleosides in such an oligomer compound does not exceed 30. Unless otherwise stated, the conjugated linker contains no more than 10 linker-nucleosides. In some embodiments, the conjugated linker comprises no more than 5 linker-nucleosides. In some embodiments, the conjugated linker comprises no more than 3 linker-nucleosides. In some embodiments, the conjugated linker comprises no more than 2 linker-nucleosides. In some embodiments, the conjugated linker comprises no more than 1 linker-nucleoside.

[0461] In some embodiments, it is desirable to cleave conjugated groups from oligonucleotides. For example, in certain cases, oligomeric compounds containing specific conjugated moieties are better absorbed by specific cell types, but once the oligomeric compound is absorbed, the conjugated group needs to be cleaved to release the unconjugated or parental oligonucleotide. Therefore, some conjugated linkers may contain one or more cleavable moieties. In some embodiments, the cleavable moieties are cleavable bonds. In some embodiments, the cleavable moieties are a group of atoms containing at least one cleavable bond. In some embodiments, the cleavable moieties contain a group of atoms having one, two, three, four, or more than four cleavable bonds. In some embodiments, the cleavable moieties are selectively cleaved in cellular or subcellular compartments such as lysosomes. In some embodiments, the cleavable moieties are selectively cleaved by endogenous enzymes such as nucleases.

[0462] In some embodiments, the cleavable bond is selected from: amides, esters, ethers, one or two esters of phosphodiester, phosphate esters, carbamates, or disulfides. In some embodiments, the cleavable bond is one or two esters of phosphodiester. In some embodiments, the cleavable moiety comprises a phosphate ester or phosphodiester. In some embodiments, the cleavable moiety is a phosphate ester or phosphodiester bond between an oligonucleotide and a conjugated moiety or conjugated group.

[0463] In some embodiments, the cleavable portion comprises or is composed of one or more linker-nucleosides. In some such embodiments, one or more linker-nucleosides are interconnected by cleavable bonds and / or connected to the remainder of the oligomeric compound. In some embodiments, such cleavable bonds are unmodified phosphodiester bonds. In some embodiments, the cleavable portion is a 2'-deoxynucleoside connected to the 3' or 5' terminal nucleoside of the oligonucleotide via a phosphodiester-nucleoside internucleotide bond and covalently connected to the remainder of the conjugated linker or the conjugated portion via a phosphate ester or thiophosphate ester internucleotide bond. In some such embodiments, the cleavable portion is 2'-deoxyadenosine.

[0464] 3. Cell-targeting component

[0465] In some embodiments, the conjugation group comprises a cell-targeting moiety. In some embodiments, the conjugation group has the general formula:

[0466]

[0467] Where n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0.

[0468] In some embodiments, n is 1, j is 1, and k is 0. In some embodiments, n is 1, j is 0, and k is 1. In some embodiments, n is 1, j is 1, and k is 1. In some embodiments, n is 2, j is 1, and k is 0. In some embodiments, n is 2, j is 0, and k is 1. In some embodiments, n is 2, j is 1, and k is 1. In some embodiments, n is 3, j is 1, and k is 0. In some embodiments, n is 3, j is 0, and k is 1. In some embodiments, n is 3, j is 1, and k is 1.

[0469] In some embodiments, the conjugating group comprises a cell-targeting portion having at least one binding ligand. In some embodiments, the cell-targeting portion comprises two binding ligands covalently linked to the branching group. In some embodiments, the cell-targeting portion comprises three binding ligands covalently linked to the branching group.

[0470] B. certain terminal groups

[0471] In some embodiments, the oligomeric compound comprises one or more terminal groups. In some such embodiments, the oligomeric compound comprises a stable 5'-phosphate ester. Stable 5'-phosphate esters include, but are not limited to, 5'-phosphonates (including, but not limited to, 5'-vinylphosphonates). In some embodiments, the terminal group comprises one or more debased nucleosides and / or inverse nucleosides. In some embodiments, the terminal group comprises one or more 2'-linked nucleosides. In some such embodiments, the 2'-linked nucleosides are debased nucleosides.

[0472] III. Oligomeric distreptides

[0473] In some embodiments, the oligomeric compounds described herein comprise oligonucleotides having a nucleobase sequence complementary to the nucleobase sequence of the target nucleic acid. In some embodiments, the oligomeric compound is paired with a second oligomeric compound to form an oligomeric duplex. Such an oligomeric duplex comprises a first oligomeric compound having a portion complementary to the target nucleic acid and a second oligomeric compound having a portion complementary to the first oligomeric compound. In some embodiments, the first oligomeric compound of the oligomeric duplex comprises or consists of: (1) a modified or unmodified oligonucleotide and an optional conjugation group, and (2) a second modified or unmodified oligonucleotide and an optional conjugation group. Either or both oligomeric compounds of the oligomeric duplex may contain a conjugation group. The oligonucleotide of each oligomeric compound of the oligomeric duplex may include a non-complementary protruding nucleoside.

[0474] IV. antisense activity

[0475] In some embodiments, the oligomeric compound and oligoduplex are capable of hybridizing with the target nucleic acid to produce at least one antisense activity; such oligomeric compounds and oligoduplexes are antisense compounds. In some embodiments, the antisense compound has antisense activity when it reduces the amount or activity of the target nucleic acid by 25% or more in a standard cellular assay. In some embodiments, the antisense compound selectively affects one or more target nucleic acids. Such antisense compounds comprise a nucleobase sequence that hybridizes with one or more target nucleic acids to produce one or more desired antisense activities, and does not hybridize with one or more non-target nucleic acids, or does not hybridize with one or more non-target nucleic acids in a manner that produces significant undesirable antisense activity.

[0476] In some antisense activities, hybridization of the antisense compound with the target nucleic acid leads to the recruitment of a protein that cleaves the target nucleic acid. For example, some antisense compounds cause RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in this RNA:DNA duplex does not need to be unmodified DNA. In some embodiments, antisense compounds described herein are sufficiently “DNA-like” to elicit RNase H activity. In some embodiments, one or more non-DNA-like nucleotides in the gapmer are permissible.

[0477] In some antisense activities, an antisense compound, or a portion thereof, is loaded into an RNA-induced silencing complex (RISC), ultimately leading to the cleavage of the target nucleic acid. For example, some antisense compounds cause the target nucleic acid to be cleaved by AGO proteins. The antisense compound loaded into the RISC is an RNAi compound. RNAi compounds can be double-stranded (siRNA) or single-stranded (ssRNA).

[0478] In some embodiments, hybridization of the antisense compound with the target nucleic acid does not result in the recruitment of proteins that cleave the target nucleic acid. In some embodiments, hybridization of the antisense compound with the target nucleic acid leads to alterations in target nucleic acid splicing. In some embodiments, hybridization of the antisense compound with the target nucleic acid leads to inhibition of binding interactions between the target nucleic acid and proteins or other nucleic acids. In some embodiments, hybridization of the antisense compound with the target nucleic acid leads to alterations in target nucleic acid translation.

[0479] Antisense activity can be observed directly or indirectly. In some embodiments, the observation or detection of antisense activity involves observing or detecting changes in the amount of the target nucleic acid or the protein encoded by the target nucleic acid, changes in the proportion of splice variants of the nucleic acid or protein, and / or phenotypic changes in cells or subjects.

[0480] V. certain target nucleic acids

[0481] In some embodiments, the oligomeric compound comprises or is composed of an oligonucleotide, said oligonucleotide containing a portion complementary to the target nucleic acid. In some embodiments, the target nucleic acid is an endogenous RNA molecule. In some embodiments, the target nucleic acid encodes a protein. In some such embodiments, the target nucleic acid is selected from mature mRNA and premRNA, including introns, exons, and untranslated regions. In some embodiments, the target nucleic acid is mature mRNA. In some embodiments, the target nucleic acid is premRNA. In some embodiments, the target region is entirely within an intron. In some embodiments, the target region spans an intron / exon junction. In some embodiments, at least 50% of the target region is within an intron.

[0482] A. Complementarity / Mismatch with Target Nucleic Acid

[0483] It is possible to introduce mismatched bases without eliminating activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93: 463-471, March 2001) demonstrated the ability of oligonucleotides with 100% complementarity to bcl-2 mRNA and with three mismatches to bcl-xL mRNA to reduce the expression of bcl-2 and bcl-xL in vitro and in vivo. Furthermore, these oligonucleotides exhibited potent antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16: 3341-3358, 1988) tested the ability of a series of tandem 14-nucleobase oligonucleotides, as well as 28-nucleobase and 42-nucleobase oligonucleotides containing two or three tandem oligonucleotides, respectively, to inhibit human DHFR translation in a rabbit reticulocyte assay. Each of the three 14-nucleobase oligonucleotides alone was able to inhibit translation, although at a more moderate level than the 28- or 42-nucleobase oligonucleotides.

[0484] In some embodiments, the oligonucleotide is complementary to the target nucleic acid along its entire length. In some embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In some embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid along its entire length and includes a portion that is 100% or completely complementary to the target nucleic acid. In some embodiments, the length of the completely complementary portion is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.

[0485] In some embodiments, the oligonucleotide contains one or more mismatched nucleobases relative to the target nucleic acid. In some embodiments, antisense activity against the target is reduced by such mismatch, but the reduction in non-target activity is greater. Therefore, in some embodiments, the selectivity of the oligonucleotide is improved. In some embodiments, the mismatch is specifically located within an oligonucleotide having a gapmer motif. In some embodiments, the mismatch is located at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 at the 5' end of the gap region. In some embodiments, the mismatch is located at position 1, 2, 3, 4, 5, or 6 at the 5' end of either the 5' flanking region or the 3' flanking region.

[0486] B. SCN2A

[0487] In some embodiments, the oligomeric compound comprises, or is composed of, an oligonucleotide complementary to the target nucleic acid, wherein the target nucleic acid is SCN2A nucleic acid. In some embodiments, the SCN2A nucleic acid has the sequence described in SEQ ID NO: 1 (GENBANK accession number NM_001040142.2) or SEQ ID NO: 2 (GENBANK accession number NC_000002.12, truncated from nucleotide 165127001 to 165395000).

[0488] In some embodiments, contacting cells with an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of SCN2A RNA in the cells, and in some embodiments reduces the amount of SCN1A protein in the cells. In some embodiments, contacting cells with a modified oligonucleotide complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of SCN2A RNA in the cells, and in some embodiments reduces the amount of SCN2A protein in the cells. In some embodiments, the cells are in vitro cells. In some embodiments, the cells are in a subject. In some embodiments, the oligomeric compound consists of a modified oligonucleotide. In some embodiments, contacting cells in a subject with an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 improves one or more symptoms or markers of a disease or disorder associated with a voltage-gated sodium channel protein. In some embodiments, the voltage-gated sodium channel protein is SCN2A. In some embodiments, the subject has a disease or disorder associated with a voltage-gated sodium channel protein other than SCN2A. In some embodiments, the subject has a disease or disorder associated with SCN1A. In some implementations, the disease or disorder is a developmental or epileptic encephalopathy, such as early-onset epileptic encephalopathy, late-onset epileptic encephalopathy, or benign familial neonatal-infant epilepsy; in some implementations, the disease or disorder is intellectual disability or autism spectrum disorder; in some implementations, the disease or disorder is Dravet syndrome.

[0489] In some implementations, the symptoms or markers are any of the following: seizures, hypotonia, sensory integration dysfunction, motor dysfunction, intellectual and cognitive dysfunction, motor and balance dysfunction, visual dysfunction, language and speech delay, gastrointestinal disorders (e.g., gastroesophageal reflux, diarrhea, constipation, motility disorders, etc.), neurodevelopmental delay, sudden unexpected death in epilepsy, motor developmental delay, social and language developmental delay, repetitive movements, uncoordinated oral movements, and sleep problems. In some implementations, a seizure is any of the following: focal, clonic, tonic and generalized tonic and clonic seizures, prolonged seizures (usually lasting more than 10 minutes), and frequent seizures (e.g., convulsions, myoclonus, absence seizures, focal, lethargic status, and tonic seizures).

[0490] In some embodiments, in a standard in vitro assay, the oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of SCN2A RNA by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in vitro. In some embodiments, in a standard in vitro assay, the oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of SCN2A protein by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in vitro. In some embodiments, when administered according to a standard in vivo assay, the oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of SCN2A RNA by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in vivo. In some embodiments, when administered according to a standard in vivo assay, the oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of SCN2A protein by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in vivo. In some embodiments, the oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of SCN2A RNA in the subject's CSF by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, the oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of SCN2A protein in the subject's CSF by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

[0491] In some embodiments, the oligomeric compound does not contain a bicyclic sugar moiety. In some embodiments, the oligomeric compound does not contain more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In some embodiments, the oligomeric compound contains one or two flanking fragments containing nucleosides that are not bicyclic nucleosides. In some embodiments, the oligomeric compound does not contain an LNA sugar moiety. In some embodiments, the oligomeric compound does not contain more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In some embodiments, the oligomeric compound contains one or two flanking fragments containing nucleosides that are not LNA nucleosides.

[0492] Certain target nucleic acids in certain tissues

[0493] In some embodiments, the oligomeric compound comprises or consists of oligonucleotides, said oligonucleotides containing a portion complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue. In some embodiments, the pharmacologically relevant tissue is cells and tissues containing the central nervous system. Such tissues include the cortex, hippocampus, and spinal cord.

