Active oxygen ros response cations and their use in siRNA delivery

Abstract

The application relates to the field of biological medicine, in particular to a series of active oxygen ROS response cations and application thereof in siRNA delivery. The nanomaterial prepared from the ROS response cations has strong loading capacity (a loading rate is more than 80%) on siRNA at a lower N / P ratio (1 or 2). The siRNA nanomicelles have effective siRNA delivery and release capacity. The siRNA nanomicelles can be used for inhibiting protein expression in target cells and have the potential as a gene delivery carrier.

Description

Technical Field

[0001] This invention belongs to the field of biomedical materials, specifically relating to the preparation of a class of ROS-responsive cations and their application in gene delivery. Technical Background

[0002] Since the discovery of RNA interference, siRNA has been widely studied as a potential treatment for various diseases, especially cancer. However, due to its negative charge and large molecular size, siRNA is difficult to penetrate cell membranes and is easily degraded by endogenous enzymes. Therefore, researchers have been working to develop safe and effective vectors for delivering siRNA into cells. Over the past few decades, numerous nanoparticles have been widely used in siRNA delivery research, and some cationic liposome / polymer nanoparticles have been successfully developed and applied in clinical research on cancer patients. Lipid-based nanoparticles, typically with a cationic "head" for binding to RNA via electrostatic interactions, and a hydrophobic "tail" for structural stability, are used to achieve nanoparticle stability. These lipid-based nanoparticles have been shown to effectively mediate gene silencing and gene therapy at low siRNA doses.

[0003] Cationic liposomes based on quaternary ammonium salt structures are commonly used as siRNA carriers due to their strong positive charge and structural stability. While these quaternary ammonium salt cationic materials exhibit strong binding affinity, their strong positive charge can easily damage cell membranes, leading to cytotoxicity. Therefore, cationic designs based on tertiary amine structures have also received widespread attention and application. Although tertiary amine-based cations have significant effects on siRNA loading, gene silencing, and therapy, their binding affinity is weaker than that of quaternary ammonium salts. Therefore, the required nitrogen-to-phosphorus ratio (N / P ratio) in formulations is often relatively high, and the excessive nitrogen atoms exhibit strong cationic properties, inevitably leading to side effects. Therefore, there is a desire to design novel cations that respond to the tumor environment. Under normal conditions, cations with quaternary ammonium salt structures have strong binding affinity, reducing the amount of cation required. When nanoparticles enter tumor cells, the cations can decompose in response to stimulation conditions, reducing to tertiary amine molecules, releasing the loaded siRNA and reducing the toxicity of the molecules themselves.

[0004] Reactive oxygen species (ROS) are the main molecules produced during oxidative stress in the body and have long been considered important factors in tumor occurrence, development, and recurrence. In normal cells, the oxidative and antioxidant systems maintain a relative balance; an increase in pro-oxidative levels or a decrease in antioxidant capacity leads to an increase in ROS levels in the body, causing a series of changes. Tumor cells have higher ROS levels than normal cells, thus tumor cells are in a state of oxidative stress. Therefore, ROS-responsive cations designed using the difference in ROS levels between tumor cells and normal cells were applied to the delivery vector of siRNA. Summary of the Invention

[0005] The purpose of this invention is to provide a ROS-responsive quaternary ammonium salt cation as a novel, highly efficient, and low-toxicity gene delivery vector.

[0006] To achieve the above technical objectives, the present invention adopts the following technical solution:

[0007] Using 2,6-dimethylphenylboronic acid as the parent compound, a series of quaternary ammonium salt cations were synthesized. Compared to previous multi-N compounds, the cations in these molecules are more charged and contain less nitrogen. Upon entering a ROS environment, the phenylboronic ester ester triggers the decomposition of the quaternary ammonium salt into tertiary amine molecules, thereby reducing the molecule's positive charge and achieving the goals of releasing siRNA and reducing toxicity.

[0008] Firstly, a series of ROS-responsive cations are provided:

[0009] A single-chain alkyl ROS-responsive cation with the following chemical structure:

[0010]

[0011] Wherein, R1 is selected from C14-C18 straight-chain alkyl groups;

[0012] Furthermore, R1 is selected from:

[0013]

[0014] A single-chain ester-based ROS-responsive cation, with the following chemical structure:

[0015]

[0016] Wherein, R2 is selected from C9-C21 straight-chain alkyl groups, or

[0017]

[0018] Furthermore, the C9-C21 straight-chain alkyl groups are selected from: C9, C10, C12, C16, and C20 straight-chain alkyl groups;

[0019]

[0020] A double-chain ester-based ROS-responsive cation, with the following chemical structural formula:

[0021]

[0022] R3 is selected from C11-C21 straight-chain alkyl groups;

[0023] Furthermore, R1 is selected from: C11, C13, C17, and C21 straight-chain alkyl groups;

[0024] The phenylboronic acid ester structure is ROS-sensitive and can be reduced to a phenolic structure by ROS, while the quaternary ammonium salts on both sides break into benzophenol and tertiary amine structures.

[0025] Methods for preparing such ROS-responsive cations include:

[0026] 2,6-Dimethylphenylboronic acid and pinacol were refluxed in toluene overnight to prepare the intermediate 2,6-dimethylphenylboronic acid pinacol ester. The intermediate 2,6-dimethylphenylboronic acid pinacol ester was then reacted with N-bromosuccinimide and azobisisobutyronitrile in carbon tetrachloride to generate the intermediate 2,6-dibromomethylphenylboronic acid pinacol ester.

[0027] The tertiary amine molecule and the intermediate 2,6-dibromomethylphenylboronic acid pinacol ester were dissolved in a mixed solution of dichloromethane and methanol in a molar ratio of 2.2:1, and reacted to form a quaternary ammonium salt cation.

[0028] Another object of the present invention is to provide a method for preparing the above-mentioned ROS-responsive siRNA delivery vector, comprising:

[0029] MPEG 2K -PLGA 11K The ROS-responsive cations (soluble in N,N-dimethylformamide) and ROS-responsive cations (soluble in N,N-dimethylformamide) were mixed and vortexed until homogeneous. Then, an aqueous solution of Cy5-labeled siRNA was added to the mixture, wherein the N / P ratio of the ROS-responsive cations to the siRNA was adjustable.

