Chitin synthase 1 (LmCHS1) gene, its dsRNA, its synthesis method, and its insect resistance application in the leafminer moth.

Abstract

This invention discloses the chitin synthase 1 (LmCHS1) gene of the leafminer moth, its dsRNA, its synthesis method, and its insect-resistant applications. Through transcriptome analysis, specific primer pairs for the open reading frame of the LmCHS1 gene were designed and synthesized. The LmCHS1 gene sequence was obtained through gene cloning (nucleotide sequence: SEQ ID NO: 1, amino acid sequence: SEQ ID NO: 2). The gene fragment with sequence SEQ ID NO: 3 was selected as the RNAi target sequence. Primer pairs SEQ ID NO: 6 and SEQ ID NO: 7 with restriction enzyme sites were designed and synthesized. PCR amplification was performed, and a prokaryotic expression vector was constructed to induce dsRNA expression. Feeding leafminer moth larvae with dsRNA interfered with LmCHS1 gene expression. After 24 hours, abnormalities were observed in the larvae's body surface, with some larvae failing to complete molting or dying due to an inability to form a normal body surface after molting. After 96 hours, the larval mortality rate was 72.22%, compared to 40% in the GFP control group, demonstrating a significant effect. This invention has broad application prospects in the control of the leaf borer pest in forestry due to its high efficiency, specificity, and safety.

Description

Technical Field

[0001] This invention relates to the field of forest pest control technology, specifically to a chitin synthase 1 (LmCHS1) gene of the leaf borer, its dsRNA, its synthesis method, and its insect resistance application. Background Technology

[0002] The walnut leaf borer (Locastra muscosalis Walker), also known as the walnut leaf borer, belongs to the family Pyralidae in the order Lepidoptera. This pest is prevalent in southern my country, primarily damaging trees such as lacquer trees, Chinese pistache, walnut trees, and sweetgum. With rising temperatures and increased urbanization in recent years, the leaf borer has been spreading northwards annually, and reports have surfaced in Liaoning and Heilongjiang provinces. The larvae hatch in large numbers, spinning silken nests that cover leaves. They are active and easily moved, quickly darting back and hiding within leaves when disturbed. They are highly mobile, and both young and mature larvae are resistant to starvation. Therefore, an outbreak often damages several neighboring trees, particularly in monoculture seed orchards or plantations. If not controlled promptly at the initial stage of an outbreak, the same forest area can suffer repeated damage year after year, severely impacting tree viability and ornamental value. There are various methods for controlling this pest, including manual control, physical control, chemical control, and biological control. Among these, the most widely applicable method is chemical control, which mainly involves spraying pesticides such as cypermethrin and diflubenzuron.

[0003] RNA interference (RNAi), also known as gene silencing, refers to the phenomenon where double-stranded RNA molecules induce the specific degradation of homologous mRNA, thereby silencing a specific target gene. Pest infestations harm plant growth and development, leading to decreased forestry or agricultural productivity. Common control methods primarily involve spraying pesticides, which are costly, pollute the environment, and even threaten human health. Faced with this challenge, RNAi technology has become an important method for insect control due to its high efficiency, specificity, and heritability. Its main mechanism is to introduce dsRNA of the target gene into the insect, silencing the endogenous gene and causing developmental disorders, reduced reproduction, or even death in the insect.

[0004] Chitin, also known as chitosan, is a polysaccharide widely distributed in insects, arthropods, and other living organisms. The presence of chitin ensures the normal growth of the insect's cuticle and feeding membrane, plays a crucial role in nutrient absorption and molting, and even affects the insect's life. CHS1 is primarily responsible for the synthesis of chitin in the insect's cuticle and trachea, participating in vital life activities such as molting. To date, lethal effects caused by silencing the CHS1 gene have been found in various insects, but there are currently no research reports on CHS1 in the leaf-bearing moth (C. truncatula) both domestically and internationally. Summary of the Invention

[0005] To address the aforementioned problems, the present invention aims to provide a chitin synthase 1 (LmCHS1) gene of the leaf borer that can be used as a drug target for the control of the leaf borer.

[0006] Another objective of this invention is to provide a method for preventing and controlling larvae from dying by feeding the LmCHS1 gene of the leaf borer to the leaf borer. This method causes some larvae to die due to abnormalities such as being unable to complete the molting process normally or failing to form a normal body surface after molting.