[0494] VI. Certain pharmaceutical compositions

[0495] In some embodiments, this document describes pharmaceutical compositions comprising one or more oligomeric compounds. In some embodiments, the one or more oligomeric compounds are each composed of modified oligonucleotides. In some embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In some embodiments, the pharmaceutical composition comprises a sterile saline solution and one or more oligomeric compounds, or a combination thereof. In some embodiments, the sterile saline solution is pharmaceutical grade saline. In some embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and sterile water, or a combination thereof. In some embodiments, the sterile water is pharmaceutical grade water. In some embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and phosphate-buffered saline (PBS), or a combination thereof. In some embodiments, the sterile PBS is pharmaceutical grade PBS. In some embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and artificial cerebrospinal fluid (“artificial CSF” or “aCSF”), or a combination thereof. In some embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0496] In some embodiments, the pharmaceutical composition comprises modified oligonucleotides and artificial cerebrospinal fluid. In some embodiments, the pharmaceutical composition consists of modified oligonucleotides and artificial cerebrospinal fluid. In some embodiments, the pharmaceutical composition consists essentially of modified oligonucleotides and artificial cerebrospinal fluid. In some embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0497] In some embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients. In some embodiments, the excipients are selected from water, salt solutions, alcohols, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silica, viscous paraffin, hydroxymethyl cellulose, and polyvinylpyrrolidone.

[0498] In some embodiments, the oligomeric compound may be mixed with a pharmaceutically acceptable active and / or inert substance for the preparation of a pharmaceutical composition or formulation. The compositions and methods used to formulate the pharmaceutical composition depend on many criteria, including but not limited to route of administration, disease severity, or dosage.

[0499] In some embodiments, pharmaceutical compositions comprising oligomeric compounds encompass any pharmaceutically acceptable salt of the oligomeric compound, an ester of the oligomeric compound, or a salt of such an ester. In some embodiments, pharmaceutical compositions comprising oligomeric compounds containing one or more oligonucleotides are capable of providing (directly or indirectly) a bioactive metabolite or its residues upon administration to a subject, including a human. Therefore, this disclosure also relates, for example, to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In some embodiments, a prodrug comprises one or more conjugate groups linked to an oligonucleotide, wherein the conjugate groups are cleaved by endogenous nucleases in vivo.

[0500] Lipid moieties have been used in nucleic acid therapy in various ways. In some such methods, nucleic acids (such as oligomeric compounds) are introduced into pre-formed liposomes or lipid complexes made from a mixture of cationic and neutral lipids. In some methods, DNA complexes with mono- or polycationic lipids are formed in the absence of neutral lipids. In some embodiments, lipid moieties are selected to increase the distribution of agents to specific cells or tissues. In some embodiments, lipid moieties are selected to increase the distribution of agents to adipose tissue. In some embodiments, lipid moieties are selected to increase the distribution of agents to muscle tissue.

[0501] In some embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems can be used to prepare certain pharmaceutical compositions, including those comprising hydrophobic compounds. In some embodiments, certain organic solvents such as dimethyl sulfoxide are used.

[0502] In some embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more agents comprising the oligomeric compounds provided herein to a specific tissue or cell type. For example, in some embodiments, the pharmaceutical composition comprises liposomes coated with tissue-specific antibodies.

[0503] In some embodiments, the pharmaceutical composition comprises a cosolvent system. Some such cosolvent systems include, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In some embodiments, such cosolvent systems are used for hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which comprises 3% w / v benzyl alcohol and 8% w / v nonpolar surfactant Polysorbate 80. TM And a 65% w / v polyethylene glycol 300 anhydrous ethanol solution. The proportions of such co-solvent systems can vary considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the properties of the co-solvent components can differ: for example, other surfactants can be used instead of Polysorbate 80. TM The fraction size of polyethylene glycol can vary; other biocompatible polymers can replace polyethylene glycol, such as polyvinylpyrrolidone; and other sugars or polysaccharides can replace glucose.

[0504] In some embodiments, a pharmaceutical composition is prepared for oral administration. In some embodiments, a pharmaceutical composition is prepared for sublingual administration. In some embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intraventricular (ICV), intraneural, perineurial, etc.). In some such embodiments, the pharmaceutical composition comprises a carrier and is formulated in an aqueous solution (such as water or a physiologically compatible buffer, such as Hanks' solution, Ringer's solution, or saline buffer). In some embodiments, additional components are included (e.g., components that aid in dissolution or act as preservatives). In some embodiments, an injectable suspension is prepared using a suitable liquid carrier, suspending agent, etc. Some injectable pharmaceutical compositions are present in unit dose form, such as in ampoules or multi-dose containers. Some pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous carriers and may contain formulations such as suspending agents, stabilizers, and / or dispersants. Certain solvents suitable for injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils (such as sesame oil), synthetic fatty acid esters (such as ethyl oleate or triglycerides and liposomes).

[0505] Under certain conditions, some of the compounds disclosed herein act as acids. Although such compounds can be drawn or described in protonated (free acid) form, or in ionized and cation-bound (salt) form, aqueous solutions of such compounds exist in equilibrium in these forms. For example, the phosphate bonds of oligonucleotides in aqueous solution exist in equilibrium as free acid, anion, and salt. Unless otherwise stated, the compounds described herein are intended to include all such forms. Furthermore, some oligonucleotides have several such bonds, each in equilibrium. Therefore, oligonucleotides in solution exist in multiple forms at multiple locations in equilibrium. The term "oligonucleotide" is intended to include all such forms. The drawn structures must depict a single form. However, unless otherwise stated, such figures are also intended to include the corresponding forms. In this document, the description of the structure of a compound as a free acid, followed by the term "or its salt," explicitly includes all such forms that can be fully or partially protonated / deprotonated / bound to a cation. In some cases, one or more specific cations are identified.

[0506] In some embodiments, the modified oligonucleotide or oligomer is in an aqueous solution containing sodium. In some embodiments, the modified oligonucleotide or oligomer is in an aqueous solution containing potassium. In some embodiments, the modified oligonucleotide or oligomer is in PBS. In some embodiments, the modified oligonucleotide or oligomer is in water. In some such embodiments, the pH of the solution is adjusted to the desired pH using NaOH and / or HCl.

[0507] This article describes certain specific dosages. Dosages may be expressed in units of dosage. For clarity, the dosage (or units of dosage) of a modified oligonucleotide or oligomer (in milligrams) represents the mass of the modified oligonucleotide or oligomer in its free acid form. As mentioned above, in aqueous solution, the free acid is in equilibrium with its anionic and salt forms. However, for the purpose of dosage calculation, it is assumed that the modified oligonucleotide or oligomer exists in a solvent-free, sodium acetate-free, anhydrous, free acid form. For example, when a modified oligonucleotide or oligomer is in a solution containing sodium (e.g., saline), it may be partially or completely deprotonated and bind to Na+ ions. However, the mass of the protons is still included in the weight of the dose, while the mass of the Na+ ions is not. Therefore, for example, a dose or dose unit of 10 mg of compound number 1348259 is equal to the number of fully protonated molecules weighing 10 mg. This is equivalent to 10.59 mg of solvent-free, sodium acetate-free, anhydrous sodium-containing compound number 1348259. When an oligomer contains a conjugated group, the mass of the conjugated group is included when calculating the dose of such an oligomer. If the conjugated group also has an acidity, it is also assumed that the conjugated group is fully protonated for dose calculation.

[0508] VII. Some compounds

[0509] 1. Compound number 1348259

[0510] In some embodiments, compound number 1348259 is characterized by a 5-10-5 MOE having the sequence (from 5' to 3') of GCATAATCCCATTATACAAA (SEQ ID NO: 2493). The gapmer consists of nucleosides 1-5 and 16-20 (from 5' to 3') each being a 2'-MOE nucleoside, and nucleosides 6-15 each being a 2'-β-D-deoxy nucleoside, wherein the internucleotide bonds between nucleosides 2-3, 3-4, 4-5, 5-6, 16-17 and 17-18 are phosphodiester internucleotide bonds, the internucleotide bonds between nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19 and 19-20 are thiophosphate internucleotide bonds, and wherein each cytosine is 5-methylcytosine.

[0511] In some embodiments, compound number 1348259 is represented by the following chemical symbol: G es m C eo A eo T eo A eo A d s T ds m C ds m C ds m C ds A ds T ds T ds A ds T ds A eo m C eo A es A es A e (SEQ ID NO: 2493), where:

[0512] A = adenine nucleobase,

[0513] m C = 5-methylcytosine nucleobase,

[0514] G = guanine nucleobase

[0515] T = thymine nucleobase,

[0516] e = 2'-MOE sugar moiety,

[0517] d = 2'-β-D-deoxyribosyl sugar moiety,

[0518] s = thiophosphate nucleoside bond, and

[0519] o = phosphate diester nucleoside bond.

[0520] In some embodiments, compound number 1348259 is represented by the following chemical structure:

[0521]

[0522] (SEQ ID NO: 2493).

[0523] Structure 1. Compound number 1348259

[0524] In some embodiments, the sodium salt of compound number 1348259 is represented by the following chemical structure:

[0525]

[0526] (SEQ ID NO: 2493).

[0527] Structure 2. Sodium salt of compound number 1348259

[0528] 2. Compound number 1348289

[0529] In some embodiments, compound number 1348289 is characterized by a 6-10-4 MOE gapmer having the sequence (from 5' to 3') of CACGACATATTTTTCTACAC (SEQ ID NO: 2514), wherein each of nucleosides 1-6 and 17-20 (each from 5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 7-16 is a 2'-β-D-deoxy nucleoside, wherein nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 1 The internucleotide bonds between 8 are phosphodiester internucleotide bonds, and the internucleotide bonds between 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19 and 19 to 20 are thiophosphate internucleotide bonds, and each cytosine in these bonds is 5-methylcytosine.

[0530] In some embodiments, compound number 1348289 is represented by the following chemical symbol: m C es A eom C eo G eo A eo m C e o A ds T ds A ds T ds T ds T ds T ds T ds m C ds T ds A eo m C es A es m C e (SEQ ID NO: 2514), where:

[0531] A = adenine nucleobase,

[0532] m C = 5-methylcytosine nucleobase,

[0533] G = guanine nucleobase

[0534] T = thymine nucleobase,

[0535] e = 2'-MOE sugar moiety,

[0536] d = 2'-β-D-deoxyribosyl sugar moiety,

[0537] s = thiophosphate nucleoside bond, and

[0538] o = phosphate diester nucleoside bond.

[0539] In some embodiments, compound number 1348289 is represented by the following chemical structure:

[0540]

[0541] (SEQ ID NO: 2514).

[0542] Structure 3. Compound number 1348289

[0543] In some embodiments, the sodium salt of compound number 1348289 is represented by the following chemical structure:

[0544]

[0545] (SEQ ID NO: 2514).

[0546] Structure 4. Sodium salt of compound number 1348289

[0547] 3. Compound number 1348290

[0548] In some embodiments, compound number 1348290 is characterized by a 6-10-4 MOEgapmer having the sequence (from 5' to 3') of CCACGACATATTTTTCTACA (SEQ ID NO: 2510), wherein each of nucleosides 1-6 and 17-20 (from 5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 7-16 is a 2'-β-D-deoxy nucleoside, wherein nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 1 The internucleotide bonds between 8 are phosphodiester internucleotide bonds, and the internucleotide bonds between 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19 and 19 to 20 are thiophosphate internucleotide bonds, and each cytosine in these bonds is 5-methylcytosine.

[0549] In some embodiments, compound number 1348290 is represented by the following chemical symbol: m C es m C eo A eo m C eo G e o A eo m C ds A ds T ds A ds T ds T ds T ds T ds T ds m C ds T eo A es m C es A e (SEQ ID NO: 2510), where:

[0550] A = adenine nucleobase,

[0551] m C = 5-methylcytosine nucleobase,

[0552] G = guanine nucleobase

[0553] T = thymine nucleobase,

[0554] e = 2'-MOE sugar moiety,

[0555] d = 2'-β-D-deoxyribosyl sugar moiety,

[0556] s = thiophosphate nucleoside bond, and

[0557] o = phosphate diester nucleoside bond.

[0558] In some embodiments, compound number 1348290 is represented by the following chemical structure:

[0559]

[0560] (SEQ ID NO: 2510).

[0561] Structure 5: Compound number 1348290

[0562] In some embodiments, the sodium salt of compound number 1348290 is represented by the following chemical structure:

[0563]

[0564] (SEQ ID NO: 2510)

[0565] Structure 6: Sodium salt of compound number 1348290

[0566] 4. Compound number 1348331

[0567] In some embodiments, compound number 1348331 is characterized by a 6-10-4 MOE gapmer having the sequence TCTGCATGTAACCTTTATAC (SEQ ID NO: 2487) (from 5' to 3'), wherein each of nucleosides 1-6 and 17-20 (from 5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 7-16 is a 2'-β-D-deoxynucleoside, wherein nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 1 The internucleotide bonds between 8 are phosphodiester internucleotide bonds, and the internucleotide bonds between 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19 and 19 to 20 are thiophosphate internucleotide bonds, and each cytosine in these bonds is 5-methylcytosine.

[0568] In some embodiments, compound number 1348331 is represented by the following chemical symbol: T es m Ceo T eo G eo m C eo A e o T ds G ds T ds A ds A ds m C ds m C ds T ds T ds T ds A eo T es A es m C e (SEQ ID NO: 2487), where:

[0569] A = adenine nucleobase,

[0570] m C = 5-methylcytosine nucleobase,

[0571] G = guanine nucleobase

[0572] T = thymine nucleobase,

[0573] e = 2'-MOE sugar moiety,

[0574] d = 2'-β-D-deoxyribosyl sugar moiety,

[0575] s = thiophosphate nucleoside bond, and

[0576] o = phosphate diester nucleoside bond.