[0030] Add the above solution to 5 mL of PBS solution, stir continuously, concentrate using an ultrafiltration centrifuge tube, and wash with PBS for 2 seconds.

[0031] The solution was prepared to a concentration of 1 nmol / mL for siRNA.

[0032] Secondly, the application of the ROS-responsive cations described in the first aspect in siRNA delivery is provided.

[0033] Thirdly, a siRNA delivery nanoparticle is provided, the nanoparticle comprising:

[0034] Component (1): The ROS-responsive cation as described in claim 1, 2 or 3;

[0035] Component (2): Methyl polyethylene glycol-polylactic acid glycol copolymer (preferably MPEG) 2K -PLGA 11000 , 75 / 25);

[0036] Component (3): siRNA with silencing effect;

[0037] Positively charged component (1) and negatively charged component (3) combine with each other and are then encapsulated by component (2) to form nanoparticles.

[0038] Particles.

[0039] In some embodiments, the N / P ratio of the siRNA delivery nanoparticles, components (1) and (3) is...

[0040] The composition is: component (1): component (3) is 1 or 2; the optimal composition is component (1): component (3) = 2.

[0041] In some embodiments, the nanoparticles have a particle size of 80–120 nm, preferably 92 nm.

[0042] Fourthly, the application of the ROS-responsive cations described in the first aspect in the preparation of drugs for treating tumor diseases is provided.

[0043] Fifthly, the application of the siRNA delivery nanoparticles described in the third aspect in the preparation of drugs for treating tumor diseases.

[0044] application.

[0045] Beneficial Effects: The gene delivery vector of this invention is based on the ortho-quaternary ammonium salt ROS-responsive structure of pinacol phenylboronic acid ester, which enhances the binding ability of cations to siRNA. After forming a complex with siRNA, it can be assembled with the polymer MPEG-PLGA to generate nanoparticles. These nanoparticles remain stable under normal physiological conditions. However, upon entering cancer cells, under the high ROS conditions within cancer cells, the ROS-responsive cations change, the quaternary ammonium salt is reduced to tertiary amine molecules, the positive charge decreases, reducing the toxicity of the material, releasing negatively charged siRNA, and improving transfection efficiency. Attached Figure Description

[0046] Figure 1This is a synthetic route diagram of the single-chain alkyl ROS-responsive cation described in Examples 1 to 4 of the present invention.

[0047] Figure 2 This is a synthetic route diagram of the single-chain ester-based ROS-responsive cation described in Examples 5 to 15 of the present invention.

[0048] Figure 3 This is a synthetic route diagram of the double-chain ester-based ROS-responsive cation described in Examples 16-19 of the present invention.

[0049] Figure 4 This is a synthetic route diagram for the ROS-responsive cation not present in Example 20 of the present invention.

[0050] Figure 5 This is a diagram of cellular gene silencing of single-chain alkyl ROS-responsive cationic nanoparticles as described in Examples 1-4 of this invention.

[0051] Figure 6 This is a cellular gene silencing diagram of the single-chain ester ROS-responsive cationic nanoparticles described in Examples 8-15 of the present invention.

[0052] Figure 7 This is a cellular gene silencing diagram of the double-chain ester-based ROS-responsive cationic nanoparticles described in Examples 16-19 of this invention.

[0053] Figure 8 This is a cell gene silencing diagram of the ROS-free cation nanoparticles of Example 20 and the PEI control nanoparticles of Example 22 of the present invention.

[0054] Figure 9 This is a fluorescence intensity map of the tissue distribution described in Example 24 of the present invention.

[0055] Figure 10 This is the tumor gene silencing map described in Example 25 of the present invention. Detailed Implementation

[0056] The following detailed description, in conjunction with the accompanying drawings and specific embodiments, further illustrates the above-described content of the present invention. However, it should not be construed as limiting the scope of the subject matter of the present invention to the following examples. Any modifications made without departing from the spirit and principles of the present invention, as well as equivalent substitutions or improvements made based on ordinary technical knowledge and common practice in the art, should be included within the scope of protection of the present invention.

[0057] The reagents and materials used in the examples are as follows:

[0058] MPEG 2K -PLGA 11K (75 / 25) Purchased from Shandong Daigang Biotechnology Co., Ltd.

[0059] All other chemical reagents were purchased from Anhui Zesheng Technology Co., Ltd. or Beijing Bailingwei Technology Co., Ltd.

[0060] Cy5-tagged siRNAs (sense(5'-3'): GAUUAUGUCCGGUUAUGUAUU, antisense(5'-3'): PUACAUAACCGGACAUAAUCU.U) were purchased from Gemma Gene.

[0061] HCT116 and HeLa cells were purchased from COBIOER (Nanjing, China). The firefly luciferase (Fluc) gene was cloned into a mouse stem cell virus (MSCV) vector, and retroviruses were packaged using Vsvg and MLV. HeLa and HCT116 cells were infected with Fluc retroviruses and selected with puromycin to obtain HCT116-Fluc and HeLa-Fluc cells.

[0062] DMEM high-glucose medium (Dulbecco's Modified Eagle Medium) was purchased from Jiangsu Kaiji Biotechnology (Nanjing, China).

[0063] Fetal bovine serum was purchased from ExCell Bio (Australia).

[0064] Opti-MEM TM I) Purchased from Gibco (USA).

[0065] Bright-Lite Luciferase Assay System and Cell Viability Assay Kit The 2.0 Luminescent Cell Viability Assay was purchased from Novizan (Nanjing, China).

[0066] The mice used in the experiment were all purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.

[0067] Example 1: Preparation method of intermediate 2,6-dibromomethylphenylboronic acid pinacol ester:

[0068] Step 1: Synthesis of intermediate 2,6-dimethylphenylboronic acid pinacol ester

[0069] 2.50 g (16.67 mmol, 1.0 equiv) of 2,6-dimethylphenylboronic acid and 2.36 g (20.0 mmol, 1.2 equiv) of pinacol were dissolved in 70 mL of benzene. The reaction mixture was refluxed overnight, and the water produced in the reaction was removed using a water separator. After cooling to room temperature, the solvent was removed by vacuum distillation, and the residue was purified by column chromatography to yield 3.10 g of product (yield 80.1%). The mobile phase was ethyl acetate. 1 H-NMR (500MHz, CDCl3) δ7.11(t,J=7.6Hz,1H),6.93(d,J=7.6Hz,2H),2.39(s,6H),1.38(s,12H).

