Molecular marker primer for brassica rapa and application thereof

By designing the purple leaf gene and its molecular marker primer Pur54 for non-heading Chinese cabbage, and combining PCR amplification and electrophoresis detection, the problem of rapidly identifying the purple leaf trait of non-heading Chinese cabbage was solved, and efficient breeding in the seedling stage was achieved.

CN116334294BActive Publication Date: 2026-05-19JIANGSU POLYTECHNIC COLLEGE OF AGRI & FORESTRY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310479862.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-04-28
Publication Date
2026-05-19
Estimated Expiration
2043-04-28

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly and effectively identify the purple leaf trait in non-heading Chinese cabbage, which affects the breeding process.

Method used

A gene for purple leaves in non-heading Chinese cabbage and its corresponding molecular marker primer Pur54 were designed. Through PCR amplification and polyacrylamide electrophoresis detection, the color of non-heading Chinese cabbage leaves can be efficiently identified.

Benefits of technology

This technology enables rapid and low-cost identification of non-heading purple-leaf Chinese cabbage varieties during the seedling stage, simplifying the breeding process and improving breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116334294B_ABST
    Figure CN116334294B_ABST
Patent Text Reader

Abstract

The application discloses a kind of Chinese cabbage molecular marker primer and its application.The application discloses a kind of Chinese cabbage purple leaf gene, its nucleotide sequence is as shown in SEQ ID NO.1.The application also discloses the molecular marker primer of detecting the above-mentioned Chinese cabbage purple leaf gene.The nucleotide sequence of the molecular marker primer is as shown in SEQ ID NO.2-3.The application also discloses the application of Chinese cabbage molecular marker primer in identifying Chinese cabbage purple leaf variety.The Chinese cabbage molecular marker primer of the application can be used to efficiently identify Chinese cabbage purple leaf variety, and identification can be completed in seedling stage, to realize seedling stage leaf color selection.It is simple to operate, and identification cost is low, efficiency is high, can speed up the breeding process of Chinese cabbage.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to molecular marker primers for non-heading Chinese cabbage and their applications. Background Technology

[0002] Non-heading Chinese cabbage (Brassica campestris ssp. chinensis Makino) holds an important place in my country's vegetable consumption. It is rich in nutrients beneficial to the human body, such as vitamin C, protein, minerals, and dietary fiber. Purple non-heading Chinese cabbage, in particular, is rich in anthocyanins and has a higher ornamental value. Anthocyanins are glycosylated polyphenolic compounds, easily soluble in water, and are important coloring substances in vegetables and fruits. Anthocyanins can protect plants against various biotic and abiotic stresses, and in humans, they also have antioxidant, anti-cancer, blood pressure and lipid-lowering, and Alzheimer's disease-alleviating effects. Therefore, designing a molecular marker primer for rapid identification of purple-leaf non-heading Chinese cabbage, significantly shortening the breeding process, and thus cultivating a non-heading Chinese cabbage with higher nutritional value and excellent ornamental value is of great significance for yield and quality. Summary of the Invention

[0003] Objectives of the invention: The first objective of this invention is to provide a gene for purple leaves in non-heading Chinese cabbage; the second objective of this invention is to provide a molecular marker primer for the efficient detection of purple-leaf non-heading Chinese cabbage and its application; the third objective of this invention is to provide a method for identifying purple-leaf varieties of non-heading Chinese cabbage.

[0004] Technical solution: The non-heading Chinese cabbage purple leaf gene of the present invention has the nucleotide sequence shown in SEQ ID NO.1.

[0005] The molecular marker primers described in this invention are for detecting the purple leaf gene in the above-mentioned non-heading Chinese cabbage.

[0006] Furthermore, the nucleotide sequences of the molecular marker primers are shown in SEQ ID NO.2-3.

[0007] The application of the molecular marker primers described in this invention in the identification of purple-leaf varieties of non-heading Chinese cabbage.

[0008] The method for identifying non-heading purple-leaf varieties of Chinese cabbage according to the present invention includes the following steps:

[0009] (1) Extract genomic DNA from the sample to be identified;

[0010] (2) Using the genomic DNA obtained in step (1) as a template, perform PCR amplification using the molecular marker primers described above;

[0011] (3) The amplification products obtained in step (2) are separated by polyacrylamide electrophoresis. If the separated products contain a 150bp fragment, it indicates that the leaves of the non-heading Chinese cabbage sample to be identified are purple.

[0012] Furthermore, the amplification system used in step (2) consists of: DNA template, Pur54 primer, 2×Primer Star, and deionized water.