[0577] In some embodiments, compound number 1348331 is represented by the following chemical structure:

[0578]

[0579] (SEQ ID NO: 2487).

[0580] Structure 7: Compound number 1348331

[0581] In some embodiments, the sodium salt of compound number 1348331 is represented by the following chemical structure:

[0582]

[0583] (SEQ ID NO: 2487)

[0584] Structure 8: Sodium salt of compound number 1348331

[0585] 5. Compound number 1348347

[0586] In some embodiments, compound number 1348347 is characterized by a 6-10-4 MOE having the sequence (from 5' to 3') of GCATAATCCCATTATACAAA (SEQ ID NO: 2493). The gapmer consists of nucleosides 1-6 and 17-20 (from 5' to 3') each being a 2'-MOE nucleoside, and nucleosides 7-16 each being a 2'-β-D-deoxy nucleoside, wherein the internucleotide bonds between nucleosides 2-3, 3-4, 4-5, 5-6, 6-7 and 17-18 are phosphodiester internucleotide bonds, the internucleotide bonds between nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19 and 19-20 are thiophosphate internucleotide bonds, and wherein each cytosine is 5-methylcytosine.

[0587] In some embodiments, compound number 1348347 is represented by the following chemical symbol: G es m C eo A eo T eo A eo A e o T ds m C ds m C ds m C ds A ds T ds T ds A ds T ds A ds m C eo A es A es A e (SEQ ID NO: 2493), where:

[0588] A = adenine nucleobase,

[0589] m C = 5-methylcytosine nucleobase,

[0590] G = guanine nucleobase

[0591] T = thymine nucleobase,

[0592] e = 2'-MOE sugar moiety,

[0593] d = 2'-β-D-deoxyribosyl sugar moiety,

[0594] s = thiophosphate nucleoside bond, and

[0595] o = phosphate diester nucleoside bond.

[0596] In some embodiments, compound number 1348347 is represented by the following chemical structure:

[0597]

[0598] (SEQ ID NO: 2493).

[0599] Structure 9: Compound number 1348347

[0600] In some embodiments, the sodium salt of compound number 1348347 is represented by the following chemical structure:

[0601]

[0602] (SEQ ID NO: 2493)

[0603] Structure 10: Sodium salt of compound number 1348347

[0604] 6. Compound number 1348937

[0605] In some embodiments, compound number 1348937 is characterized by a 5-8-5 MOE gapmer having the sequence (from 5' to 3') of CTGCATGTAACCTTTATA (SEQ ID NO: 2534), wherein each of nucleosides 1-5 and 14-18 (each from 5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 6-13 is a 2'-β-D-deoxy nucleoside, wherein the internucleotide bonds between nucleosides 2-3, 3-4, 4-5, 14-15, and 15-16 are phosphodiester internucleotide bonds, the internucleotide bonds between nucleosides 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 16-17, and 17-18 are thiophosphate internucleotide bonds, and wherein each cytosine is 5-methylcytosine.

[0606] In some embodiments, compound number 1348937 is represented by the following chemical symbol: m C es T eo G eom C eo A es T d s G ds T ds A ds A ds m C ds m C ds T ds T eo T eo A es T es A e

[0607] (SEQ ID NO: 2534), where:

[0608] A = adenine nucleobase,

[0609] m C = 5-methylcytosine nucleobase,

[0610] G = guanine nucleobase

[0611] T = thymine nucleobase,

[0612] e = 2'-MOE sugar moiety,

[0613] d = 2'-β-D-deoxyribosyl sugar moiety,

[0614] s = thiophosphate nucleoside bond, and

[0615] o = phosphate diester nucleoside bond.

[0616] In some embodiments, compound number 1348937 is represented by the following chemical structure:

[0617]

[0618] (SEQ ID NO: 2534).

[0619] Structure 11: Compound number 1348937

[0620] In some embodiments, the sodium salt of compound number 1348937 is represented by the following chemical structure:

[0621]

[0622] (SEQ ID NO: 2534)

[0623] Structure 12: Sodium salt of compound number 1348937

[0624] VIII. Some hot spots

[0625] In some embodiments, the nucleobases within the specified range below comprise the hotspot region of the SCN2A nucleic acid. In some embodiments, modified oligonucleotides complementary to an equal-length portion within the hotspot region of the SCN2A nucleic acid achieved an average in vitro reduction of SCN2A RNA of 69.9% or more in a standard in vitro assay. In some embodiments, modified oligonucleotides complementary to an equal-length portion within the hotspot region of the SCN2A nucleic acid achieved an average in vivo reduction of SCN2A RNA of 59% or more in a standard in vivo assay.

[0626] 1. SEO ID NO: 1, nucleobases 2306-2367 or SEQ ID NO: 2 Nucleotide bases 199863-199905

[0627] In some embodiments, nucleotides 2306-2367 of SEQ ID NO: 1 or nucleotides 199863-199905 of SEQ ID NO: 2 contain a hotspot region. In some embodiments, the modified oligonucleotide is complementary to the iso-length portion within nucleotides 2306-2367 of SEQ ID NO: 1 or nucleotides 199863-199905 of SEQ ID NO: 2. In some embodiments, the modified oligonucleotide is 20 nucleotides long. In some embodiments, the modified oligonucleotide is 18 nucleotides long. In some embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleotides long. In some embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In some embodiments, the modified oligonucleotide is a gapmer.

[0628] In some embodiments, the gapmer is a 5-10-5 MOE gapmer. In some embodiments, the gapmer is a 6-10-4 MOE gapmer. In some embodiments, the gapmer is a 4-10-6 MOE gapmer. In some embodiments, the gapmer is a 4-8-6 MOE gapmer. In some embodiments, the gapmer is a 6-8-4 MOE gapmer. In some embodiments, the gapmer is a 5-8-5 MOE gapmer. In some embodiments, the gapmer has a glycosyl sequence from 5' to 3': eeeeeeddddddddddeeeee, eeeeeeddddddddddeeeeee, eeeeddddddddddeeeeee, eeeeddddddddddeeeeee, eeeeeeddddddddeeeeee, or eeeeeeddddddddeeeeeee, where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety and 'e' represents the 2'-MOE sugar moiety. In some embodiments, the gapmer contains a 2'-substituted nucleoside. In some embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In some embodiments, the 2'-substituted nucleoside is located at position 2 (5' to 3') of the gap.

[0629] In some embodiments, the modified oligonucleotide does not contain a bicyclic sugar moiety. In some embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In some embodiments, the modified oligonucleotide contains one or two flanking fragments containing nucleosides that are not bicyclic nucleotides. In some embodiments, the modified oligonucleotide does not contain an LNA sugar moiety. In some embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In some embodiments, the modified oligonucleotide contains one or two flanking fragments containing nucleosides that are not LNA nucleotides.

[0630] In some embodiments, the internucleotide bonds of the modified oligonucleotide are phosphate thioester internucleotide bonds and phosphodiester internucleotide bonds. In some embodiments, the phosphodiester (“o”) and phosphate thioester (“s”) internucleotide bonds are arranged in a sequence from 5' to 3'. In some embodiments, the modified nucleotide has an internucleotide bond motif (from 5' to 3') of sooooosssssssssssssoss, soooosssssssssssoss, soooossssssssssssoss, soooosssssssssssoss, soooossssssssssoss, or soooossssssssssssoss, where each “s” represents a phosphate thioester internucleotide bond and each “o” represents a phosphodiester internucleotide bond.

[0631] The nucleobase sequences of SEQ ID NO: 336, 488, 2021, 2097, 2174, 2250, 2326, 2403, 2499, 2500, 2501, 2502 and 2526 are complementary to the same length portions of nucleobases 2306-2367 of SEQ ID NO: 1 or nucleobases 199863-199905 of SEQ ID NO: 2.

[0632] The nucleobase sequences of compounds IDs 909979, 1248427, 1248428, 1248429, 1248430, 1248431, 1248432, 1248433, 1348279, 1348282, 1348286, 1348297, 1348328, 1348343, 1348358, 1348360, 1348361, 1348362, 1348364, 1348365, 1348366, 1348367, 1348378, and 1348380 are identical to nucleobases 2306-2367 of SEQ ID NO: 1 or SEQ ID NO: 1. The equal-length portions of the nucleobases 199863-199905 in NO:2 are complementary.

[0633] In some embodiments, oligonucleotides modified with complementarity to the equal-length portions of SEQ ID NO: 1 (nucleotides 2306-2367) or SEQ ID NO: 2 (nucleotides 199863-199905) achieved an in vitro reduction of SCN2A RNA by at least 53% in a standard in vitro assay. In some embodiments, oligonucleotides modified with complementarity to the equal-length portions of SEQ ID NO: 1 (nucleotides 2306-2367) or SEQ ID NO: 2 (nucleotides 199863-199905) achieved an average in vitro reduction of SCN2A RNA by 69.9% in a standard in vitro assay. In some embodiments, oligonucleotides modified with complementarity to the equal-length portions of SEQ ID NO: 1 (nucleotides 2306-2367) or SEQ ID NO: 2 (nucleotides 199863-199905) achieved an average in vivo reduction of SCN2A RNA by 77.1% in a standard in vivo assay. In some embodiments, modified oligonucleotides complementary to the same length portions within SEQ ID NO: 1 (bases 2306-2367) or SEQ ID NO: 2 (bases 199863-199905) achieved an average 63.2% reduction in SCN2A RNA in vivo in standard in vivo assays.

[0634] 2. Nucleobases 3499-3557 of SEQ ID NO: 1 or SEQ ID NO: 2 Nucleotide bases 227493-227551

[0635] In some embodiments, nucleotides 3499-3557 of SEQ ID NO: 1 or nucleotides 227493-227551 of SEQ ID NO: 2 contain a hotspot region. In some embodiments, the modified oligonucleotide is complementary to the iso-length portion within nucleotides 3499-3557 of SEQ ID NO: 1 or nucleotides 227493-227551 of SEQ ID NO: 2. In some embodiments, the modified oligonucleotide is 20 nucleotides long. In some embodiments, the modified oligonucleotide is 18 nucleotides long. In some embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleotides long. In some embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In some embodiments, the modified oligonucleotide is a gapmer.

[0636] In some embodiments, the gapmer is a 5-10-5 MOE gapmer. In some embodiments, the gapmer is a 6-10-4 MOE gapmer. In some embodiments, the gapmer is a 4-10-6 MOE gapmer. In some embodiments, the gapmer is a 4-8-6 MOE gapmer. In some embodiments, the gapmer is a 6-8-4 MOE gapmer. In some embodiments, the gapmer is a 5-8-5 MOE gapmer. In some embodiments, the gapmer has a glycosyl sequence from 5' to 3': eeeeeeddddddddddeeeee, eeeeeeddddddddddeeeeee, eeeeddddddddddeeeeee, eeeeddddddddddeeeeee, eeeeeeddddddddeeeeee, or eeeeeeddddddddeeeeeee, where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety and 'e' represents the 2'-MOE sugar moiety. In some embodiments, the gapmer contains a 2'-substituted nucleoside. In some embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In some embodiments, the 2'-substituted nucleoside is located at position 2 (5' to 3') of the gap.

[0637] In some embodiments, the modified oligonucleotide does not contain a bicyclic sugar moiety. In some embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In some embodiments, the modified oligonucleotide contains one or two flanking fragments containing nucleosides that are not bicyclic nucleotides. In some embodiments, the modified oligonucleotide does not contain an LNA sugar moiety. In some embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In some embodiments, the modified oligonucleotide contains one or two flanking fragments containing nucleosides that are not LNA nucleotides.

[0638] In some embodiments, the internucleotide bonds of the modified oligonucleotide are phosphate thioester internucleotide bonds and phosphodiester internucleotide bonds. In some embodiments, the phosphodiester (“o”) and phosphate thioester (“s”) internucleotide bonds are arranged in a sequence from 5' to 3'. In some embodiments, the modified nucleotide has an internucleotide bond motif (from 5' to 3') of sooooosssssssssssssoss, soooosssssssssssoss, soooossssssssssssoss, soooosssssssssssoss, soooossssssssssoss, or soooossssssssssssoss, where each “s” represents a phosphate thioester internucleotide bond and each “o” represents a phosphodiester internucleotide bond.

[0639] The nucleobase sequences of SEQ ID NO: 181, 259, 643, 720, 796, 2504, 2505, 2506, 2507, 2508, 2509, 2510, 2511, 2512, 2513, 2514 and 2521 are complementary to the same length portions of nucleobases 3499-3557 of SEQ ID NO: 1 or nucleobases 227493-227551 of SEQ ID NO: 2.

[0640] Compound IDs: 909989, 909990, 1248487, 1248488, 1248489, 1348289, 1348290, 1348291, 1348292, 1348295, 1348298, 1348302, 1348303, 1348304, 1348306, 1348307, 1348369, 1348370, 1348371, 1348373, 1348374, 134837 5. The nucleobase sequences of 1348376, 1348377, 1348381, 1348382, 1348383, 1348384, 1348385, 1348386, 1348387, 1348405, 1348411, 1348423, 1348439, 1348440, 1348441, 1348442, 1348443, 1348444, 1348446, 1348447, and 1348456 are complementary to the same length portions of nucleobases 3499-3557 in SEQ ID NO: 1 or nucleobases 227493-227551 in SEQ ID NO: 2.

