Construction and identification of a transgenic fruit fly model of abnormal intestinal acidity

Abstract

The present invention relates to a method for constructing and identifying a transgenic fruit fly capable of inducing abnormal intestinal acidity, constructing a fruit fly transgenic vector pValium20-RagA RNAi, and obtaining RagA RNAi Transgenic fruit flies, through the double balancer fruit flies SP / SM6; MKRS / TM6 Crossing two generations to obtain a stable hereditary balancer gene UAS-RagA RNAi Transgenic fruit flies SP / SM6;UAS‑RagA RNAi / TM6 By crossing with NP1-GAL4 flies that drive gene expression in intestinal epithelial cells, we obtained a knockout strain of RagA in the intestine. NP1-GAL4;UAS-RagA RNAi Fruit flies. Phenotypic detection revealed that the intestinal morphology of the fruit flies was abnormal; the method of feeding bromophenol blue and cresyl purple revealed that the acidity in the intestine of the RagA knockout fruit flies was reduced; the method of detecting copper cells with immunofluorescence determined that the phenotype of abnormal gastrointestinal acidity in the fruit flies was related to a reduction in the number of cells that secrete hydrogen ions. These results confirmed that the intestinal acidity of the RagA knockout fruit flies was abnormal. The present invention can be used to screen drugs targeted at gastrointestinal acidity deficiency diseases more quickly and conveniently.

Description

Technical Field

[0001] The invention relates to a construction method and an identification method of a transgenic fruit fly model, in particular to a construction method and an identification method of a transgenic fruit fly model with abnormal intestinal acidity, and belongs to the field of biotechnology. Background Art

[0002] Drosophila melanogaster has a highly developed nervous system and a short life cycle. It is easy to raise and easy to manipulate and analyze using genetics, cell biology, and molecular biology. It is a very practical model organism. Therefore, Drosophila melanogaster is widely used in the construction and research of disease models.

[0003] RagA is a component of the Rag complex and can sense the nutritional status of the cell. When the cell is in a state of starvation, RagA binds to GDP and is inactive. When nutrition is sufficient, RagA binds to GTP and becomes active, promoting cell growth and metabolism. We constructed transgenic fruit flies using dsRNA sequences targeting the Rag gene based on RNA interference technology and found that specific knockdown in the intestine RagA It can make the fruit fly intestine thicker; based on the knockdown of RagA, the restoration of RagA can inhibit the phenotype of intestinal thickening.

[0004] The intestinal tract of fruit flies and mammals is highly similar in terms of genetic regulation and cell composition. The midgut of fruit flies can be divided into the anterior midgut, the copper cell area and the mid-hindgut. The copper cell area is located in the middle of the midgut, similar to the stomach of mammals and is acidic, with a pH of less than 4. After feeding the bromophenol blue acid-base indicator, the area turns yellow. Relevant studies in recent years have shown that with age, the digestive capacity of the fruit fly intestine decreases, and the intestinal environment changes from weak acid to weak alkaline, suggesting that intestinal acidity may be related to organ aging. The RagA knockout fruit flies involved in the present invention show an abnormal intestinal acidity phenotype similar to that of aging fruit flies, and replenishing RagA can inhibit the phenotype of reduced intestinal acidity caused by RagA knockout. Summary of the invention

[0005] The purpose of the present invention is to provide a method for constructing and identifying a transgenic fruit fly model with abnormal intestinal acidity in view of the deficiencies of the above-mentioned prior art.

[0006] To achieve the above object, the present invention provides the following specific technical solutions:

[0007] A method for constructing a transgenic fruit fly model with abnormal intestinal acidity, based on the fruit fly RagA gene, designs an RNA interference target sequence, and inserts a transgenic vector for fruit fly RNA interference. Construct an RNA interference fruit fly targeting the RagA expression sequence. The specific steps of the method are:

[0008] a. Based on the Drosophila RagA gene, the target of the RNA interference sequence CTCGGAGGCTACGCTAGTCAA was designed to prepare the pValium20-RagA RNAi vector;

[0009] b: The Drosophila transgenic vector obtained in step a is constructed by microinjection combined with genetic engineering technology RagA RNAi Transgenic fruit flies.

[0010] The specific operation method of step a above is:

[0011] a-1: Synthesize primers based on the target sequence of RNA interference sequence:

[0012] aattcgcCTCGGAGGCTACGCTAGTCAAtatgcttgaatataactaTTGACTAGCGTAGCCTCCGAGactg

[0013] and

[0014] ctagcagtCTCGGAGGCTACGCTAGTCAAtagttatattcaagcataTTGACTAGCGTAGCCTCCGAGgcg;

[0015] a-2: After annealing and renaturation of the primers, insert them into the pvalium20 vector after double digestion with NheI and EcoRI.

[0016] a-3: Screening on agar plates containing ampicillin to obtain the pValium20-RagA RNAi vector for transgenic use.