[0007] To achieve the above-mentioned objectives, the present invention employs the following technical solution:

[0008] This invention provides an LmCHS1 gene of the leaf-bearing moth, the nucleotide sequence of which is shown in SEQ ID NO: 1 and the amino acid sequence of which is shown in SEQ ID NO: 2. The LmCHS1 gene coding region of the leaf-bearing moth is 4692 bp in length and encodes 1563 amino acids.

[0009] The present invention provides the nucleotide sequence of the target fragment corresponding to the dsRNA synthesized based on the LmCHS1 gene of the above-mentioned leaf-bearing moth, as shown in SEQ ID NO: 3.

[0010] The present invention also provides a specific primer pair for obtaining the open reading frame of the LmCHS1 gene of the above-mentioned leaf-bearing moth, the upstream primer sequence is shown in SEQ ID NO:4, and the downstream primer sequence is shown in SEQ ID NO:5.

[0011] This invention also provides primer pairs for synthesizing the RNAi interference target fragment, specifically primers with an L4440 restriction site, the upstream primer sequence being shown in SEQ ID NO. 6, and the downstream primer sequence being shown in SEQ ID NO. 7.

[0012] This invention also provides a method for inducing dsRNA expression based on the LmCHS1 gene of the leaf-bearing moth, comprising the following steps:

[0013] (1) Based on the transcriptome data analysis of the leaf-leaf moth, specific primers for cloning the open reading frame of the LmCHS1 gene were designed and synthesized. The upstream primer sequence is shown in SEQ ID NO:4 and the downstream primer sequence is shown in SEQ ID NO:5. The primers were synthesized by a biotechnology company.

[0014] (2) Total RNA was extracted from *Eriocheir spp.* and cDNA was obtained by reverse transcription via RT-PCR.

[0015] (3) Using the cDNA obtained in (2) as a template and the primers synthesized in (1), the full-length LmCHS1 gene was amplified by PCR. The PCR system was as follows: 2 μL template, 5 μL 10x polymerase buffer, 1.5 μL upstream primer, 1.5 μL downstream primer, 1 μL R taq enzyme, 5 μL 2.5 mM dNTP, and 34 μL ddH2O. The amplification program was as follows: 94℃ for 3 min; 94℃ for 30 s, 58℃ for 1 min, and 72℃ for 1 min, for a total of 30 cycles; 72℃ for 8 min.

[0016] (4) After sequencing the PCR products, the gene sequence was analyzed using online analysis software, and a suitable RNAi interference target fragment was selected. Specific primers with the L4440 restriction sites SacⅠ (gagctc) and XbaⅠ (tctaga) were designed. The upstream primer sequence is shown in SEQ ID NO.6, and the downstream primer sequence is shown in SEQ ID NO.7.

[0017] (5) Construct the L4440 vector containing the selected target gene fragments, use the GFP sequence fragment as a negative control, and transform it into the host Escherichia coli HT115 to obtain HT115-L4440-LmCHS1 bacterial culture and the negative control HT115-L4440-GFP bacterial culture.

[0018] (6) Induction of dsRNA expression: The transformed E. coli in (6) were verified by PCR. The verified E. coli were inoculated into LB liquid medium containing 100 mg / L ampicillin and 50 mg / L tetracycline at a ratio of 1:50 and cultured overnight at 37°C. Then, the bacterial culture was cultured again at a ratio of bacterial culture to medium of 1:100 at 37°C and 200 rpm for about 3-4 hours until OD was reached. 600 =0.5, add IPTG to the bacterial culture to a final concentration of 1mM to induce double-stranded RNA expression, and incubate at 37℃ and 200rpm / min for about 5-6h;

[0019] The present invention also provides the application of the above-mentioned dsRNA to the insect resistance of the leafminer moth.

[0020] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0021] Multiple experiments have shown that the ingestion of dsRNA in the body of the leaf-bearing moth can effectively inhibit the expression of the LmCHS1 gene. After 24 hours, abnormalities were observed on the body surface of the larvae, and some larvae were unable to complete the molting process normally or died because they could not form a normal body surface after molting. After 96 hours, the larval mortality rate was 72.22%, while the GFP control group had a mortality rate of 40%, indicating a significant effect.

[0022] Furthermore, the use of dsRNA to inhibit the larvae of the leaf borer exhibits strong species specificity and will not cause gene interference to other species. Simultaneously, dsRNA is easily degraded in the natural environment, and the bacterial solution involved is the commonly used *E. coli*, making it environmentally friendly. Therefore, given the high efficiency, specificity, and safety of this invention, it has broad application prospects in the insect resistance of leaf borer larvae and offers significant economic benefits for protecting my country's forestry resources and ecological security. Attached Figure Description

[0023] Figure 1 Phenotypic changes in leaf borer larvae after ingestion of dsRNA are shown, with the leftmost image representing the normal larval stage of the control group.