[0641] In some embodiments, oligonucleotides modified with complementarity to the equal-length portions of SEQ ID NO: 1 (nucleotides 3499-3557) or SEQ ID NO: 2 (nucleotides 227493-227551) achieved an in vitro reduction of SCN2A RNA of at least 75% in a standard in vivo assay. In some embodiments, oligonucleotides modified with complementarity to the equal-length portions of SEQ ID NO: 1 (nucleotides 3499-3557) or SEQ ID NO: 2 (nucleotides 227493-227551) achieved an average in vitro reduction of SCN2A RNA of 81.6% in a standard in vivo assay. In some embodiments, oligonucleotides modified with complementarity to the equal-length portions of SEQ ID NO: 1 (nucleotides 3499-3557) or SEQ ID NO: 2 (nucleotides 227493-227551) achieved an average in vivo reduction of SCN2A RNA of 76.6% in a standard in vivo assay. In some embodiments, modified oligonucleotides complementary to the same length portions within nucleotides 3499-3557 of SEQ ID NO: 1 or nucleotides 227493-227551 of SEQ ID NO: 2 achieved an average in vivo reduction of SCN2A RNA of 67.2% in standard in vivo assays.

[0642] 3. SEQ ID NO: 2 Nucleotide bases 243124-243204

[0643] In some embodiments, nucleotides 243124-243204 of SEQ ID NO: 2 contain a hotspot region. In some embodiments, the modified oligonucleotide is complementary to the iso-length portion within nucleotides 243124-243204 of SEQ ID NO: 2. In some embodiments, the modified oligonucleotide is 20 nucleotides long. In some embodiments, the modified oligonucleotide is 18 nucleotides long. In some embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleotides long. In some embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In some embodiments, the modified oligonucleotide is a gapmer.

[0644] In some embodiments, the gapmer is a 5-10-5 MOE gapmer. In some embodiments, the gapmer is a 6-10-4 MOE gapmer. In some embodiments, the gapmer is a 4-10-6 MOE gapmer. In some embodiments, the gapmer is a 4-8-6 MOE gapmer. In some embodiments, the gapmer is a 6-8-4 MOE gapmer. In some embodiments, the gapmer is a 5-8-5 MOE gapmer. In some embodiments, the gapmer has a glycosyl sequence from 5' to 3': eeeeeeddddddddddeeeee, eeeeeeddddddddddeeeeee, eeeeddddddddddeeeeee, eeeeddddddddddeeeeee, eeeeeeddddddddeeeeee, or eeeeeeddddddddeeeeeee, where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety and 'e' represents the 2'-MOE sugar moiety. In some embodiments, the gapmer contains a 2'-substituted nucleoside. In some embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In some embodiments, the 2'-substituted nucleoside is located at position 2 (5' to 3') of the gap.

[0645] In some embodiments, the modified oligonucleotide does not contain a bicyclic sugar moiety. In some embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In some embodiments, the modified oligonucleotide contains one or two flanking fragments containing nucleosides that are not bicyclic nucleotides. In some embodiments, the modified oligonucleotide does not contain an LNA sugar moiety. In some embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In some embodiments, the modified oligonucleotide contains one or two flanking fragments containing nucleosides that are not LNA nucleotides.

[0646] In some embodiments, the internucleotide bonds of the modified oligonucleotide are phosphate thioester internucleotide bonds and phosphodiester internucleotide bonds. In some embodiments, the phosphodiester (“o”) and phosphate thioester (“s”) internucleotide bonds are arranged in a sequence from 5' to 3'. In some embodiments, the modified nucleotide has an internucleotide bond motif (from 5' to 3') of sooooosssssssssssssoss, soooosssssssssssoss, soooossssssssssssoss, soooosssssssssssoss, soooossssssssssoss, or soooossssssssssssoss, where each “s” represents a phosphate thioester internucleotide bond and each “o” represents a phosphodiester internucleotide bond.

[0647] The nucleobase sequences of SEQ ID NO: 491, 567, 644, 721, 797, 2177, 2253, 2315, 2329, 2406 and 2527 are complementary to the same length portion of nucleobases 243124-243204 in SEQ ID NO: 2.

[0648] The nucleobase sequences of compounds IDs 1248507, 1248508, 1248509, 1248510, 1248511, 1248512, 1248513, 1248514, 1248515, 1250138, 1348299, 1348379, 1348388, and 1348397 are complementary to the same-length portions of nucleobases 243124-243204 in SEQ ID NO: 2.

[0649] In some embodiments, oligonucleotides modified with complementarity to the equal-length portion of SEQ ID NO: 2 (nucleotides 243124-243204) achieved an in vitro reduction of SCN2A RNA of at least 51% in a standard in vitro assay. In some embodiments, oligonucleotides modified with complementarity to the equal-length portion of SEQ ID NO: 2 (nucleotides 243124-243204) achieved an average in vitro reduction of SCN2A RNA of 71.4% in a standard in vitro assay. In some embodiments, oligonucleotides modified with complementarity to the equal-length portion of SEQ ID NO: 2 (nucleotides 243124-243204) achieved an average in vivo reduction of SCN2A RNA of 61.3% in a standard in vivo assay. In some embodiments, oligonucleotides modified with complementarity to the equal-length portion of SEQ ID NO: 2 (nucleotides 243124-243204) achieved an average in vivo reduction of SCN2A RNA of 61.5% in a standard in vivo assay.

[0650] 4. SEQ ID NO: 2Nucleotide bases 243917-244073

[0651] In some embodiments, nucleotides 243917-244073 of SEQ ID NO: 2 contain a hotspot region. In some embodiments, the modified oligonucleotide is complementary to the iso-length portion within nucleotides 243917-244073 of SEQ ID NO: 2. In some embodiments, the modified oligonucleotide is 20 nucleotides long. In some embodiments, the modified oligonucleotide is 18 nucleotides long. In some embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleotides long. In some embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In some embodiments, the modified oligonucleotide is a gapmer.

[0652] In some embodiments, the gapmer is a 5-10-5 MOE gapmer. In some embodiments, the gapmer is a 6-10-4 MOE gapmer. In some embodiments, the gapmer is a 4-10-6 MOE gapmer. In some embodiments, the gapmer is a 4-8-6 MOE gapmer. In some embodiments, the gapmer is a 6-8-4 MOE gapmer. In some embodiments, the gapmer is a 5-8-5 MOE gapmer. In some embodiments, the gapmer has a glycosyl sequence from 5' to 3': eeeeeeddddddddddeeeee, eeeeeeddddddddddeeeeee, eeeeddddddddddeeeeee, eeeeddddddddddeeeeee, eeeeeeddddddddeeeeee, or eeeeeeddddddddeeeeeee, where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety and 'e' represents the 2'-MOE sugar moiety. In some embodiments, the gapmer contains a 2'-substituted nucleoside. In some embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In some embodiments, the 2'-substituted nucleoside is located at position 2 (5' to 3') of the gap.

[0653] In some embodiments, the modified oligonucleotide does not contain a bicyclic sugar moiety. In some embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In some embodiments, the modified oligonucleotide contains one or two flanking fragments containing nucleosides that are not bicyclic nucleotides. In some embodiments, the modified oligonucleotide does not contain an LNA sugar moiety. In some embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In some embodiments, the modified oligonucleotide contains one or two flanking fragments containing nucleosides that are not LNA nucleotides.

[0654] In some embodiments, the internucleotide bonds of the modified oligonucleotide are phosphate thioester internucleotide bonds and phosphodiester internucleotide bonds. In some embodiments, the phosphodiester (“o”) and phosphate thioester (“s”) internucleotide bonds are arranged in a sequence from 5' to 3'. In some embodiments, the modified nucleotide has an internucleotide bond motif (from 5' to 3') of sooooosssssssssssssoss, soooosssssssssssoss, soooossssssssssssoss, soooosssssssssssoss, soooossssssssssoss, or soooossssssssssssoss, where each “s” represents a phosphate thioester internucleotide bond and each “o” represents a phosphodiester internucleotide bond.

[0655] The nucleobase sequences of SEQ ID NO: 1090, 1166, 2484, 2485, 2487, 2493, 2496, 2497, 2498, 2533, 2534, 2535 and 2537 are complementary to the same length portion of nucleobases 243917-244073 in SEQ ID NO: 2.

[0656] Compound IDs: 1250148, 1250149, 1348250, 1348251, 1348253, 1348259, 1348265, 1348266, 1348267, 1348331, 1348332, 1348333, 1348338, 1348342, 1348344, 1348345, 1348347, 1348419, 13484 The nucleobase sequences of 20, 1348421, 1348427, 1348428, 1348435, 1348436, 1348437, 1348920, 1348922, 1348923, 1348925, 1348927, 1348928, 1348929, 1348931, 1348934, 1348935, 1348937 and 1348938 are complementary to the same-length portions of nucleobases 243917-244073 in SEQ ID NO: 2.

[0657] In some embodiments, oligonucleotides modified with complementarity to the equal-length portion of SEQ ID NO: 2 (nucleotides 243917-244073) achieved an in vitro reduction of SCN2A RNA of at least 80% in a standard in vitro assay. In some embodiments, oligonucleotides modified with complementarity to the equal-length portion of SEQ ID NO: 2 (nucleotides 243917-244073) achieved an average in vitro reduction of SCN2A RNA of 80.5% in a standard in vitro assay. In some embodiments, oligonucleotides modified with complementarity to the equal-length portion of SEQ ID NO: 2 (nucleotides 243917-244073) achieved an average in vivo reduction of SCN2A RNA of 67.7% in a standard in vivo assay. In some embodiments, oligonucleotides modified with complementarity to the equal-length portion of SEQ ID NO: 2 (nucleotides 243917-244073) achieved an average in vivo reduction of SCN2A RNA of 62.1% in a standard in vivo assay.

[0658] 5. Nucleobases 4389-4487 of SEQ ID NO: 1 or SEQ ID NO: 2 Nucleotide bases 247823-247921

[0659] In some embodiments, nucleotides 4389-4487 of SEQ ID NO: 1 or nucleotides 247823-247921 of SEQ ID NO: 2 contain a hotspot region. In some embodiments, the modified oligonucleotide is complementary to the iso-length portion within nucleotides 4389-4487 of SEQ ID NO: 1 or nucleotides 247823-247921 of SEQ ID NO: 2. In some embodiments, the modified oligonucleotide is 20 nucleotides long. In some embodiments, the modified oligonucleotide is 18 nucleotides long. In some embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleotides long. In some embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In some embodiments, the modified oligonucleotide is a gapmer.

[0660] In some embodiments, the gapmer is a 5-10-5 MOE gapmer. In some embodiments, the gapmer is a 6-10-4 MOE gapmer. In some embodiments, the gapmer is a 4-10-6 MOE gapmer. In some embodiments, the gapmer is a 4-8-6 MOE gapmer. In some embodiments, the gapmer is a 6-8-4 MOE gapmer. In some embodiments, the gapmer is a 5-8-5 MOE gapmer. In some embodiments, the gapmer has a glycosyl sequence from 5' to 3': eeeeeeddddddddddeeeee, eeeeeeddddddddddeeeeee, eeeeddddddddddeeeeee, eeeeddddddddddeeeeee, eeeeeeddddddddeeeeee, or eeeeeeddddddddeeeeeee, where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety and 'e' represents the 2'-MOE sugar moiety. In some embodiments, the gapmer contains a 2'-substituted nucleoside. In some embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In some embodiments, the 2'-substituted nucleoside is located at position 2 (5' to 3') of the gap.

[0661] In some embodiments, the modified oligonucleotide does not contain a bicyclic sugar moiety. In some embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In some embodiments, the modified oligonucleotide contains one or two flanking fragments containing nucleosides that are not bicyclic nucleotides. In some embodiments, the modified oligonucleotide does not contain an LNA sugar moiety. In some embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In some embodiments, the modified oligonucleotide contains one or two flanking fragments containing nucleosides that are not LNA nucleotides.

[0662] In some embodiments, the internucleotide bonds of the modified oligonucleotide are phosphate thioester internucleotide bonds and phosphodiester internucleotide bonds. In some embodiments, the phosphodiester (“o”) and phosphate thioester (“s”) internucleotide bonds are arranged in a sequence from 5’ to 3’. In some embodiments, the modified nucleotide has an internucleotide bond motif of sooooos ...

[0663] The nucleobase sequences of SEQ ID NO: 29, 30, 107, 108, 185, 186, 263, 264, 341, 342, 419, 420, 1796, 1871, 1948, 2025, 2101, 2178, 2254, 2330, 2503, 2517 and 2522 are complementary to the same length portions of nucleobases 4389-4487 of SEQ ID NO: 1 or nucleobases 247823-247921 of SEQ ID NO: 2.

[0664] The nucleobase sequences of compounds IDs 910009, 910010, 910011, 910012, 910013, 910014, 910015, 910016, 910017, 910018, 910019, 910020, 1248528, 1248529, 1248530, 1248531, 1248532, 1248533, 1248534, 1248535, 1348269, 1348270, 1348271, 1348275, 1348277, 1348348, 1348353, 1348355, 1348356, 1348396, and 1348450 are consistent with SEQ ID NO. The equal-length portions within nuclei 4389-4487 of SEQ ID NO: 1 or nuclei 247823-247921 of SEQ ID NO: 2 are complementary.