[0070] Step 2: Synthesis of intermediate 2,6-dibromomethylphenylboronic acid pinacol ester

[0071] 1.60 g (6.9 mmol, 1.0 equiv) of pinacol 2,6-dimethylphenylboronic acid, 113 mg (0.69 mmol, 0.1 equiv) of azobisisobutyronitrile, and 2.56 g (14.4 mmol, 2.1 equiv) of N-bromosuccinimide were dissolved in carbon tetrachloride, and the reaction mixture was stirred and refluxed overnight. After filtering off the precipitate, the solvent was evaporated, and the product was rapidly purified by column chromatography with dichloromethane to give 2.1 g of the product, in 78% yield. 1 H-NMR (500MHz, CDCl3) δ7.35-7.22(m,3H),4.81(s,4H),1.46(s,12H).

[0072] Example 2: Synthesis of a single-chain 14-alkyl ROS-responsive cation (C14)

[0073] 100 mg (257 μmol, 1.0 equiv) of pinacol 2,6-dibromomethylphenylboronic acid and 136 mg (564 μmol, 2.2 equiv) of tetradecyl dimethyl tertiary amine were dissolved in 2 mL of a mixed solution of dichloromethane and methanol, and the solution was stirred overnight. After rotary evaporation, the solution was purified by column chromatography to obtain the final product, with a gradient eluent from dichloromethane to dichloromethane:methanol = 10:1. 1 H-NMR(500MHz, CDCl3)δ7.92(d,J=7.6Hz,2H),7.49(t,J=7.6Hz,1H),5.28(s,4H),3.69-3.60(m,4H ),3.19(s,12H),1.85(s,4H),1.39(s,12H),1.24(m,44H),0.85(t,6H).LC / MS(ESI,m / z)=356.22[M] 2+ .

[0074] Example 3: Preparation method of single-chain 16-alkyl ROS-responsive cation (C16):

[0075] The preparation method is the same as in Example 2, except that the raw material tetradecyl dimethyl tertiary amine is replaced with hexadecyl dimethyl tertiary amine. 1 H-NMR(500MHz, CDCl3)δ7.89(d,J=7.6Hz,2H),7.62(t,J=7.6Hz,1H),5.19(s,4H),3.60(m,4H),3.1 6(s,12H),1.90(s,4H),1.44(s,12H),1.34-1.23(m,52H),0.88(t,6H).LC / MS(ESI,m / z)=384.61[M] 2+ .

[0076] Example 4: Preparation method of single-chain 18-alkyl ROS-responsive cation (C18):

[0077] The preparation method is the same as in Example 2, except that the raw material tetradecyl dimethyl tertiary amine is replaced with octadecyl dimethyl tertiary amine. 1 H-NMR (500MHz, CDCl3) δ7.91(d,J=7.6Hz,2H),7.61(t,J=7.6Hz,1H),5.22(s,4H),3.62(m,4H),3.1 6(s,12H),1.89(s,4H),1.41(s,12H),1.32-1.22(m,60H),0.88(t,6H).LC / MS(ESI,m / z)=412.51[M] 2+ .

[0078] Example 5: Preparation method of single-chain ester-based ROS-responsive cation E3:

[0079] Step 1: Synthesis of intermediate 4-(dimethylamino)butyl decanoate

[0080] 565 mg (3.28 mmol, 1.0 equiv) of n-decanoic acid, 384 mg (3.28 mmol, 1.0 equiv) of 4-(dimethylamino)-1-butanol, 40.1 mg (328 μmol, 0.1 equiv) of 4-dimethylaminopyridine, and 813 mg (3.94 mmol, 1.2 equiv) of 1,3-dicyclohexylcarbodiimide were dissolved in 100 mL of dichloromethane solution, and the reaction was carried out overnight at room temperature. The solvent was removed by vacuum distillation, and the mixture was purified by column chromatography with dichloromethane:methanol = 150:1 as the eluent. 1H-NMR(500MHz, CDCl3)δ4.21(t,2H),2.56(s,2H),2.34(s,2H),2.21(s,6H),1.6 3-1.55(m,4H),1.34-1.21(m,14H),0.87(t,3H).LC / MS(ESI,m / z)=272.16[M+H] + .

[0081] Step 2: Synthesis of single-chain ester ROS-responsive cation E3:

[0082] 100 mg (257 μmol, 1.0 equiv) of pinacol 2,6-dibromomethylphenylboronic acid and 153 mg (564 μmol, 2.2 equiv) of 4-(dimethylamino)butyldecanoate were dissolved in 2 mL of a mixture of dichloromethane and methanol, and the solution was stirred overnight. After rotary evaporation, the solution was purified by column chromatography to obtain the final product, with a gradient eluent from dichloromethane to dichloromethane:methanol = 5:1. 1 H-NMR (500MHz, CDCl3) δ7.94(d,J=7.6Hz,2H),7.61(t,J=7.6Hz,1H),5.24(s,4H),4.22(t,4H),3.62(m,4H),3.21(s ,12H),2.32(s,4H),1.79-1.65(m,12H),1.42(s,12H),1.36-1.21(m,24H),0.88(t,6H).LC / MS(ESI,m / z)=386.35[M] 2+ .

[0083] Example 6: Preparation method of single-chain ester ROS-responsive cation E4:

[0084] Step 1: Synthesis of intermediate 4-(dimethylamino)butyl-3,4-difluorobenzoate

[0085] The preparation method is the same as in Example 5, except that the raw material n-decanoic acid is replaced with 3,4-difluorobenzoic acid. 1 H-NMR (500MHz, CDCl3) δ7.92(m,2H),7.35(m,1H),4.19(t,2H),2.41(t,2H),2.20(s,6H),1.52(m,2H),1.38(m,2H).LC / MS(ESI,m / z)=258.25[M+H] + .