[0013] Further, the amplification system used in step (2) is as follows: 1 μL of 50 ng / μL DNA template, 0.5 μL each of 10 μM Pur54 primers, 5 μL of 2× Primer Star, 3 μL of deionized water, and a total reaction volume of 10 μL.

[0014] Further, the amplification program used in step (2) is as follows: 95℃ pre-denaturation for 2 min, 98℃ denaturation for 30 s, 59.8℃ annealing for 30 s, 72℃ extension for 30 s, 72℃ post-extension for 10 min, 35 cycles, and then cooled to 4℃ for storage.

[0015] The method for breeding purple-leaf non-heading Chinese cabbage described in this invention refers to a Chinese cabbage containing the aforementioned purple-leaf gene for non-heading Chinese cabbage.

[0016] Furthermore, the aforementioned molecular marker primers were used during the breeding process to select for the color trait in non-heading Chinese cabbage.

[0017] Beneficial effects: Compared with the prior art, the present invention has the following outstanding advantages: The molecular marker primers for non-heading Chinese cabbage of the present invention can be used to efficiently identify purple-leaf varieties of non-heading Chinese cabbage, and identification can be completed at the seedling stage, realizing leaf color selection at the seedling stage. The operation is simple, the identification cost is low, and the efficiency is high, which can accelerate the breeding process of non-heading Chinese cabbage. Attached Figure Description

[0018] Figure 1 The image shows the polyacrylamide gel electrophoresis (PAGE) results of PCR amplification of different varieties of non-heading Chinese cabbage using the primers of this invention (where M is the DL500 Marker). Detailed Implementation

[0019] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0020] Example 1

[0021] This embodiment provides a method for identifying the purple-leaf trait in non-heading Chinese cabbage, comprising the following steps:

[0022] Step 1: Extraction of genomic DNA from non-heading Chinese cabbage

[0023] DNA was extracted according to the instructions of the Plant Genomic DNA Rapid Extraction Kit (purchased from Beijing Tiangen Biotech Co., Ltd., DP105). A brief summary is as follows:

[0024] 1) Take about 100mg of fresh plant tissue and grind it thoroughly with liquid nitrogen;

[0025] 2) Quickly transfer the ground powder into a centrifuge tube containing 700 μL of preheated GP1 buffer at 65°C (add mercaptoethanol to the preheated GP1 before the experiment to make the final concentration 0.1%), quickly invert and mix well, and place the centrifuge tube in a 65°C water bath for 20 min.

[0026] 3) Add 700 μL of chloroform, mix thoroughly, and centrifuge at 12,000 rpm for 5 min;

[0027] 4) Carefully transfer the upper aqueous phase obtained in the previous step into a new centrifuge tube, add 700 μL of buffer GP2, and mix thoroughly;

[0028] 5) Transfer the mixed liquid into the adsorption column CB3, centrifuge at 12,000 rpm for 30 s, and discard the waste liquid.

[0029] 6) Add 500 μL of buffer GD to the adsorption column CB3 (please check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and put the adsorption column CB3 into the collection tube.

[0030] 7) Add 600 μL of washing buffer PW to the adsorption column CB3 (please check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 30 s, discard the waste liquid, and put the adsorption column CB3 into the collection tube.

[0031] 8) Repeat step 7;

[0032] 9) Place the adsorption column CB3 back into the collection tube, centrifuge at 12,000 rpm for 2 minutes, and discard the waste liquid. Place the adsorption column CB3 at room temperature for several minutes to thoroughly dry any residual washing liquid in the adsorption material;

[0033] 10) Transfer the adsorption column CB3 into a clean centrifuge tube, add 100 μL of elution buffer TE dropwise to the middle of the adsorption membrane, incubate at room temperature for 5 min, centrifuge at 12,000 rpm for 2 min, and collect the solution into the centrifuge tube.

[0034] 11) After the DNA was tested for purity and concentration, it was diluted to 50 ng / μL and stored in a -20℃ refrigerator for later use.

[0035] Step 2: Amplification of the genome of non-heading Chinese cabbage using the marker primer Pur54.

[0036] In a 10 μL reaction system, there are 1 μL of 50 ng / μL DNA template, 0.5 μL each of 10 μM labeled primer Pur54, 5 μL of 2×Primer Star, and 3 μL of deionized water.

[0037] Pur54 labeled primers (synthesized by Genscript Biotech Inc.):

[0038] Pur54F (SEQ ID NO.2): 5'-TCCTTATCCGCCACTTCCGC-3',

[0039] Pur54R (SEQ ID NO. 3): 5'-AGCCGGAATAGGCAGTGGAG-3'.