[0017] The specific steps of the above step b are:

[0018] b-1: Injection of transgenic vector pValium20-RagA RNAi into y,v;attP2 The tail of the fertilized egg of Drosophila was cultured in a humidified box at 16°C;

[0019] b-2: After the larvae hatched from the fertilized eggs obtained in step b-1 have emerged into adults, they can be self-fertilized, and the fruit flies with red eyes in the offspring are selected as the fruit flies with UAS-RagA RNAi transgenic fruit flies;

[0020] b-3: Transgenic fruit flies and double-balancer fruit flies obtained in step b-2 SP / SM6;MKRS / TM6 After two generations of hybridization, stable inheritance was obtained through screening. UAS-RagA RNAi Fruit flies;

[0021] b-4: The transgenic fruit flies obtained in b-3 were mixed with NP1-GAL4Crossbreeding fruit flies to create a transgenic fruit fly with abnormal gastrointestinal acidity NP1-GAL4;UAS-RagA RNAi .

[0022] A method for identifying a transgenic fruit fly model with abnormal intestinal acidity is provided, wherein the transgenic fruit flies are identified by bromophenol blue feeding assay and immunofluorescence method.

[0023] The present invention utilizes microinjection technology and fruit fly hybridization technology to construct a transgenic fruit fly model with abnormal intestinal acidity, providing materials and ideas for faster and more convenient screening of intestinal disease-related drugs, and has good application prospects.

[0024] The invention has the advantages of simple operation and strong repeatability. The transgenic fruit fly model of abnormal intestinal acidity can be used to study the mechanism of abnormal intestinal acidity and can also be used to screen drugs targeted at treating intestinal diseases, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 As control, RagA knockout flies ( NP1-GAL4;UAS-RagA RNAi )、RagA knockdown + overexpression flies ( NP1-GAL4 / UAS-RagA;UAS-RagA RNAi ) Statistical graph of the width of the anterior midgut ( ) of the intestine.

[0026] Figure 2 As control, RagA knockout flies ( NP1-GAL4;UAS-RagA RNAi )、RagA knockdown + overexpression flies ( NP1-GAL4 / UAS-RagA;UAS-RagA RNAi ) Color statistics of intestinal copper cell areas fed with bromophenol blue.

[0027] Figure 3 As control, RagA knockout flies ( NP1-GAL4;UAS-RagA RNAi )、RagA knockdown + overexpression flies ( NP1-GAL4 / UAS-RagA;UAS-RagA RNAi ) Color statistics of intestinal copper cell areas in mice fed with cresyl violet.

[0028] Figure 4 As control, RagA knockout flies ( NP1-GAL4;UAS-RagA RNAi ), immunofluorescence staining images of the copper cell area of ​​RagA knockdown + overexpression fruit flies. DETAILED DESCRIPTION

[0029] The present invention is further described below in conjunction with specific implementation modes.

[0030] Example 1: Construction and verification of Drosophila transgenic vector;

[0031] 1. To obtain the Drosophila transgenic vector pValium20-RagA RNAi, primers were designed and synthesized according to the target sequence of the RNA interference sequence:

[0032] aattcgcCTCGGAGGCTACGCTAGTCAAtatgcttgaatataactaTTGACTAGCGTAGCCTCCGAGactg

[0033] and

[0034] ctagcagtCTCGGAGGCTACGCTAGTCAAtagttatattcaagcataTTGACTAGCGTAGCCTCCGAGgcg;

[0035] The plasmid pValium20 was double-digested with NheI and EcoRI, and the residues were recovered by gel for later use.

[0036] Screening was performed on agar plates containing ampicillin to obtain the pValium20-RagA RNAi vector for transgenic use.

[0037] Use primers

[0038] aattcgcCTCGGAGGCTACGCTAGTCAAtatgcttgaatataactaTTGACTAGCGTAGCCTCCGAGactg

[0039] and

[0040] ctagcagtCTCGGAGGCTACGCTAGTCAAtagttatattcaagcataTTGACTAGCGTAGCCTCCGAGgcg

[0041] PCR identification of the constructed Drosophila transgenic vector pValium20.

[0042] Example 2: Microinjection experiment and verification of transgenic fruit flies;

[0043] 1. In order to obtain transgenic fruit flies with abnormal intestinal acidity, transgenic fruit flies were constructed using genetic engineering technology using microinjection.

[0044] 2. Load the transgenic vector pValium20-RagA RNAi into a glass microelectrode with an elongated opening at a certain concentration ratio. With the help of a pneumatic mechanical injection arm, inject the mixture into the tail of a newly laid fertilized egg of the fruit fly that has been removed from its eggshell within 1 hour. Place the injected eggs in a wet box at 16°C for culture.

[0045] 3. After the fertilized eggs are injected, they hatch into larvae and can be self-fertilized after they emerge as adults. The offspring with red eyes are selected as transgenic fruit flies. The obtained transgenic fruit flies and double-balanced fruit flies are separated into SP / SM6;MKRS / TM6 After two generations of hybridization, a stable hereditary SP / SM6;UAS-RagA RNAi / TM6Drosophila; UAS- RagA RNAi Transgenic fruit flies with genotype NP1-GAL4 The transgenic fruit flies expressing the RagA interference sequence were obtained by hybridization of fruit flies. UAS-RagA / SM6; RagA RNAi / TM6 Drosophila melanogaster with genotype NP1-GAL4 By crossing fruit flies, transgenic fruit flies that simultaneously express the RagA interference sequence and the RagA coding region sequence are obtained.