[0086] Step 2: Synthesis of single-chain ester ROS-responsive cation E4:

[0087] The preparation method is the same as in Example 5, except that the intermediate 4-(dimethylamino)butyldecanoate is replaced with 4-(dimethylamino)butyl-3,4-difluorobenzoate. 1 H-NMR (500MHz, CDCl3) δ7.94(m,6H),7.61(t,J=7.6Hz,1H),7.35(m,2H),5.26(s,4H),4.19(t,4H) ,3.59(m,4H),3.20(s,12H),1.79(m,4H),1.70(m,4H),1.42(s,12H).LC / MS(ESI,m / z)=372.28[M] 2+ .

[0088] Example 7: Preparation method of single-chain ester-based ROS-responsive cation E5:

[0089] Step 1: Synthesis of intermediate 4-(dimethylamino)butyl-4-fluoro-2-nitrobenzoate

[0090] The preparation method is the same as in Example 5, except that the raw material n-decanoic acid is replaced with 4-fluoro-2-nitrobenzoic acid. 1 H-NMR(500MHz, CDCl3)δ8.40(m,1H),8.10(m,1H),7.82(m,1H),4.18(t,2H),2.3 9(t,2H),2.21(s,6H),1.52(m,2H),1.39(m,2H).LC / MS(ESI,m / z)=285.46[M+H] + .

[0091] Step 2: Synthesis of single-chain ester ROS-responsive cation E5:

[0092] The preparation method is the same as in Example 5, except that the intermediate 4-(dimethylamino)butyldecanoate is replaced with 4-(dimethylamino)butyl-4-fluoro-2-nitrobenzene. 1 H-NMR (500MHz, CDCl3) δ8.41(m,2H),8.12(m,2H),7.95(d,J=7.6Hz,2H),7.84(m,2H),7.61(t,J=7.6Hz,1H),5.25(s ,4H),4.19(t,4H),3.64(m,4H),3.19(s,12H),1.81(m,4H),1.70(m,4H),1.41(s,12H).LC / MS(ESI,m / z)=399.29[M] 2+ .

[0093] Example 8: Preparation method of single-chain ester-based ROS-responsive cation E6:

[0094] Step 1: Synthesis of intermediate 4-(dimethylamino)butyl-4-methyl-3-(trifluoromethyl)benzoate

[0095] The preparation method is the same as in Example 5, except that the raw material n-decanoic acid is replaced with 4-methyl-3-(trifluoromethyl)benzoic acid. 1 H-NMR(500MHz, CDCl3)δ8.21(m,1H),8.09(m,1H),7.45(m,1H),4.20(t,2H),2.41- 2.35(m,5H),2.21(s,6H),1.55(m,2H),1.38(m,2H).LC / MS(ESI,m / z)=303.26[M+H] + .

[0096] Step 2: Synthesis of single-chain ester ROS-responsive cation E6:

[0097] The preparation method is the same as in Example 5, except that the intermediate 4-(dimethylamino)butyldecanoate is replaced with 4-(dimethylamino)butyl-4-methyl-3-(trifluoromethyl)benzoate. 1 H-NMR (500MHz, CDCl3) δ8.22(m,2H),8.09(m,2H),7.93(d,J=7.6Hz,2H),7.62(t,J=7.6Hz,1H),7.44(m,2H),5.23(s,4H), 4.19(t,4H),3.64(m,4H),3.19(s,12H),2.37(s,6H),1.81(m,4H),1.70(m,4H),1.41(s,12H).LC / MS(ESI,m / z)=418.36[M] 2+ .

[0098] Example 9: Preparation method of single-chain ester-based ROS-responsive cation E7:

[0099] Step 1: Synthesis of intermediate 4-(dimethylamino)butyl-(E)-3-(4-nitrophenyl)acrylate

[0100] The preparation method is the same as in Example 5, except that the raw material n-decanoic acid is replaced with (E)-3-(4-nitrophenyl)acrylic acid. 1H-NMR (500MHz, CDCl3) δ8.25(d,J=8.3Hz,2H),8.01(d,J=8.3Hz,2H),7.71(d,J=16.1Hz,1H),6.75(d,J=16 .1Hz,1H),4.18(t,2H),2.38(m,2H),2.20(s,6H),1.55(m,2H),1.38(m,2H).LC / MS(ESI,m / z)=293.54[M+H] + .

[0101] Step 2: Synthesis of single-chain ester ROS-responsive cation E7:

[0102] The preparation method is the same as in Example 5, except that the intermediate 4-(dimethylamino)butyldecanoate is replaced with 4-(dimethylamino)butyl-(E)-3-(4-nitrophenyl)acrylate. 1 H-NMR (500MHz, CDCl3) δ8.24(d,J=8.2Hz,4H),7.97(m,6H),7.74(d,J=16.1Hz,2H),7.61(t,J=7.6Hz,1H),6.72(d,J=16.2Hz,2 H),5.20(s,4H),4.18(t,4H),3.56(m,4H),3.19(s,12H),1.79(m,4H),1.70(m,4H),1.38(s,12H).LC / MS(ESI,m / z)=407.19[M] 2+ .

[0103] Example 10: Preparation method of single-chain ester-based ROS-responsive cation E8:

[0104] Step 1: Synthesis of intermediate 4-(dimethylamino)butyl-3,4-dimethoxyphenylacetic acid ester

[0105] The preparation method is the same as in Example 5, except that the raw material n-decanoic acid is replaced with 3,4-dimethoxyphenylacetic acid. 1 H-NMR(500MHz, CDCl3)δ6.82(m,3H),4.15(t,2H),3.87(s,6H),3.59(s,2H),2.3 5(m,2H),2.21(s,6H),1.58(m,2H),1.37(m,2H).LC / MS(ESI,m / z)=296.56[M+H] + .

[0106] Step 2: Synthesis of single-chain ester ROS-responsive cation E8:

[0107] The preparation method is the same as in Example 5, except that the intermediate 4-(dimethylamino)butyldecanoate is replaced with 4-(dimethylamino)butyl-3,4-dimethoxyphenylacetic acid ester. 1 H-NMR (500MHz, CDCl3) δ7.93(d,J=7.6Hz,2H),7.61(t,J=7.6Hz,1H),6.84(m,6H),5.26(s,4H),4.19(t,4H),3.87(s ,12H),3.60(m,4H),3.55(s,4H),3.20(s,12H),1.79(m,4H),1.70(m,4H),1.42(s,12H).LC / MS(ESI,m / z)=410.44[M] 2+ .