[0665] In some embodiments, oligonucleotides modified with complementarity to the equal-length portions of SEQ ID NO: 1 (nucleotides 4389-4487) or SEQ ID NO: 2 (nucleotides 247823-247921) achieved an in vitro reduction of SCN2A RNA by at least 27% in a standard in vitro assay. In some embodiments, oligonucleotides modified with complementarity to the equal-length portions of SEQ ID NO: 1 (nucleotides 4389-4487) or SEQ ID NO: 2 (nucleotides 247823-247921) achieved an average in vitro reduction of SCN2A RNA by 71.1% in a standard in vitro assay. In some embodiments, oligonucleotides modified with complementarity to the equal-length portions of SEQ ID NO: 1 (nucleotides 4389-4487) or SEQ ID NO: 2 (nucleotides 247823-247921) achieved an average in vivo reduction of SCN2A RNA by 63.4% in a standard in vivo assay. In some embodiments, modified oligonucleotides complementary to the same-length portions within SEQ ID NO: 1 (bases 4389-4487) or SEQ ID NO: 2 (bases 247823-247921) achieved an average 59.1% reduction in SCN2A RNA in vivo in standard in vivo assays.

[0666] 6. Nucleobases 4774-4809 of SEQ ID NO: 1 or SEQ ID NO: 2 Nucleotide bases 254142-254177

[0667] In some embodiments, nucleotides 4774-4809 of SEQ ID NO: 1 or nucleotides 254142-254177 of SEQ ID NO: 2 contain hotspot regions. In some embodiments, the modified oligonucleotide is complementary to the iso-length portion within nucleotides 4774-4809 of SEQ ID NO: 1 or nucleotides 254142-254177 of SEQ ID NO: 2. In some embodiments, the modified oligonucleotide is 20 nucleotides long. In some embodiments, the modified oligonucleotide is 18 nucleotides long. In some embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleotides long. In some embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In some embodiments, the modified oligonucleotide is a gapmer.

[0668] In some embodiments, the gapmer is a 5-10-5 MOE gapmer. In some embodiments, the gapmer is a 6-10-4 MOE gapmer. In some embodiments, the gapmer is a 4-10-6 MOE gapmer. In some embodiments, the gapmer is a 4-8-6 MOE gapmer. In some embodiments, the gapmer is a 6-8-4 MOE gapmer. In some embodiments, the gapmer is a 5-8-5 MOE gapmer. In some embodiments, the gapmer has a glycosyl sequence from 5' to 3': eeeeeeddddddddddeeeee, eeeeeeddddddddddeeeeee, eeeeddddddddddeeeeee, eeeeddddddddddeeeeee, eeeeeeddddddddeeeeee, or eeeeeeddddddddeeeeeee, where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety and 'e' represents the 2'-MOE sugar moiety. In some embodiments, the gapmer contains a 2'-substituted nucleoside. In some embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In some embodiments, the 2'-substituted nucleoside is located at position 2 (5' to 3') of the gap.

[0669] In some embodiments, the modified oligonucleotide does not contain a bicyclic sugar moiety. In some embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In some embodiments, the modified oligonucleotide contains one or two flanking fragments containing nucleosides that are not bicyclic nucleotides. In some embodiments, the modified oligonucleotide does not contain an LNA sugar moiety. In some embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In some embodiments, the modified oligonucleotide contains one or two flanking fragments containing nucleosides that are not LNA nucleotides.

[0670] In some embodiments, the internucleotide bonds of the modified oligonucleotide are phosphate thioester internucleotide bonds and phosphodiester internucleotide bonds. In some embodiments, the phosphodiester (“o”) and phosphate thioester (“s”) internucleotide bonds are arranged in a sequence from 5' to 3'. In some embodiments, the modified nucleotide has an internucleotide bond motif (from 5' to 3') of sooooossssssssssssss, soooossssssssssssss, soooosssssssssssss, soooosssssssssssss, or soooossssssssssss, where each “s” represents a phosphate thioester internucleotide bond and each “o” represents a phosphodiester internucleotide bond.

[0671] The nucleobase sequences of SEQ ID NO: 1016, 1093, 1104, 1169, 1246, 1323, 1400, 1477, 1554, 1708, 1785, 1860, 1937, 2014, 1631, 2090 and 2539 are complementary to the same length portions of nucleobases 4774-4809 of SEQ ID NO: 1 or nucleobases 254142-254177 of SEQ ID NO: 2.

[0672] The nucleobase sequences of compounds IDs 1248544, 1250225, 1250226, 1250227, 1250228, 1250229, 1250230, 1250231, 1250232, 1250233, 1250234, 1250235, 1250236, 1250237, 1250238, 1250239, 1348936, and 1348939 are complementary to the same length portions of nucleobases 4774-4809 of SEQ ID NO: 1 or nucleobases 254142-254177 of SEQ ID NO: 2.

[0673] In some embodiments, oligonucleotides modified with complementarity to the equal-length portions of SEQ ID NO: 1 (nucleotides 4774-4809) or SEQ ID NO: 2 (nucleotides 254142-254177) achieved an in vitro reduction of SCN2A RNA by at least 51% in a standard in vitro assay. In some embodiments, oligonucleotides modified with complementarity to the equal-length portions of SEQ ID NO: 1 (nucleotides 4774-4809) or SEQ ID NO: 2 (nucleotides 254142-254177) achieved an average in vitro reduction of SCN2A RNA by 89% in a standard in vitro assay. In some embodiments, oligonucleotides modified with complementarity to the equal-length portions of SEQ ID NO: 1 (nucleotides 4774-4809) or SEQ ID NO: 2 (nucleotides 254142-254177) achieved an average in vivo reduction of SCN2A RNA by 74.8% in a standard in vivo assay. In some embodiments, modified oligonucleotides complementary to the same length portions within SEQ ID NO: 1 (nucleotides 4774-4809) or SEQ ID NO: 2 (nucleotides 254142-254177) achieved an average 67.8% reduction in SCN2A RNA in vivo in standard in vivo assays.

[0674] 7. Other hotspot areas

[0675] In some embodiments, the ranges described in the table below include hotspot regions. Each hotspot region begins with the nucleus of SEQ ID NO: 2 identified in the "Start Site SEQ ID NO: 2" column and ends with the nucleus of SEQ ID NO: 2 identified in the "Termination Site SEQ ID NO: 2" column. In some embodiments, the modified oligonucleotide is complementary to an iso-length portion within any of the hotspot regions 1-17, as defined in the table below. In some embodiments, the modified oligonucleotide is 20 nucleosides long. In some embodiments, the modified oligonucleotide is 18 nucleosides long. In some embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleosides long. In some embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In some embodiments, the modified oligonucleotide is a gapmer.

[0676] In some embodiments, the gapmer is a 5-10-5 MOE gapmer. In some embodiments, the gapmer is a 6-10-4 MOE gapmer. In some embodiments, the gapmer is a 4-10-6 MOE gapmer. In some embodiments, the gapmer is a 4-8-6 MOE gapmer. In some embodiments, the gapmer is a 6-8-4 MOE gapmer. In some embodiments, the gapmer is a 5-8-5 MOE gapmer. In some embodiments, the gapmer has a glycosyl sequence from 5' to 3': eeeeeeddddddddddeeeee, eeeeeeddddddddddeeeeee, eeeeddddddddddeeeeee, eeeeddddddddddeeeeee, eeeeeeddddddddeeeeee, or eeeeeeddddddddeeeeeee, where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety and 'e' represents the 2'-MOE sugar moiety. In some embodiments, the gapmer contains a 2'-substituted nucleoside. In some embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In some embodiments, the 2'-substituted nucleoside is located at position 2 (5' to 3') of the gap.

[0677] In some embodiments, the modified oligonucleotide does not contain a bicyclic sugar moiety. In some embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In some embodiments, the modified oligonucleotide contains one or two flanking fragments containing nucleosides that are not bicyclic nucleotides. In some embodiments, the modified oligonucleotide does not contain an LNA sugar moiety. In some embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In some embodiments, the modified oligonucleotide contains one or two flanking fragments containing nucleosides that are not LNA nucleotides.

[0678] In some embodiments, the internucleotide bonds of the modified oligonucleotide are phosphate thioester internucleotide bonds and phosphodiester internucleotide bonds. In some embodiments, the phosphodiester (“o”) and phosphate thioester (“s”) internucleotide bonds are arranged in a sequence from 5' to 3'. In some embodiments, the modified nucleotide has an internucleotide bond motif (from 5' to 3') of sooooosssssssssssssoss, soooosssssssssssoss, soooossssssssssssoss, soooosssssssssssoss, soooossssssssssoss, or soooossssssssssssoss, where each “s” represents a phosphate thioester internucleotide bond and each “o” represents a phosphodiester internucleotide bond.

[0679] The nucleobase sequences of the compounds listed in the "Compound ID within the Scope" column of the table below are complementary to SEQ ID NO: 2 within the specified hotspot region. The nucleobase sequences of the oligonucleotides listed in the "SEQ ID NO" column of the table below are complementary to the target sequence SEQ ID NO: 2 within the specified hotspot region.

[0680] In some embodiments, the modified oligonucleotides complementary to the nucleobases in the hotspot region achieve at least a “minimum in vitro reduction percentage” (minimum reduction percentage relative to untreated control cells) of in vitro SCN2A RNA in the standard in vitro assays shown in the table below. In some embodiments, the modified oligonucleotides complementary to the nucleobases in the hotspot region achieve the average “mean in vitro reduction percentage” (mean reduction percentage relative to untreated control cells) of in vitro SCN2A RNA in the standard in vitro assays shown in the table below. In some embodiments, the modified oligonucleotides complementary to the nucleobases in the hotspot region achieve the maximum “maximum in vitro reduction percentage” (maximum reduction percentage relative to untreated control cells) of in vitro SCN2A RNA in the standard in vitro assays shown in the table below. In some embodiments, the modified oligonucleotides complementary to the nucleobases in the hotspot region achieve the average “mean in vivo cortical reduction percentage” of in vivo SCN2A RNA in the standard in vivo assays in cortical tissue shown in the table below. In some embodiments, the modified oligonucleotides complementary to the nucleobases in the hotspot region achieve the average “mean in vivo spinal cord reduction percentage” of in vivo SCN2A RNA in the standard in vivo assays in cortical spinal cord tissue shown in the table below. "nd" indicates that no in vivo data are available for compounds within this range. In other cases, the average in vivo reduction includes a subset of any given hotspot compounds, since not all compounds are tested in vivo.

[0681] Table 1

[0682] SCN2A Hotspot

[0683]

[0684]

[0685]

[0686]

[0687] IX. Some comparative compounds

[0688] In the experiment described in Example 4 of this specification, comparative compound 1506060 was selected as the comparative compound. Comparative compound 1506060, previously described in WO2020 / 041348 (incorporated herein by reference), is a 4-8-4 LNAgapmer with the sequence (from 5' to 3') TGGGTCTCTTAGCTTT (SEQ ID NO: 2540), wherein the central interspace fragment consists of eight 2'-β-D-deoxynucleosides, and the 5' and 3' flanking fragments each consist of four LNA-modified nucleosides, with each nucleoside internucleotide being a phosphate thioate internucleotide bond.

[0689] In some embodiments, the compounds described herein are more tolerable than comparative compound 1506060.

[0690] For example, as described herein (see Example 4), the 3-hour FOB of the control compound 1506060 in mice was 6.00, while the 3-hour FOB of compounds 1348290, 1348331, and 1348347 in mice was 0.00, and the 3-hour FOB of compounds 1348259, 1348289, and 1348937 in mice was 0 or 1.00. Therefore, in this assay, some of the compounds described herein were more tolerable than the control compound 1506060.

[0691] Non-restrictive disclosure and inclusion by reference

[0692] Each of the literature and patent publications listed in this article is incorporated in its entirety by reference.

[0693] Although some compounds, ingredients and methods described herein have been implemented according to certain embodiments

[0694] A detailed description has been provided, but the examples below are for illustrative purposes only.

[0695] The compounds described herein are not intended to be limiting. Every reference, GenBank accession number, etc., cited in this application is incorporated herein by reference in its entirety.

[0696] Although the sequence listing accompanying this document identifies each sequence as “RNA” or “DNA” as needed, in practice, these sequences can be modified with any combination of chemical modifications. Those skilled in the art will readily understand that, in some cases, the name “RNA” or “DNA” used to describe a modified oligonucleotide is arbitrary. For example, an oligonucleotide containing a nucleoside with a 2'-OH sugar moiety and a thymine base can be described as DNA with a modified sugar (2'-OH replacing a 2'-H in DNA) or RNA with a modified base (thymine (methylated uracil) replacing uracil in RNA). Therefore, the nucleic acid sequences provided herein, including but not limited to those in the sequence listing, are intended to cover nucleic acids containing any combination of native or modified RNA and / or DNA, including but not limited to such nucleic acids with modified nucleobases. As a further example, and not a limitation, oligomers having the nucleobase sequence “ATCGATCG” encompass any oligomer having such a nucleobase sequence, whether modified or unmodified, including but not limited to such compounds containing RNA bases, such as compounds having the sequence “AUCGAUCG” and compounds having some DNA bases and some RNA bases (such as “AUCGATCG”), as well as those with other modified nucleobases (such as “AT”). m "CGAUCG", among which m C indicates an oligomeric compound containing a cytosine base with a methyl group at position 5.

[0697] Some of the compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric centers, thus producing enantiomers, diastereomers, and other stereoisomers, which, according to absolute stereochemistry, may be defined as (R) or (S), α or β (such as glycoanomers), or (D) or (L) (such as amino acids). The compounds depicted or described herein as having certain stereoisomers include only the specified compounds. Unless otherwise stated, the compounds described or drawn with undefined stereochemistry herein include all such possible isomers, including their stereorandom and optically pure forms. Similarly, unless otherwise stated, all cis and trans isomers and tautomers of the compounds herein are also included. The oligomeric compounds described herein include mixtures of chiral purity or enrichment, as well as racemic mixtures. For example, oligomeric compounds having multiple thiophosphate nucleoside internucleotide bonds include such compounds, wherein the chirality of the thiophosphate nucleoside internucleotide bonds is controlled or random. Unless otherwise stated, the compounds described herein are intended to include the corresponding salt forms.