[0040] The PCR amplification program was as follows: 95℃ pre-denaturation for 2 min, 98℃ denaturation for 30 s, 59.8℃ annealing for 30 s, 72℃ extension for 30 s, 72℃ post-extension for 10 min, 35 cycles, and stored at 4℃.

[0041] Step 3, Polyacrylamide gel electrophoresis detection

[0042] After PCR amplification, polyacrylamide gel electrophoresis (PAGE) was performed. The electrophoresis buffer was 1×TBE, and 1 μL of sample was loaded. After electrophoresis at 150V for 56 min, the sample was stained, observed, and photographed.

[0043] To verify the feasibility of this method, 38 non-heading Chinese cabbage samples were identified using this method. All samples were from the Chinese cabbage systems biology laboratory of Nanjing Agricultural University.

[0044] Electrophoresis results as follows Figure 1 It was found that a 150bp fragment could be amplified from purple non-heading Chinese cabbage in lanes 1, 2, 4-6, 8-13, 15-24, 26-30, and 32-38. The nucleotide sequence of the 150bp fragment amplified from purple non-heading Chinese cabbage was determined to be TCCTTATCCGCCACTTCCGCTTCCTCCAGGTCTATTAGCGGCCTCCTCCTCTACATCGTCATCGCCTCTTACAGTTAACCAAACGTCACCACCATCGCTGGGCGCCTCCTCCGCAATTAGCTGGGGCACCTCCACTGCCTATTCCGGCT (SEQ ID NO.1).

[0045] Lanes 3, 7, 14, 25, and 31 are green, non-heading Chinese cabbage, and the amplified fragment is a 175 bp fragment with the following nucleotide sequence: TCCTTATCCGCCACTTCCGCTTCCTCCAGGTCTATTAGCGGCCTCCTCCTCTACATCGTCATCGCCTCTTACAGTTAACCAAACGTCACCACCATCTGCTGGGGCGCCTCCTCCGCAATTAGCTGGGGCGCCTCCTCCGCAATTAGCTGGGGCGCCTCCTCCGCAATTAGCTGGGGCACCTCCACTGCCTATTCCGGCT (SEQ ID NO.4).

[0046] The results above show that when using the marker primer Pur54 to amplify non-heading Chinese cabbage varieties or materials, a 150bp fragment indicates that the leaves of the variety or material being identified are purple, while a 175bp fragment indicates that the leaves are green.

Claims

1. The application of a molecular marker primer in identifying a purple-leaf variety of non-heading Chinese cabbage, characterized in that, The molecular marker primers are used to detect the nucleotide sequence of the purple leaf gene fragment of non-heading Chinese cabbage as shown in SEQ ID NO.

1.

2. A method for identifying non-heading purple-leaf varieties of Chinese cabbage, characterized in that, Includes the following steps: (1) Extract genomic DNA from the sample to be identified; (2) Using the genomic DNA obtained in step (1) as a template, perform PCR amplification using molecular marker primers with nucleotide sequences as shown in SEQ ID NO.2~3; (3) The amplification product obtained in step (2) is separated by polyacrylamide electrophoresis. If the separated product contains a 150bp fragment as shown in SEQ ID NO.1, it indicates that the leaves of the non-heading Chinese cabbage sample to be identified are purple.

3. The method for identifying non-heading purple-leaf varieties of Chinese cabbage according to claim 2, characterized in that, The amplification system used in step (2) consists of: DNA template, molecular marker primers, 2× Primer Star, and deionized water.

4. The method for identifying non-heading purple-leaf varieties of Chinese cabbage according to claim 2, characterized in that, The amplification system used in step (2) is as follows: 1 μL of 50 ng / μL DNA template, 0.5 μL each of 10 μM Pur54 primers, 5 μL of 2× Primer Star, 3 μL of deionized water, and a total reaction volume of 10 μL.

5. The method for identifying non-heading purple-leaf varieties of Chinese cabbage according to claim 2, characterized in that, The amplification program used in step (2) is as follows: 95℃ pre-denaturation for 2 min, 98℃ denaturation for 30 s, 59.8℃ annealing for 30 s, 72℃ extension for 30 s, 72℃ post-extension for 10 min, 35 cycles, and then cooled to 4℃ for storage.

6. A method for breeding a purple-leaf, non-heading Chinese cabbage, characterized in that, The purple-leaf non-heading Chinese cabbage contains a non-heading Chinese cabbage purple-leaf gene fragment with a nucleotide sequence as shown in SEQ ID NO.

1.

7. The breeding method according to claim 6, characterized in that, In the breeding process, molecular marker primers with nucleotide sequences as shown in SEQ ID NO.2~3 are used to select the color trait of non-heading Chinese cabbage.