[0108] Example 11: Preparation method of single-chain ester-based ROS-responsive cation E9:

[0109] Step 1: Synthesis of intermediate 4-(dimethylamino)butyl-2-naphthaleneacetic acid ester

[0110] The preparation method is the same as in Example 5, except that the raw material n-decanoic acid is replaced with 2-naphthaleneacetic acid. 1 H-NMR(500MHz, CDCl3)δ7.80(m,3H),7.73(s,1H),7.45(m,2H),7.40(m,1H),3.84(s,2H),4.1 4(t,2H),2.35(m,2H),2.20(s,6H),1.56(m,2H),1.39(m,2H).LC / MS(ESI,m / z)=286.44[M+H] + .

[0111] Step 2: Synthesis of single-chain ester ROS-responsive cation E9:

[0112] The preparation method is the same as in Example 5, except that the intermediate 4-(dimethylamino)butyldecanoate is replaced with 4-(dimethylamino)butyl-2-naphthaleneacetic acid ester. 1 H-NMR (500MHz, CDCl3) δ7.94(d,J=7.5Hz,2H),7.82(m,6H),7.74(s,2H),7.61(t,J=7.5Hz,1H),7.45(m,4H),7.40(m,2H),5.26(s ,4H),4.22(t,4H),3.81(s,4H),3.57(m,4H),3.22(s,12H),1.79(m,4H),1.71(m,4H),1.39(s,12H).LC / MS(ESI,m / z)=400.38[M] 2+ .

[0113] Example 12: Preparation method of single-chain ester-based ROS-responsive cation E12-1:

[0114] Step 1: Synthesis of intermediate 4-(dimethylamino)butyl dodecanoate

[0115] The preparation method is the same as in Example 5, except that the raw material n-decanoic acid is replaced with dodecanoic acid. 1 H-NMR(500MHz, CDCl3)δ4.25(t,2H),2.55(s,2H),2.34(s,2H),2.20(s,6H),1.6 5-1.55(m,4H),1.34-1.21(m,18H),0.88(t,3H).LC / MS(ESI,m / z)=300.25[M+H] + .

[0116] Step 2: Synthesis of single-chain ester ROS-responsive cation E12-1:

[0117] The preparation method is the same as in Example 5, except that the intermediate 4-(dimethylamino)butyldecanoate is replaced with 4-(dimethylamino)butyldodecanoate. 1 H-NMR (500MHz, CDCl3) δ7.95(d,J=7.6Hz,2H),7.61(t,J=7.6Hz,1H),5.23(s,4H),4.25(t,4H),3.60(m,4H),3.22(s ,12H),2.34(s,4H),1.78-1.64(m,12H),1.44(s,12H),1.36-1.20(m,32H),0.88(t,6H).LC / MS(ESI,m / z)=414.39[M] 2+ .

[0118] Example 13: Preparation method of single-chain ester-based ROS-responsive cation E14-1:

[0119] Step 1: Synthesis of intermediate 4-(dimethylamino)butyltetradecanoate

[0120] The preparation method is the same as in Example 5, except that the raw material n-decanoic acid is replaced with tetradecanoic acid. 1 H-NMR(500MHz, CDCl3)δ4.23(t,2H),2.53(s,2H),2.32(s,2H),2.20(s,6H),1.6 3-1.53(m,4H),1.33-1.20(m,22H),0.88(t,3H).LC / MS(ESI,m / z)=328.61[M+H] + .

[0121] Step 2: Synthesis of single-chain ester ROS-responsive cation E14-1:

[0122] The preparation method is the same as in Example 5, except that the intermediate 4-(dimethylamino)butyldecanoate is replaced with 4-(dimethylamino)butyltetradecanoate. 1 H-NMR (500MHz, CDCl3) δ7.96(d,J=7.6Hz,2H),7.63(t,J=7.6Hz,1H),5.23(s,4H),4.25(t,4H),3.60(m,4H),3.22(s ,12H),2.34(s,4H),1.75-1.65(m,12H),1.44(s,12H),1.36-1.20(m,40H),0.88(t,6H).LC / MS(ESI,m / z)=441.25[M] 2+ .

[0123] Example 14: Preparation method of single-chain ester-based ROS-responsive cation E18-1:

[0124] Step 1: Synthesis of intermediate 4-(dimethylamino)butyl octadecanoate

[0125] The preparation method is the same as in Example 5, except that the raw material n-decanoic acid is replaced with octadecanoic acid. 1 H-NMR(500MHz, CDCl3)δ4.24(t,2H),2.53(s,2H),2.34(s,2H),2.21(s,6H),1.6 3-1.56(m,4H),1.34-1.19(m,30H),0.88(t,3H).LC / MS(ESI,m / z)=384.19[M+H] + .

[0126] Step 2: Synthesis of single-chain ester ROS-responsive cation E18-1:

[0127] The preparation method is the same as in Example 5, except that the intermediate 4-(dimethylamino)butyldecanoate is replaced with 4-(dimethylamino)butyloctadecanoate. 1 H-NMR (500MHz, CDCl3) δ7.96(d,J=7.5Hz,2H),7.62(t,J=7.5Hz,1H),5.22(s,4H),4.25(t,4H),3.55(m,4H),3.20(s ,12H),2.32(s,4H),1.77-1.66(m,12H),1.44(s,12H),1.40-1.22(m,56H),0.88(t,6H).LC / MS(ESI,m / z)=498.31[M] 2+ .

[0128] Example 15: Preparation method of single-chain ester-based ROS-responsive cation E22-1:

[0129] Step 1: Synthesis of intermediate 4-(dimethylamino)butyl docosanoate

[0130] The preparation method is the same as in Example 5, except that the raw material n-decanoic acid is replaced with docosic acid. 1 H-NMR(500MHz, CDCl3)δ4.26(t,2H),2.51(s,2H),2.34(s,2H),2.20(s,6H),1.6 0-1.50(m,4H),1.32-1.18(m,38H),0.88(t,3H).LC / MS(ESI,m / z)=440.55[M+H] + .