[0698] The compounds described herein include variants in which one or more atoms are replaced by non-radioactive or radioactive isotopes of the element shown. For example, the compounds contained in this article cover...1 All possible deuterium substitutions in each of the hydrogen atoms. The isotopic substitutions covered in this article include, but are not limited to: or substitutions. 1 H 2 H or 3 H, replacing 12 C 13 C or 14 C, replacing 14 N of 15 N, replacing 16 O 17 O or 18 O and substitution 32 S 33 S, 34 S, 35 S or 36 S. In some embodiments, non-radioactive isotope substitution can impart new properties to the oligomeric compound, which are beneficial for use as a therapeutic or research tool. In some embodiments, radioactive isotope substitution can make the compound suitable for research or diagnostic purposes, such as imaging.

[0699] Example

[0700] The following examples illustrate certain embodiments of this disclosure, but are not limiting. Furthermore, where specific embodiments are provided, the inventors have considered the general application of those specific embodiments. For example, the disclosure of oligonucleotides having a specific motif provides reasonable support for other oligonucleotides having the same or similar motifs. And, for example, when a specific high-affinity modification appears at a specific position, other high-affinity modifications at the same position are considered appropriate, unless otherwise stated.

[0701] Example 1: Effect of 5-10-5 MOE gapmer-modified oligonucleotides on human SCN2A RNA in vitro, single dose

[0702] Modified oligonucleotides complementary to human SCN2A nucleic acid were designed, and their single-dose effects on SCN2A RNA were tested in vitro. The modified oligonucleotides were tested in a series of experiments with similar culture conditions.

[0703] The modified oligonucleotides in the table below are 5-10-5 MOE gapmers with mixed PO / PS nucleotide internucleotide bonds. The gapmer is 20 nucleotides long, with the central interstitial segment consisting of ten 2'-β-D-deoxynucleotides, and the 5' and 3' flanking segments each consisting of five 2'-MOE-modified nucleotides. The glycosylation motif of the gapmer (from 5' to 3') is: eeeeddddddddddeeeee; where 'd' represents the 2'-β-D-deoxyribosyl sugar and 'e' represents the 2'-MOE sugar moiety. The nucleotide internucleotide bond motif of the gapmer (from 5' to 3') is: soooosssssssssssooss; where each "o" represents a phosphodiester nucleotide internucleotide bond and each "s" represents a phosphothiophosphate nucleotide internucleotide bond. Each cytosine residue is 5-methylcytosine.

[0704] “Start site” indicates the 5'-terminal nucleoside complementary to the modified oligonucleotide in the target nucleic acid sequence. “Termination site” indicates the 3'-terminal nucleoside complementary to the modified oligonucleotide in the target nucleic acid sequence. Each modified oligonucleotide listed in the table below is 100% complementary to human SCN2A mRNA (designated in this paper as SEQ ID NO: 1 (GENBANK accession number NM_001040142.2)) or human SCN2A genome sequence (designated in this paper as SEQ ID NO: 2 ((GENBANK accession number NC_000002.12, truncated from nucleotide 165127001 to 165395000)), or both. 'N / A' indicates that the modified oligonucleotide is not 100% complementary to the specific target nucleic acid sequence.

[0705] Cultured SH-SY5Y cells were electroporated at a density of 20,000 cells / well using modified oligonucleotides at concentrations of 4000 or 5000 nM. After a treatment period of approximately 24 hours, total RNA was isolated from the cells, and SCN2A RNA levels were measured by quantitative real-time RT-PCR. SCN2A RNA levels were measured using the human primer probe set RTS36041 (forward sequence CCTTGAACCTGAAGCCTGTT, designated SEQ ID NO: 10; reverse sequence CGAACCAATTGTGCTCCACTA, designated SEQ ID NO: 11; probe sequence TTCCACCAGAGTTTCCCTTTGCCT, designated SEQ ID NO: 12). SCN2A RNA levels were normalized to total RNA content, as shown by... Measured. The reduction in SCN2A RNA is expressed in the table below as a percentage (% control) of the amount of SCN2A RNA relative to the amount in untreated control cells. Each table represents results from a single assay plate. (The table is labeled with...) The value indicates that the modified oligonucleotide is complementary to the amplicon region of the primer-probe set. Additional assays can be used to measure the potency and efficacy of modified oligonucleotides complementary to the amplicon region.

[0706] Table 2

[0707] In SH-SY5Y cells, a 5-10-5 MOE gapmer with a mixed PO / PS nucleotide interpeptide concentration of 5000 nM reduces SCN2A RNA.

[0708]

[0709]

[0710] Table 3

[0711] In SH-SY5Y cells, a 5000 nM concentration of 5-10-5 MOE gapmer containing mixed PO / PS nucleotide bonds reduces SCN2A RNA.

[0712]

[0713]

[0714]

[0715] Table 4

[0716] In SH-SY5Y cells, a 5-10-5 MOE gapmer with a mixed PO / PS nucleotide interpeptide concentration of 5000 nM reduces SCN2A RNA.

[0717]

[0718]

[0719]

[0720] Table 5

[0721] In SH-SY5Y cells, a 5-10-5 MOE gapmer with a mixed PO / PS nucleotide interpeptide concentration of 5000 nM reduces SCN2A RNA.

[0722]

[0723]

[0724]

[0725] Table 6

[0726] In SH-SY5Y cells, a 5-10-5 MOE gapmer with a mixed PO / PS nucleotide interpeptide concentration of 5000 nM reduces SCN2A RNA.

[0727]

[0728]

[0729]

[0730] Table 7

[0731] In SH-SY5Y cells, a 5-10-5 MOE gapmer with a mixed PO / PS nucleotide interpeptide concentration of 5000 nM reduces SCN2A RNA.

[0732]

[0733]

[0734]

[0735] Table 8

[0736] In SH-SY5Y cells, a 4000 nM concentration of 5-10-5 MOE gapmer containing mixed PO / PS nucleotide bonds reduces SCN2A RNA.

[0737]

[0738]

[0739]

[0740] Table 9

[0741] In SH-SY5Y cells, a 4000 nM concentration of 5-10-5 MOE gapmer containing mixed PO / PS nucleotide bonds reduces SCN2A RNA.

[0742]

[0743]

[0744]

[0745] Table 10

[0746] In SH-SY5Y cells, a 4000 nM concentration of 5-10-5 MOE gapmer containing mixed PO / PS nucleotide bonds reduces SCN2A RNA.

[0747]

[0748]

[0749]

[0750] Table 11

[0751] In SH-SY5Y cells, a 4000 nM concentration of 5-10-5 MOE gapmer containing mixed PO / PS nucleotide bonds reduces SCN2A RNA.

[0752]

[0753]

[0754]

[0755] Table 12

[0756] In SH-SY5Y cells, a 4000 nM concentration of 5-10-5 MOE gapmer containing mixed PO / PS nucleotide bonds reduces SCN2A RNA.

[0757]

[0758]

[0759]

[0760] Table 13

[0761] In SH-SY5Y cells, a 4000 nM concentration of 5-10-5 MOE gapmer containing mixed PO / PS nucleotide bonds reduces SCN2A RNA.

[0762]

[0763]

[0764]

[0765] Table 14

[0766] In SH-SY5Y cells, a 4000 nM concentration of 5-10-5 MOE gapmer containing mixed PO / PS nucleotide bonds reduces SCN2A RNA.

[0767]

[0768]

[0769]

[0770] Table 15

[0771] In SH-SY5Y cells, a 4000 nM concentration of 5-10-5 MOE gapmer containing mixed PO / PS nucleotide bonds reduces SCN2A RNA.

[0772]

[0773]

[0774]

[0775] Table 16

[0776] In SH-SY5Y cells, a 4000 nM concentration of 5-10-5 MOE gapmer containing mixed PO / PS nucleotide bonds reduces SCN2A RNA.

[0777]

[0778]

[0779]

[0780] Table 17

[0781] In SH-SY5Y cells, a 4000 nM concentration of 5-10-5 MOE gapmer containing mixed PO / PS nucleotide bonds reduces SCN2A RNA.

[0782]

[0783]

[0784]

[0785] Table 18

[0786] In SH-SY5Y cells, a 4000 nM concentration of 5-10-5 MOE gapmer containing mixed PO / PS nucleotide bonds reduces SCN2A RNA.

[0787]

[0788]

[0789]

[0790] Table 19

[0791] In SH-SY5Y cells, a 4000 nM concentration of 5-10-5 MOE gapmer containing mixed PO / PS nucleotide bonds reduces SCN2A RNA.

[0792]

[0793]

[0794]

[0795] Table 20

[0796] In SH-SY5Y cells, a 4000 nM concentration of 5-10-5 MOE gapmer containing mixed PO / PS nucleotide bonds reduces SCN2A RNA.

[0797]

[0798]

[0799] Table 21

[0800] In SH-SY5Y cells, a 4000 nM concentration of 5-10-5 MOE gapmer containing mixed PO / PS nucleotide bonds reduces SCN2A RNA.

[0801]

[0802]

[0803]

[0804] Table 22

[0805] In SH-SY5Y cells, a 4000 nM concentration of 5-10-5 MOE gapmer containing mixed PO / PS nucleotide bonds reduces SCN2A RNA.

[0806]

[0807]

[0808]

[0809] Table 23

[0810] In SH-SY5Y cells, a 4000 nM concentration of 5-10-5 MOE gapmer containing mixed PO / PS nucleotide bonds reduces SCN2A RNA.

[0811]

[0812]

[0813]

[0814] Table 24

[0815] In SH-SY5Y cells, a 4000 nM concentration of 5-10-5 MOE gapmer containing mixed PO / PS nucleotide bonds reduces SCN2A RNA.

[0816]

[0817]

[0818]

[0819] Table 25

[0820] In SH-SY5Y cells, a 4000 nM concentration of 5-10-5 MOE gapmer containing mixed PO / PS nucleotide bonds reduces SCN2A RNA.

[0821]

[0822]

[0823]

[0824] Table 26

[0825] In SH-SY5Y cells, a 4000 nM concentration of 5-10-5 MOEgapmer containing mixed PO / PS nucleotide internucleotides reduces SCN2A RNA.

[0826]

[0827]

[0828]

[0829] Table 27

[0830] In SH-SY5Y cells, a 4000 nM concentration of 5-10-5 MOE gapmer containing mixed PO / PS nucleotide bonds reduces SCN2A RNA.

[0831]

[0832]

[0833]

[0834] Table 28

[0835] In SH-SY5Y cells, a 4000 nM concentration of 5-10-5 MOE gapmer containing mixed PO / PS nucleotide bonds reduces SCN2A RNA.

[0836]

[0837]

[0838]

[0839] Table 29

[0840] In SH-SY5Y cells, a 4000 nM concentration of 5-10-5 MOE gapmer containing mixed PO / PS nucleotide bonds reduces SCN2A RNA.

[0841]

[0842]

[0843]

[0844] Table 30

[0845] In SH-SY5Y cells, a 4000 nM concentration of 5-10-5 MOE gapmer containing mixed PO / PS nucleotide bonds reduces SCN2A RNA.

[0846]

[0847]

[0848]

[0849] Table 31

[0850] In SH-SY5Y cells, a 4000 nM concentration of 5-10-5 MOE gapmer containing mixed PO / PS nucleotide bonds reduces SCN2A RNA.

[0851]

[0852]

[0853]

[0854] Table 32

[0855] In SH-SY5Y cells, a 4000 nM concentration of 5-10-5 MOE gapmer containing mixed PO / PS nucleotide bonds reduces SCN2A RNA.

[0856]

[0857]

[0858]

[0859] Table 33

[0860] In SH-SY5Y cells, a 4000 nM concentration of 5-10-5 MOE gapmer containing mixed PO / PS nucleotide bonds reduces SCN2A RNA.

[0861]

[0862]

[0863]

[0864] Example 2: Effects of modified oligonucleotides on human SCN2A RNA in vitro, multiple doses

[0865] Modified oligonucleotides selected from Example 1 above were tested in SH-SY5Y cells at different doses. SH-SY5Y cells cultured at a density of 20,000 cells / well were treated with various concentrations of modified oligonucleotides via electroporation, as shown in the table below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells, and SCN2A RNA levels were measured by quantitative real-time RT-PCR. The human SCN2A primer-probe set RTS36041 (described in Example 1 of this document) was used to measure RNA levels as described above. SCN2A RNA levels were normalized to total RNA content, as shown by... The reduction in SCN2A RNA was measured. The reduction is expressed in the table below as a percentage (% control) of the amount of SCN2A RNA relative to the amount in untreated control cells.

[0866] Half-maximum inhibition concentration (IC50) of each modified oligonucleotide 50 The calculation is performed using a linear regression of the log / linear graph of the data in Excel.