[0046] 4. After dissecting the 3-day-old control fruit flies, transgenic fruit flies expressing the RagA interference sequence, and transgenic fruit flies expressing the RagA interference sequence and the RagA coding sequence, the intestines were fixed, sealed, and photographed under a microscope. The widths of the anterior midgut, copper cell area, and posterior midgut of the fruit fly intestine were counted. The results are as follows Figure 1 , knockdown RagA Make the fruit fly intestine thicker; based on the knockdown of RagA, replenishing RagA can suppress the phenotype of intestinal thickening.

[0047] 5. Mix the pH indicator bromophenol blue with fruit fly food (final concentration 0.2%) and feed it to the control fruit flies, the transgenic fruit flies expressing the RagA interference sequence, and the transgenic fruit flies expressing the RagA interference sequence and the RagA coding sequence. After 24 hours, the fruit flies were dissected and the proportion of fruit flies with a pH value of less than 4.0 in the copper cell area of ​​the gastrointestinal tract was counted. Figure 2 RagA knockout fruit flies show a phenotype of abnormal intestinal acidity, and RagA complementation can inhibit the phenotype of reduced intestinal acidity caused by RagA knockout.

[0048] 6. Mix the pH indicator - cresyl violet with fruit fly food (final concentration 0.2%), feed the control fruit flies, the transgenic fruit flies expressing the RagA interference sequence, and the transgenic fruit flies expressing the RagA interference sequence and the RagA coding sequence. After 24 hours, the fruit flies were dissected and the proportion of fruit flies with a pH value of less than 4.0 in the copper cell area of ​​the gastrointestinal tract was counted. Figure 3 RagA knockout fruit flies show a phenotype of abnormal intestinal acidity, and RagA complementation can inhibit the phenotype of reduced intestinal acidity caused by RagA knockout.

[0049] 7. After dissecting the 3-day-old control fruit flies, transgenic fruit flies expressing the RagA interference sequence, and transgenic fruit flies expressing the RagA interference sequence and the RagA coding sequence, the intestines were dissected and fixed, and immunofluorescence staining was performed with the copper cell-specific primary antibody Cut, and photos were taken under a fluorescence microscope. The results are as follows: Figure 4 , the number of copper cells in Drosophila with RagA knockout is reduced, and supplementation of RagA can inhibit the reduction in the number of intestinal copper cells caused by RagA knockout.

[0050] Therefore, the transgenic fruit fly model of abnormal intestinal acidity of the present invention can be used to analyze the mechanism of abnormal gastrointestinal acidity, and can also be used to quickly screen drugs or compounds for treating abnormal intestinal acidity, and has good application prospects.

Claims

1. A method for constructing a transgenic fruit fly model of abnormal gastrointestinal acidity, characterized in that: Based on the Drosophila RagA gene, an RNA interference target sequence is designed and inserted into a transgenic vector for Drosophila RNA interference; an RNA interference Drosophila targeting the RagA expression sequence is constructed; and the construction method comprises the following steps: a: Based on the Drosophila RagA gene, the target site of the RNA interference sequence CTCGGAGGCTACGCTAGTCAA was designed to prepare the pValium20-RagA RNAi vector; b: constructing RagARNAi transgenic fruit flies by combining microinjection with genetic engineering technology using the fruit fly transgenic vector obtained in step a; The specific method of step a is: a-1: Synthesize primers based on the target sequence of RNA interference sequence: aattcgcCTCGGAGGCTACGCTAGTCAAtatgcttgaatataactaTTGACTAGCGTAGCCTCCGAGactg and ctagcagtCTCGGAGGCTACGCTAGTCAAtagttatattcaagcataTTGACTAGCGTAGCCTCCGAGgcg; a-2: After annealing and renaturation, the primers were inserted into the pvalium20 vector that was double-digested with NheI and EcoRI and recovered from the gel; a-3: Screening on an agar plate containing ampicillin to obtain the pValium20-RagA RNAi vector for transgenic use; The specific steps of step b are: b-1: The transgenic vector pValium20-RagA RNAi was injected into the tail of the fertilized egg of yv;attP2 fruit fly and cultured in a humidified box at 16°C; b-2: After the larvae hatched from the fertilized eggs obtained in step b-1 have emerged into adults, they can be self-fertilized, and the fruit flies with red eyes in the offspring are selected as the ones carrying UAS- RagA RNAi transgenic fruit flies; b-3: Transgenic fruit flies and double-balancer fruit flies obtained in step b-2 SP / SM6;MKRS / TM6 Fruit flies were crossed for two generations and stable inheritance was obtained UAS-RagA RNAi Fruit flies; b-4: The transgenic fruit flies obtained in b-3 were mixed with NP1-GAL4 Crossbreeding fruit flies to create a transgenic fruit fly with abnormal gastrointestinal acidity NP1-GAL4;UAS-RagA RNAi .

Images