[0131] Step 2: Synthesis of single-chain ester ROS-responsive cation E22-1:

[0132] The preparation method is the same as in Example 5, except that the intermediate 4-(dimethylamino)butyldecanoate is replaced with 4-(dimethylamino)butyldodecanoate. 1 H-NMR (500MHz, CDCl3) δ7.95(d,J=7.6Hz,2H),7.61(t,J=7.6Hz,1H),5.25(s,4H),4.22(t,4H),3.54( m,4H),3.20(s,12H),2.33(s,4H),1.75-1.65(m,12H),1.44(s,12H),1.42-1.24(m,72H),0.87(t,6H).

[0133] Example 16: Preparation method of double-chain ester-based ROS-responsive cation E12-2:

[0134] Step 1: Synthesis of intermediate 2-[2-dodecanoyloxyethyl(methyl)amino]ethyl dodecanoate:

[0135] 1.0 g (4.99 mmol, 2.1 equiv) of dodecanoic acid, 284 mg (2.38 mmol, 1.0 equiv) of N-methyldiethanolamine, 58.2 mg (4.76 mmol, 0.2 equiv) of 4-dimethylaminopyridine, and 1.08 g (5.23 mmol, 2.2 equiv) of 1,3-dicyclohexylcarbodiimide were dissolved in 100 mL of dichloromethane solution, and the reaction was carried out overnight at room temperature. The solvent was removed by vacuum distillation, and the mixture was purified by column chromatography using dichloromethane:methanol = 150:1 as the eluent. 1H-NMR (500MHz, CDCl3) δ4.13-4.05(m,4H),2.63(t,J=5.9Hz,4H),2.28(s,3H),2.24(t,J=7.6Hz, 4H),1.59-1.50(m,4H),1.28-1.14(m,32H),0.81(t,J=6.9Hz,6H).LC / MS(ESI,m / z)=484.14[M+H] + .

[0136] Step 2: Synthesis of the double-chain ester ROS-responsive cation E12-2

[0137] 100 mg (257 μmol, 1.0 equiv) of pinacol 2,6-dibromomethylphenylboronic acid and 272 mg (564 μmol, 2.2 equiv) of ethyl 2-[2-dodecanoyloxyethyl(methyl)amino]dodecanoate were dissolved in 2 mL of a mixed solution of dichloromethane and methanol, and the solution was stirred overnight. After rotary evaporation, the solution was purified by column chromatography to obtain the final product, with a gradient eluent from dichloromethane to dichloromethane:methanol = 3:1. 1 H-NMR (500MHz, CDCl3) δ8.03(d,J=7.2Hz,2H),7.57(t,J=7.2Hz,1H),5.57(s,4H),4.60(d,J=14.0Hz,8H),4.13(m,8H),3.50 (s,6H),2.35(t,J=7.6Hz,8H),1.59(m,8H),1.40(s,12H),1.26(s,64H),0.88(t,J=6.8Hz,12H).LC / MS(ESI,m / z)=598.49[M] 2+ .

[0138] Example 17: Preparation method of double-chain ester-based ROS-responsive cation E14-2:

[0139] Step 1: Synthesis of intermediate ethyl 2-[2-tetradecanoyloxyethyl(methyl)amino]tetradecanoate:

[0140] The preparation method is the same as in Example 16, except that the raw material dodecanoic acid is replaced with tetradecanoic acid. 1 H-NMR (500MHz, CDCl3) δ4.12-4.06 (m, 4H), 2.63 (t, J = 6.0Hz, 4H), 2.29 (s, 3H), 2.23 (t, J = 7.6Hz, 4H),1.58-1.48(m,4H),1.28-1.12(m,40H),0.84(t,J=6.9Hz,6H).LC / MS(ESI,m / z)=540.36[M+H] + .

[0141] Step 2: Synthesis of the double-chain ester ROS-responsive cation E14-2

[0142] The preparation method is the same as in Example 16, except that the intermediate 2-[2-dodecanoyloxyethyl(methyl)amino]ethyl dodecanoate is replaced with 2-[2-tetradecanoyloxyethyl(methyl)amino]tetradecanoate. 1 H-NMR (500MHz, CDCl3) δ8.02(d,J=7.1Hz,2H),7.58(t,J=7.1Hz,1H),5.57(s,4H),4.58(m,8H),4.12(d,8H),3.50(s, 6H),2.37(t,J=7.6Hz,8H),1.59(m,8H),1.44(s,12H),1.31-1.15(s,80H),0.88(m,12H).LC / MS(ESI,m / z)=654.68[M] 2+ .

[0143] Example 18: Preparation method of double-chain ester-based ROS-responsive cation E18-2:

[0144] Step 1: Synthesis of intermediate ethyl 2-[2-octadecyloxyethyl(methyl)amino]octadecanoate:

[0145] The preparation method is the same as in Example 16, except that the raw material dodecanoic acid is replaced with tetradecanoic acid. 1 H-NMR (500MHz, CDCl3) δ4.10(m,4H),2.62(t,J=6.0Hz,4H),2.27(s,3H),2.22(t,J=7.5Hz,4H) ,1.57-1.46(m,4H),1.28-1.10(m,56H),0.82(t,J=6.9Hz,6H).LC / MS(ESI,m / z)=652.48[M+H] + .

[0146] Step 2: Synthesis of the double-chain ester ROS-responsive cation E18-2

[0147] The preparation method is the same as in Example 16, except that the intermediate 2-[2-dodecanoyloxyethyl(methyl)amino]ethyl dodecanoate is replaced with 2-[2-octadecanoyloxyethyl(methyl)amino]ethyl octadecanoate. 1H-NMR (500MHz, CDCl3) δ7.99 (d, J = 7.2Hz, 2H), 7.56 (t, J = 7.2Hz, 1H), 5.56 (s, 4H), 4.54 (m, 8H), 4.1 4(d,8H),3.50(s,6H),2.35(m,8H),1.59(m,8H),1.44(s,12H),1.31-1.14(s,112H),0.85(m,12H).