[0867] Table 34

[0868] Modified oligonucleotides dose-dependently reduced human SCN2A RNA in SH-SY5Y cells

[0869]

[0870] Table 35

[0871] Modified oligonucleotides dose-dependently reduced human SCN2A RNA in SH-SY5Y cells

[0872]

[0873]

[0874] Table 36

[0875] Modified oligonucleotides dose-dependently reduced human SCN2A RNA in SH-SY5Y cells

[0876]

[0877] Table 37

[0878] Modified oligonucleotides dose-dependently reduced human SCN2A RNA in SH-SY5Y cells

[0879]

[0880]

[0881] Table 38

[0882] Modified oligonucleotides dose-dependently reduced human SCN2A RNA in SH-SY5Y cells

[0883]

[0884] Table 39

[0885] Modified oligonucleotides dose-dependently reduced human SCN2A RNA in SH-SY5Y cells

[0886]

[0887]

[0888] Table 40

[0889] Modified oligonucleotides dose-dependently reduced human SCN2A RNA in SH-SY5Y cells

[0890]

[0891] Table 41

[0892] Modified oligonucleotides dose-dependently reduced human SCN2A RNA in SH-SY5Y cells

[0893]

[0894] Table 42

[0895] Modified oligonucleotides dose-dependently reduced human SCN2A RNA in SH-SY5Y cells

[0896]

[0897]

[0898] Table 43

[0899] Modified oligonucleotides dose-dependently reduced human SCN2A RNA in SH-SY5Y cells

[0900]

[0901] Table 44

[0902] Modified oligonucleotides dose-dependently reduced human SCN2A RNA in SH-SY5Y cells

[0903]

[0904]

[0905] Table 45

[0906] Modified oligonucleotides dose-dependently reduced human SCN2A RNA in SH-SY5Y cells

[0907]

[0908] Table 46

[0909] Modified oligonucleotides dose-dependently reduced human SCN2A RNA in SH-SY5Y cells

[0910]

[0911]

[0912] Table 47

[0913] Modified oligonucleotides dose-dependently reduced human SCN2A RNA in SH-SY5Y cells

[0914]

[0915] Table 48

[0916] Modified oligonucleotides dose-dependently reduced human SCN2A RNA in SH-SY5Y cells

[0917]

[0918] Table 49

[0919] Modified oligonucleotides dose-dependently reduced human SCN2A RNA in SH-SY5Y cells

[0920]

[0921]

[0922] Table 50

[0923] Modified oligonucleotides dose-dependently reduced human SCN2A RNA in SH-SY5Y cells

[0924]

[0925] Example 3: Design of MOE gapmer-modified oligonucleotides complementary to human SCN2A nucleic acid

[0926] As described in the table below, modified oligonucleotides complementary to human SCN2A nucleic acid were designed. In the table below, "start site" indicates the 5'-terminal nucleoside complementary to the modified oligonucleotide in the target nucleic acid sequence. "stop site" indicates the 3'-terminal nucleoside complementary to the modified oligonucleotide in the target nucleic acid sequence. Each modified oligonucleotide listed in the table is 100% complementary to SEQ ID NO: 1 (GENBANK accession number NM_001040142.2) or SEQ ID NO: 2 (GENBANK accession number NC_000002.12, truncated from nucleotide 165127001 to 165395000), or both. 'N / A' indicates that the modified oligonucleotide is not 100% complementary to the specific target nucleic acid sequence.

[0927] The modified oligonucleotides in Table 51 are 5-10-5 MOE Gapmers. The Gapmer is 20 nucleotides in length, with the central interstitial segment consisting of ten 2'-β-D-deoxyribosyl nucleotides, and the 5' and 3' flanking segments each consisting of five 2'-MOE nucleotides. The glycosylation motif of the Gapmer is (from 5' to 3'): eeeeeeddddddddddeeeee; where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety and 'e' represents the 2'-MOE sugar moiety. The Gapmer has an internucleotide bond motif (from 5' to 3'): soooosssssssssssooss; where each "s" represents a phosphate thioester internucleotide bond and each "o" represents a phosphate diester internucleotide bond. Each cytosine residue is 5-methylcytosine.

[0928] Table 51

[0929] 5-10-5 MOE gapmer with mixed PO / PS nucleotide internucleotide bonds complementary to human SCN2A

[0930]

[0931]

[0932] The modified oligonucleotides in Table 52 below are 6-10-4 MOE Gapmers. The Gapmer is 20 nucleotides in length, with the central interstitial segment consisting of ten 2'-β-D-deoxyribosides, the 5' flanking segments consisting of six 2'-MOE nucleotides, and the 3' flanking segments consisting of four 2'-MOE nucleotides. The glycosylation motif of the Gapmer (from 5' to 3') is: eeeeeddddddddddeeee; where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety and 'e' represents the 2'-MOE sugar moiety. The Gapmer has an internucleotide bond motif (from 5' to 3'): soooooossssssssssss; where each "s" represents a phosphate thioester internucleotide bond and each "o" represents a phosphate diester internucleotide bond. Each cytosine residue is 5-methylcytosine.

[0933] Table 52

[0934] A 6-10-4 MOE gapmer with mixed PO / PS nucleotide internucleotide bonds complementary to human SCN2A

[0935]

[0936]

[0937] The modified oligonucleotides in Table 53 below are 4-10-6 MOE gapmers. The gapmer is 20 nucleotides in length, with the central interstitial segment consisting of ten 2'-β-D-deoxyribosides, the 5' flanking segments consisting of four 2'-MOE nucleotides, and the 3' flanking segments consisting of six 2'-MOE nucleotides. The glycosylation motif of the gapmer (from 5' to 3') is: eeeeddddddddddeeeeee; where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety and 'e' represents the 2'-MOE sugar moiety. The gapmer has an internucleotide bond motif (from 5' to 3'): soooossssssssssoooss; where each "s" represents a phosphate thioester internucleotide bond and each "o" represents a phosphate diester internucleotide bond. Each cytosine residue is 5-methylcytosine.

[0938] Table 53 4-10-6 MOE gapmers with mixed PO / PS nucleotide internucleotide bonds complementary to human SCN2A

[0939]

[0940]

[0941] The modified oligonucleotides in Table 54 below are 4-8-6 MOE gapmers. The gapmer is 18 nucleotides in length, with the central interstitial segment consisting of eight 2'-β-D-deoxyribosides, the 5' flanking segments consisting of four 2'-MOE nucleotides, and the 3' flanking segments consisting of six 2'-MOE nucleotides. The glycosylation motif of the gapmer (from 5' to 3') is: eeeeddddddddeeeeee; where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety and 'e' represents the 2'-MOE sugar moiety. The gapmer has an internucleotide bond motif (from 5' to 3'): soosssssssssoooss; where each "s" represents a phosphate thioester internucleotide bond and each "o" represents a phosphate diester internucleotide bond. Each cytosine residue is 5-methylcytosine.

[0942] Table 54

[0943] 4-8-6 MOE gapmer with mixed PO / PS nucleotide internucleotide bonds complementary to human SCN2A

[0944]

[0945]

[0946] The modified oligonucleotides in Table 55 below are 6-8-4 MOE gapmers. The gapmer is 18 nucleotides in length, with the central interstitial segment consisting of eight 2'-β-D-deoxyribosyl nucleotides, the 5' flanking segments consisting of six 2'-MOE nucleotides, and the 3' flanking segments consisting of four 2'-MOE nucleotides. The glycosylation motif of the gapmer (from 5' to 3') is: eeeeeddddddddeeee; where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety and 'e' represents the 2'-MOE sugar moiety. The gapmer has an internucleotide bond motif (from 5' to 3'): soooossssssssssoss; where each "s" represents a phosphate thioester internucleotide bond and each "o" represents a phosphate diester internucleotide bond. Each cytosine residue is 5-methylcytosine.

[0947] Table 55

[0948] 6-8-4 MOE gapmer with mixed PO / PS nucleotide internucleotide bonds complementary to human SCN2A

[0949]

[0950] The modified oligonucleotide in Table 56 is the 5-8-5 MOE gapmer. The gapmer is 18 nucleotides in length, with the central interstitial segment consisting of eight 2'-β-D-deoxyribosides, the 5' flanking segments consisting of five 2'-MOE nucleotides, and the 3' flanking segments consisting of five 2'-MOE nucleotides. The glycosylation motif of the gapmer (from 5' to 3') is: eeeeddddddddeeeee; where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety and 'e' represents the 2'-MOE sugar moiety. The gapmer has an internucleotide bond motif (from 5' to 3'): soooosssssssssooss; where each "s" represents a phosphate thioester internucleotide bond and each "o" represents a phosphate diester internucleotide bond. Each cytosine residue is 5-methylcytosine.

[0951] Table 56

[0952] 5-8-5 MOE gapmer with mixed PO / PS nucleotide internucleotide bonds complementary to human SCN2A

[0953]

[0954]

[0955] Example 4: Tolerance of modified oligonucleotides complementary to human SCN2A in wild-type mice, 3-hour study

[0956] Tolerance to the modified oligonucleotides was assessed in wild-type female C57 / B16 mice. Additionally, the control compound 1506060 was tested. Each wild-type female C57 / B16 mouse received a single ICV dose of the modified oligonucleotide, as listed in the table below. Each treatment group consisted of 3 mice. A group of 4 mice received PBS as a negative control for each experiment (determined in a separate table below). Three hours post-injection, mice were assessed according to seven distinct criteria. The criteria were (1) the mouse was active, alert, and responsive; (2) the mouse stood or bent over without stimulation; (3) the mouse exhibited any movement without stimulation; (4) the mouse exhibited forward movement when lifted; (5) the mouse exhibited any movement when lifted; (6) the mouse responded to tail pinching; and (7) regular breathing. For each of the seven criteria, a score of 0 was given if the mouse met the criteria, and a score of 1 was given if it did not meet the criteria (functional observation combination score or FOB). After assessing all seven criteria, the scores for each mouse were summed and averaged within each treatment group.

[0957] Table 57

[0958] Tolerance score in mice at a dose of 700 μg

[0959]

[0960]

[0961] Table 58

[0962] Tolerance score in mice at a dose of 700 μg

[0963] Compound ID 3-hour FOB PBS 0.00 1248429 1.00 1249990 1.00 1250148 0.00 1250225 0.00

[0964] Table 59

[0965] Tolerance score in mice at a dose of 700 μg

[0966]

[0967]

[0968] Table 60

[0969] Tolerance score in mice at a dose of 700 μg

[0970]

[0971]

[0972] Table 61

[0973] Tolerance score in mice at a dose of 700 μg

[0974]

[0975]

[0976] Table 6. Tolerance scores in mice at a dose of 2700 μg.

[0977]

[0978]

[0979] Table 63

[0980] Tolerance score in mice at a dose of 700 μg

[0981]

[0982]

[0983] Table 64

[0984] Tolerance score in mice at a dose of 700 μg

[0985] Compound ID 3-hour FOB PBS 0.00 1348447 0.00

[0986] Table 65

[0987] Tolerance score in mice at a dose of 700 μg

[0988]

[0989] Table 66

[0990] Tolerance score in mice at a dose of 700 μg

[0991] Compound numbering 3-hour FOB PBS 0.00 1506060 6.00

[0992] Example 5: Tolerance of modified oligonucleotides complementary to human SCN2A in rats, 3 mg dose

[0993] Tolerance to the modified oligonucleotides described above was assessed in rats. Each Sprague-Dawley rat received a single intrathecal (IT) dose of 3 mg of the modified oligonucleotide listed in the table below. Each treatment group consisted of 3–4 rats. A group of 4 rats received PBS as a negative control for each experiment (determined in a separate table below). Three hours after injection, activity at seven different body parts was assessed in each rat. The seven body parts are (1) the rat's tail; (2) the rat's anterior trunk; (3) the rat's hind limbs; (4) the rat's hind paws; (5) the rat's forepaws; (6) the rat's posterior trunk; and (7) the rat's head. For each of the seven different body parts, a subscore of 0 is given to each rat if the body part is active, and a subscore of 1 is given if the body part is paralyzed (Functional Observation Combined Score or FOB). After each of the seven body parts has been assessed, the subscores for each rat are summed, and then averaged for each group. For example, if a rat's tail, head, and all other assessed body parts are active 3 hours after a 3 mg IT dose, its total score will be 0. If another rat is not active in its tail 3 hours after a 3 mg IT dose, but all other assessed body parts are active, it will receive a score of 1. The scores for each treatment group are averaged and shown in the table below. Symbols are marked. The value indicates a group with 3 or fewer animals.

[0994] Table 67

[0995] Tolerance score of rats at a 3 mg dose

[0996]

[0997] Table 68

[0998] Tolerance score of rats at a 3 mg dose

[0999] Compound ID 3-hour FOB PBS 0.00 910009 1.00 1248427 0.00 1248428 1.00 1248431 0.67 1248488 1.33 1248531 0.33 1249989 1.33 1348240 0.33 1348241 0.00 1348242 0.00 1348243 3.00 1348244 1.67 1348245 0.67 1348248 0.33 1348250 3.00 1348251 2.33 1348252 0.33 1348253 1.67 1348254 0.00 1348255 0.33 1348256 1.00 1348257 0.33 1348258 1.00 1348259 0.67 1348263 0.00

[1000] Table 69

[1001] Tolerance score of rats at a 3 mg dose

[1002]

[1003]

[1004] Table 70

[1005] Tolerance score of rats at a 3 mg dose

[1006] Compound ID 3-hour FOB PBS 0.00 1348297 0.33 1348298 1.33 1348299 1.33 1348300 2.33 1348302 0.00 1348303 0.00 1348304 0.33

[1007] Table 71

[1008] Tolerance score of rats at a 3 mg dose

[1009] Compound ID 3-hour FOB PBS 0.00 1348306 0.67 1348307 3.00 1348308 0.00 1348309 1.00 1348310 0.67 1348311 2.00 1348312 2.00 1348313 2.00

[1010] Table 72

[1011] Tolerance score of rats at a 3 mg dose

[1012]

[1013]

[1014] Table 7. Tolerance scores of rats at a dose of 33 mg.