[0148] Example 19: Preparation method of double-chain ester-based ROS-responsive cation E22-2:

[0149] Step 1: Synthesis of intermediate 2-[2-icosicoyloxyethyl(methyl)amino]ethyl docosanoate:

[0150] The preparation method is the same as in Example 16, except that the raw material dodecanoic acid is replaced with tetradecanoic acid. 1 H-NMR (500MHz, CDCl3) δ4.12(m,4H),2.61(t,J=6.1Hz,4H),2.27(s,3H),2.20(t,J=7.6Hz,4H) ,1.58-1.46(m,4H),1.31-1.10(m,72H),0.81(t,J=6.9Hz,6H).LC / MS(ESI,m / z)=764.55[M+H] + .

[0151] Step 2: Synthesis of the double-chain ester ROS-responsive cation E22-2

[0152] The preparation method is the same as in Example 16, except that the intermediate 2-[2-dodecanoyloxyethyl(methyl)amino]ethyl dodecanoate is replaced with 2-[2-eicosyloxyethyl(methyl)amino]ethyl dodecanoate. 1 H-NMR(500MHz, CDCl3)δ8.00(d,J=7.2Hz,2H),7.55(t,J=7.2Hz,1H),5.53(s,4H),4.52(m,8H),4.1 5(d,8H),3.51(s,6H),2.32(m,8H),1.58(m,8H),1.42(s,12H),1.33-1.14(s,144H),0.82(m,12H).

[0153] Example 20: Preparation method of ROS-free cation N1:

[0154] Step 1: Synthesis of intermediate 1,3-bis(bromomethyl)-2-chlorobenzene

[0155] 966 mg (6.9 mmol, 1.0 equiv) of 2-chloro-1,3-dimethylbenzene, 113 mg (0.69 mmol, 0.1 equiv) of azobisisobutyronitrile, and 2.56 g (14.4 mmol, 2.1 equiv) of N-bromosuccinimide were dissolved in carbon tetrachloride, and the reaction mixture was stirred and refluxed overnight. After filtering off the precipitate, the solvent was evaporated to dryness, and the product was rapidly analyzed by column chromatography with dichloromethane to give 1.5 g of product, in 73% yield. 1 H-NMR (500MHz, CDCl3) δ7.52 (t, J = 7.9Hz, 2H) 7.18 (d, J = 7.9Hz, 1H), 4.82 (s, 4H).

[0156] Step 2: Synthesis of ROS-free cation N1:

[0157] 76.0 mg (257 μmol, 1.0 equiv) of 1,3-bis(bromomethyl)-2-chlorobenzene and 272 mg (564 μmol, 2.2 equiv) of ethyl 2-[2-dodecanoyloxyethyl(methyl)amino]dodecanoate were dissolved in 2 mL of a mixed solution of dichloromethane and methanol, and the solution was stirred overnight. After rotary evaporation, the solution was purified by column chromatography to obtain the final product, with a gradient eluent from dichloromethane to dichloromethane:methanol = 3:1. 1 H-NMR (500MHz, CDCl3) δ7.77(d,J=7.9Hz,2H),7.38(t,J=7.2Hz,1H),5.51(s,4H),4.58(m,8H),4.08(m,8H),3.4 4(s,6H),2.32(t,J=7.6Hz,8H),1.57(m,8H),1.26(s,64H),0.85(t,J=6.8Hz,12H).LC / MS(ESI,m / z)=598.49[M] 2+ .

[0158] Example 21: Preparation method of ROS-responsive cationic / ROS-free cationic polymer nanomaterials (NPs):

[0159] 10mg MPEG 2K -PLGA 11K(75 / 25) was dissolved in 2 mL of N,N-dimethylformamide to prepare a 5 mg / mL solution. ROS-responsive cations / non-ROS-responsive cations from Table 1 were dissolved in N,N-dimethylformamide to prepare 4.2 μmol / mL solutions. siRNA was prepared as a 100 nmol / mL aqueous solution. 200 μL of polymer solution and an appropriate amount of cation solution (N / P ratios of cation to siRNA were 2 and 1, respectively) were mixed thoroughly, and then 10 μL of siRNA solution was added. After thorough mixing, the solution was slowly added to 5 mL of PBS solution using a 1 mL sterile syringe. After stirring for 2 min, the solution was concentrated using an ultrafiltration centrifuge tube. After washing twice with PBS solution, the siRNA concentration was determined by measuring the Cy5 fluorescence intensity using a microplate reader (Molecular Device, MD), and then prepared as 1 nmol / mL or 10 nmol / mL solutions. The ROS-responsive cations used were those listed in Table 1.

[0160] Example 22: Preparation method of PEI control group polymer nanomaterials:

[0161] Polyethyleneimine (PEI, MW = 10000) was dissolved in N,N-dimethylformamide to prepare a 0.722 mg / mL solution. 200 μL of the PEI solution and 50 μL of 10 mg / mL MPEG were then added. 2K -PLGA 11K Mix (75 / 25) N,N-dimethylformamide solution and add 20 nmol μL siRNA solution. After thorough mixing, slowly add to 5 mL PBS solution using a 1 mL sterile syringe. Stir for 2 min, concentrate using an ultrafiltration centrifuge tube, wash twice with PBS solution, and then measure the Cy5 fluorescence intensity using a microplate reader (Molecular Device, MD) to determine the siRNA concentration, preparing a 10 nmol / mL solution.

[0162] Example 23: Particle size and Zeta potential of ROS-responsive cationic polymer nanomaterials:

[0163] The particle size and zeta potential of all nanomaterials were measured using a Nano-ZS90 Nanosizer (Malvern Panalytical Ltd, Malvern, UK). As shown in Table 1, the diameters of all the measured nanomaterials were in the range of 80–120 nm, and the zeta potentials were around -5.0 mV.

[0164] Table 1

[0165]

[0166]

[0167] Example 24: In vitro cell silencing experiment

[0168] HeLa-Fluc and HCT116-Fluc cells were divided into 3×10 3 Cells / well were seeded at 100 μL of DMEM medium containing 10% serum and cultured for 24 h at 37°C in a 5% CO2 incubator. Nanomaterials were then added to the wells at different concentrations. After 48 h of incubation, the fluorescence values ​​of Cy5 cells were read using a microplate reader (excitation wavelength 640 nm, emission wavelength 680 nm). Subsequently, some cells were added to a luciferase assay kit, and the fluorescence intensity of the luciferase was measured using a microplate reader. Cell viability was assessed using a cell viability assay kit. The IC50 values ​​for fluorescence silencing of each nanoparticle were determined. 50 The values ​​are shown in Table 2.

[0169] Table 2

[0170]

[0171]

[0172] The results are as follows Figure 5 As shown, each single-chain alkyl ROS-responsive cationic nanomaterial exhibits a certain silencing effect at different N / P ratios (1 or 2). Among them, the ROS-responsive cationic C16 nanoparticles, at an N / P ratio of 2, showed excellent silencing effects on both HCT116 and HeLa cells without cytotoxicity. Other single-chain alkyl ROS-responsive cationic nanoparticles all exhibited some cytotoxicity. Single-chain ester-based ROS-responsive cationic nanoparticles all showed some silencing effect, but at high concentrations (20 and 50 nM), they exhibited strong cytotoxicity. Figure 6 For double-chain ester ROS-responsive cations, E12-2 showed a good silencing effect in both cell types at an N / P ratio of 2 (IC50). 50 <5nM), and has no cytotoxicity ( Figure 7 While E22-2 exhibited a similar silencing effect on cells, it also showed cytotoxicity at low concentrations. Therefore, the double-chain ester-based ROS-responsive cation E12-2 was ultimately selected as the most effective cation for subsequent property determination.

[0173] As a control, nanomaterials prepared with ROS-free cations as described in Example 20 (N / P ratio of 2) were used. Figure 8The results showed no silencing effect at any concentration, indicating that ROS response plays a crucial role in cell delivery. Using commercially available PEI as a positive control, it could silence cell fluorescence at concentrations of 10, 20, and 50 nM, but it also exhibited significant cytotoxicity at these concentrations. This demonstrates that, in comparison, E12-2 cationic nanoparticles not only have a better silencing effect but also lack toxicity, indicating better safety.

[0174] Example 25: In vivo tissue distribution and tumor silencing experiment

[0175] Thirty null / null mice were randomly divided into 6 groups. Cells were harvested during exponential growth prior to implantation. 10 million Hela-Fluc cells in DMEM were mixed with Matrigel at a 1:1 ratio and subcutaneously injected into the right side of athymic null mice. Tumors were allowed to solidify and reach a size of approximately 60 cm². 3 Subsequently, mice were injected via tail vein with saline, siRNA, PEI nanoparticles, and E12-2 nanoparticles (N / P ratio of 2, doses of 375, 750 μg / kg, and 1.50 mg / kg, respectively), once daily for two consecutive days. The mice were euthanized 24 hours after the second injection.

[0176] The internal organs and tumors of mice were isolated, ground into powder, and 100 μL of the supernatant was taken and its fluorescence was detected in a 96-well plate using an ELISA reader.

[0177] Organizational distribution results as follows Figure 9 As shown, siRNA showed relatively low enrichment levels in various organs and tumors. PEI-loaded siRNA was mainly enriched in the liver, spleen, and kidneys, with very low fluorescence in tumors. In contrast, E12-2 nanoparticles at various concentrations were mainly enriched in tumors, and the fluorescence intensity was dose-dependent. This indicates that such ROS-responsive cationic nanoparticles facilitate the delivery of siRNA to tumor tissues.

[0178] Tumor fluorescence silencing results as follows Figure 10 As shown, compared to the control group, the fluorescence intensity in tumors did not decrease with the siRNA and PEI groups, indicating that free siRNA cannot effectively enter tumor cells, and PEI as a drug carrier is insufficient for effective siRNA delivery. All three groups of E12-2 NPs produced varying degrees of silencing effect on tumor fluorescence intensity, which was dose-dependent. This indicates that after these ROS-responsive cationic nanoparticles deliver siRNA to tumor tissue, they can further efficiently deliver siRNA to tumor cells, thereby achieving gene silencing.

[0179] In summary, the above examples demonstrate that the E12-2 cation exhibits high loading efficiency for siRNA under an N / P ratio of 2, enabling efficient delivery of siRNA into cells without cytotoxicity. Its nanomaterials can also effectively aggregate siRNA at tumor sites, achieving gene silencing in tumor cells. This indicates that E12-2 and similar cations are suitable for preparing siRNA gene delivery nanoparticles.

Claims

1. A ROS-responsive cation, characterized in that, The ROS-responsive cation is selected from one of quaternary ammonium salt cation II and quaternary ammonium salt cation III, the quaternary ammonium salt cation II is a single-chain ester ROS-responsive cation, the quaternary ammonium salt cation III is a double-chain ester ROS-responsive cation, and the chemical structural formulas are as follows: wherein R2 is selected from a C9-C21 straight-chain alkyl group, or R3 is selected from a C11-C21 straight-chain alkyl group.

2. The ROS-responsive cation of claim 1, wherein, In a ROS environment, the phenylboronic ester structure of the ROS-responsive cation is decomposed to generate a phenol structure, and the quaternary ammonium salts on both sides are reduced to tertiary amine molecules.

3. Use of the ROS-responsive cation of claim 1 in the preparation of an siRNA delivery carrier.

4. A siRNA delivery nanoparticle, characterized in that, The nanoparticle comprises: Component (1): the ROS-responsive cation of claim 1; Component (2): a methyl polyethylene glycol-polylactic acid glycolic acid copolymer; Component (3): an siRNA with a silencing effect; The positively charged component (1) and the negatively charged component (3) are combined with each other, and then wrapped by the component (2) to form a nanoparticle.

5. The siRNA delivery nanoparticle of claim 4, wherein, The N / P ratio of the component (1) and the component (3) is 1 or 2.

6. The siRNA delivery nanoparticle of claim 4, wherein, The nanoparticle has a particle size of 80-120 nm.

7. Use of the ROS-responsive cation of claim 1 in the preparation of a drug for treating a tumor disease.

8. Use of the siRNA delivery nanoparticle of any one of claims 4-6 in the preparation of a drug for treating a tumor disease.

Images