[1015]

[1016]

[1017] Table 74

[1018] Tolerance score of rats at a 3 mg dose

[1019] Compound ID 3-hour FOB PBS 0.25 1348348 0.67 1348350 1.33 1348353 1.67 1348355 0.00 1348356 0.00 1348358 0.00 1348360 2.00 1348361 2.67 1348362 2.00 1348364 2.67 1348365 1.33 1348366 1.00 1348367 1.67 1348369 0.33 1348370 0.33 1348371 0.67 1348373 3.00 1348374 3.33 1348375 0.67 1348392 0.33

[1020] Table 75

[1021] Tolerance score of rats at a 3 mg dose

[1022]

[1023]

[1024] Table 7. Tolerance scores of rats at a dose of 763 mg

[1025]

[1026]

[1027] Table 77

[1028] Tolerance score of rats at a 3 mg dose

[1029] Compound ID 3-hour FOB PBS 0.25 1348315 1.67 1348403 2.00 1348404 1.00 1348405 2.33 1348406 4.00 1348407 0.33 1348408 0.00 1348410 2.00 1348411 2.00 1348412 0.00 1348413 0.67

[1030] Table 78

[1031] Tolerance score of rats at a 3 mg dose

[1032] Compound ID 3-hour FOB PBS 0.00 1348414 3.00 1348415 2.00 1348416 0.67 1348417 0.67 1348418 0.00 1348419 0.00 1348420 2.00 1348421 2.00 1348422 1.33 1348423 3.00

[1033] Table 79

[1034] Tolerance score of rats at a 3 mg dose

[1035] Compound ID 3-hour FOB PBS 0.00 1348439 2.67 1348440 0.33 1348441 1.00 1348442 0.00 1348443 1.00

[1036] Table 80

[1037] Tolerance score of rats at a 3 mg dose

[1038] Compound ID 3-hour FOB PBS 0.00 1348444 0.00 1348445 3.00 1348446 0.00 1348447 0.67

[1039] Table 81

[1040] Tolerance score of rats at a 3 mg dose

[1041]

[1042] Example 6: Effects of modified oligonucleotides on human SCN2A RNA in vitro, multiple doses

[1043] Modified oligonucleotides selected from the above embodiments were tested in SH-SY5Y cells at different doses. SH-SY5Y cells cultured at a density of 20,000 cells / well were treated with various concentrations of modified oligonucleotides via electroporation, as shown in the table below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells, and SCN2A RNA levels were measured by quantitative real-time RT-PCR. The human SCN2A primer-probe set RTS36041 (as described above) was used to measure RNA levels. SCN2A RNA levels were normalized to total RNA content, as measured by GAPDH. GAPDH levels were measured using the human primer-probe set RTS104 (forward sequence GAAGGTGAAGGTCGGAGTC, designated SEQ ID NO: 7; reverse sequence GAAGATGGTGATGGGATTTC, designated SEQ ID NO: 8; probe sequence CAAGCTTCCCGTTCTCAGCC, designated SEQ ID NO: 9). The reduction in SCN2A RNA is expressed as a percentage (% control) of the amount of SCN2A RNA relative to the amount in untreated control cells in the table below. The results of each individual experiment are listed in the table below.

[1044] Half-maximum inhibition concentration (IC50) of each modified oligonucleotide 50 The calculation is performed using a linear regression of the log / linear graph of the data in Excel.

[1045] Table 82

[1046] Modified oligonucleotides dose-dependently reduced human SCN2A RNA in SH-SY5Y cells

[1047]

[1048] Table 83

[1049] Modified oligonucleotides dose-dependently reduced human SCN2A RNA in SH-SY5Y cells

[1050]

[1051]

[1052] Table 84

[1053] Modified oligonucleotides dose-dependently reduced human SCN2A RNA in SH-SY5Y cells

[1054]

[1055] Table 85

[1056] Modified oligonucleotides dose-dependently reduced human SCN2A RNA in SH-SY5Y cells

[1057]

[1058] Table 86

[1059] Modified oligonucleotides dose-dependently reduced human SCN2A RNA in SH-SY5Y cells

[1060]

[1061] Table 87

[1062] Modified oligonucleotides dose-dependently reduced human SCN2A RNA in SH-SY5Y cells

[1063]

[1064] Example 7: Effects of modified oligonucleotides on human SCN2A RNA in vitro, multiple doses

[1065] Modified oligonucleotides selected from the above-described embodiments were tested in SH-SY5Y cells at different doses. SH-SY5Y cells cultured at a density of 35,000 cells / well were treated with various concentrations of modified oligonucleotides via electroporation, as shown in the table below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells, and SCN2A RNA levels were measured by quantitative real-time RT-PCR. The human SCN2A primer-probe set RTS36041 (as described above) was used to measure RNA levels. SCN2A RNA levels were normalized to total RNA content, as measured by GAPDH. GAPDH levels were measured using the human primer-probe set RTS104 (forward sequence GAAGGTGAAGGTCGGAGTC, designated SEQ ID NO: 7; reverse sequence GAAGATGGTGATGGGATTTC, designated SEQ ID NO: 8; probe sequence CAAGCTTCCCGTTCTCAGCC, designated SEQ ID NO: 9). The reduction in SCN2A RNA is shown in the table below as a percentage (% control) of the amount of SCN2A RNA relative to the amount in untreated control cells.

[1066] In Graphpad Prism, the half-maximum inhibitory concentration (IC50) of each modified oligonucleotide is calculated by fitting log(inhibitor) against a normalized response-variable slope curve. 50 ).

[1067] Table 88

[1068] Modified oligonucleotides dose-dependently reduced human SCN2A RNA in SH-SY5Y cells

[1069]

[1070] Example 8: Effects of modified oligonucleotides on human SCN2A in transgenic mice

[1071] The modified oligonucleotides were tested in a human SCN2A transgenic mouse model. Transgenic mice expressing human SCN2A transcripts were generated in a C57B1 / 6 background. Transgenic mice can be prepared and obtained from commercial and academic research institutions; examples of transgenic mice expressing human neurology genes can be found, for example, Heintz et al., 2002, Nature Reviews Neuroscience 2, 861-870.

[1072] treat

[1073] Human SCN2A transgenic mice were divided into groups of 2 mice each. Each mouse received a single dose of modified oligonucleotides via ICV 350 μg. A group of 4 mice received PBS as a negative control.

[1074] RNA analysis

[1075] Two weeks after treatment, mice were sacrificed, and RNA was extracted from the cortical brain tissue and spinal cord. The amount of SCN2A RNA was measured using quantitative real-time RT-PCR analysis with the human primer and probe set RTS36041 (described in Example 1 above). Results were expressed as a percentage of human SCN2A RNA relative to the amount in PBS-treated animals, normalized to mouse GAPDH RNA (% control). Mouse GAPDH RNA was amplified using the primer and probe set mGapdh_LTS00102 (forward sequence GGCAAATTCAACGGCACAGT, named SEQ ID NO: 13; reverse sequence GGGTCTCGCTCCTGGAAGAT, named SEQ ID NO: 14; probe sequence AAGGCCGAGAATGGGAAGCTTGTCATC, named SEQ ID NO: 15).

[1076] As shown in the table below, treatment with modified oligonucleotides resulted in a reduction of SCN2A RNA compared to the PBS control.

[1077] Table 89

[1078] Reduction of human SCN2A RNA in transgenic mice

[1079]

[1080]

[1081]

[1082] Table 90 shows the reduction of human SCN2A RNA in transgenic mice with only one PCR value.

[1083]

[1084]

[1085]

[1086] Table 91 shows the reduction of human SCN2A RNA in transgenic mice with only one PCR value.

[1087]

[1088]

[1089] Table 92

[1090] Reduction of human SCN2A RNA in transgenic mice

[1091]

[1092] Table 93

[1093] Reduction of human SCN2A RNA in transgenic mice

[1094]

[1095]

[1096] Example 9: Efficacy of modified oligonucleotides complementary to human SCN2A RNA in transgenic mice

[1097] The modified oligonucleotides (as described above) were tested in human SCN2A transgenic mice.

[1098] treat

[1099] Human SCN2A transgenic mice were divided into groups of four mice each. Each mouse received a single dose of the modified oligonucleotide via ICV, as shown in the table below. A group of eight mice received PBS as a negative control.

[1100] RNA analysis

[1101] Two weeks after treatment, mice were sacrificed, and RNA was extracted from the cortex and spinal cord. Quantitative real-time RT-PCR analysis of SCN2A RNA expression was performed using the primer and probe set RTS36041 (described in Example 1 of this document). Results were expressed as a percentage of human SCN2A RNA relative to the amount in PBS-treated animals and normalized to mouse GAPDH RNA. Mouse GAPDH was amplified using the primer and probe set mGapdh_LTS00102 (as described above). The half-maximum effective dose (ED50) for each modified oligonucleotide was calculated using GraphPad Prism 7 software (GraphPad Software, San Diego, CA). 50 ). ED 50The values ​​were calculated using a custom equation, Motulsky, based on the dose and individual animal SCN2A RNA levels: agonist versus response - variable slope (four parameters) Y = Bottom + (Top - Bottom) / (1 + (10^logEC50 / X)^HillSlope), with the following constraints: bottom > the lowest value in the dataset for comparison between ASOs (4.5 for cortical and 9.4 for spinal), top = 100, and HillSlope < -1 and > -2.

[1102] As shown in the table below, treatment with modified oligonucleotides resulted in a decrease in the dose-responsiveness of SCN2A RNA compared to the PBS control.

[1103] Table 94

[1104] Reduction of human SCN2A RNA in transgenic mice

[1105]

[1106]

Claims

1. An oligomeric compound comprising a 6-10-4 MOE gapmer having a sequence from 5' to 3' CCACGACATATTTTTCTACA (SEQ ID NO:2510); Each of the nucleosides 1-6 and 17-20 from 5' to 3' is a 2'-MOE nucleoside, and each of the nucleosides 7-16 is a 2'-β-D-deoxy nucleoside. The inter-nucleoside bonds between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester inter-nucleoside bonds, while the inter-nucleoside bonds between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are thiophosphate inter-nucleoside bonds. Each cytosine is a 5-methylcytosine; and 2'-MOE nucleoside refers to a nucleoside containing a 2'-MOE sugar moiety; and the 2'-MOE sugar moiety refers to the sugar moiety in which the 2'-OH group of the furanose group is replaced by the -OCH2CH2OCH3 group.

2. A pharmaceutical composition comprising the oligomeric compound as claimed in claim 1 and a pharmaceutically acceptable diluent.

3. A pharmaceutical composition comprising the oligomeric compound as described in claim 1 and a pharmaceutically acceptable carrier.

4. The pharmaceutical composition of claim 2, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid or phosphate-buffered saline.

5. The pharmaceutical composition of claim 4, wherein the pharmaceutical composition is substantially composed of the oligomeric compound and artificial cerebrospinal fluid.

6. The pharmaceutical composition of claim 4, wherein the pharmaceutical composition comprises essentially the oligomeric compound and phosphate-buffered saline.

7. A modified oligonucleotide represented by the following chemical structure: Or its salt.

8. The modified oligonucleotide or its salt as described in claim 7, wherein the salt is a sodium or potassium salt.

9. The modified oligonucleotide or its salt as described in claim 8, wherein the salt is a sodium salt.

10. A pharmaceutical composition comprising the modified oligonucleotide as described in claim 7 or a salt thereof and a pharmaceutically acceptable diluent.

11. A pharmaceutical composition comprising the modified oligonucleotide as described in claim 7 or a salt thereof and a pharmaceutically acceptable carrier.

12. The pharmaceutical composition of claim 10, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid or phosphate-buffered saline.

13. The pharmaceutical composition of claim 12, wherein the pharmaceutical composition is substantially composed of the modified oligonucleotide and artificial cerebrospinal fluid.

14. The pharmaceutical composition of claim 12, wherein the pharmaceutical composition comprises substantially the modified oligonucleotide and phosphate-buffered saline.

15. A modified oligonucleotide represented by the following chemical structure:

16. A pharmaceutical composition comprising the modified oligonucleotide as described in claim 15 and a pharmaceutically acceptable diluent.

17. A pharmaceutical composition comprising the modified oligonucleotide as described in claim 15 and a pharmaceutically acceptable carrier.

18. The pharmaceutical composition of claim 16, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid or phosphate-buffered saline.

19. The pharmaceutical composition of claim 18, wherein the pharmaceutical composition comprises substantially the modified oligonucleotide and artificial cerebrospinal fluid.

20. The pharmaceutical composition of claim 18, wherein the pharmaceutical composition comprises substantially the modified oligonucleotide and phosphate-buffered saline.

21. Use of the oligomeric compound of claim 1, the modified oligonucleotide of any one of claims 7-9 or a salt thereof, the modified oligonucleotide of claim 15, or the pharmaceutical composition of any one of claims 2-6, 10-14, and 16-20 for the preparation of a medicament for treating diseases or disorders associated with SCN2A, wherein the diseases or disorders associated with SCN2A are developmental and epileptic encephalopathy.

22. The use as claimed in claim 21, wherein the developmental and epileptic encephalopathy is early-onset epileptic encephalopathy.

23. The use as claimed in claim 21, wherein the developmental and epileptic encephalopathy is selected from Ōtahara syndrome, epilepsy with migratory focal seizures in infants, West syndrome, Lennon-Gastaut syndrome, or Dravet syndrome.

Citation Information

Patent Citations

  • Atomizing device

    US2001817A

  • Nuclease resistant chimeric oligonucleotides

    US20030158403A1

  • Nuclease resistant chimeric oligonucleotides

    US20030175906A1

  • Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation

    US20080039618A1

  • Nucleic acid compounds with conformationally restricted monomers and uses thereof

    US20130190383A1