[0024] Figure 2 To illustrate the changes in mortality rates of leafminer larvae within 72 hours of dsRNA ingestion, note: one-way ANOVA was used for significance analysis. Error bars represent standard errors, and data represent the mean ± SE of replication of three independent organisms. An asterisk indicates a significant difference between the treatment group and the control group; *p<0.05, **p<0.01.

[0025] Figure 3 The relative expression level of LmCHS1 after dsRNA expression in bacterial culture is shown. Note: One-way ANOVA was used for significance analysis. Error bars represent standard errors, and data represent the mean ± SE of three independent replications. An asterisk indicates a significant difference between the treatment group and the control group, *p<0.05, **p<0.01, ***p<0.001. Detailed Implementation

[0026] To better understand the present invention, the following embodiments are provided to further illustrate the content of the present invention. The embodiments given are only for illustrating the present invention and are not intended to limit the scope of the present invention.

[0027] The embodiments provided below are intended as a guide for those skilled in the art to make further improvements and are not intended to limit the invention in any way.

[0028] Unless otherwise specified, the experimental methods described in the following examples are conventional methods.

[0029] Unless otherwise specified, the materials, reagents, carriers, etc. used in the following examples are all commercially available.

[0030] Example 1: Obtaining the LmCHS1 gene sequence of *Pteris vittata*

[0031] (1) Extraction of total RNA from leaf borer: RNA was extracted from fourth-instar larvae of leaf borer using Trizol reagent (Invitrogen);

[0032] (2) The total RNA extracted from the leaf borer was reverse transcribed into cDNA using the HiFiScript cDNA Synthesis Kit (Kangwei Biotechnology);

[0033] (3) Based on transcriptome alignment information, upstream and downstream primers for the target gene were designed using Primerpremier 5.0 software.

[0034] LmCHS1-F SEQ ID NO:4

[0035] GAGATGGCGACGTCGGGA

[0036] LmCHS1-R SEQ ID NO:5

[0037] GCCTTCTAAAATCTTCCCTGG

[0038] Primers were synthesized by qualified biotechnology companies;

[0039] (4) The full-length open reading frame of the target gene LmCHS1 was obtained by PCR amplification using cDNA as a template. The PCR system was as follows: 2 μL template, 5 μL 10x polymerase buffer, 1.5 μL upstream primer, 1.5 μL downstream primer, 1 μL R Taq enzyme, 5 μL 2.5 mM dNTP, and 34 μL ddH2O. The amplification program was as follows: 94℃ for 3 min; 94℃ for 30 s, 58℃ for 1 min, and 72℃ for 1 min, for a total of 30 cycles; 72℃ for 8 min.

[0040] (5) The target gene obtained in (4) was ligated into the pMD19-T vector and transformed into Escherichia coli DH5α competent cells. After PCR verification, the positive clones that were verified were sent to Harbin Borui Xingke Biotechnology Co., Ltd. for sequencing to obtain the LmCHS1 gene sequence.

[0041] (6) Biological analysis was performed on the LmCHS1 sequence in (5). The nucleotide sequence of LmCHS1 is shown in SEQ ID NO: 1, and the amino acid sequence is shown in SEQ ID NO: 2. The results are as follows:

[0042] The LmCHS1 gene of the leafminer moth has a full-length coding region of 4692 bp, encoding 1563 amino acids, with a molecular weight of 178077.22 and a theoretical isoelectric point of 6.50. Based on protparam analysis, the molecular formula of this protein is C1. 8064 H 12613 N 2107 O 2283 S 77Of its 1563 amino acids, the highest proportion is Leu (10.7%) and the lowest is Cys (1.7%). The total number of negatively charged amino acids (Asp+Glu) is 184, and the total number of positively charged amino acids (Arg+Lys) is 176. Its instability coefficient is 42.73, which makes it an unstable protein.

[0043] Example 2: Prokaryotic expression of dsRNA of LmCHS1 gene in *Pteris vittata*

[0044] (1) Target fragment selection

[0045] Using online prediction software such as https: / / rnaidesigner.thermofisher.com / rnaiexpress / design.do and http: / / sidirect2.rnai.jp / , the effective interference sites of LmCHS1 gene siRNA were predicted, appropriate target fragments were selected, and the nucleotide sequence of the target fragment corresponding to the dsRNA was synthesized as shown in SEQ ID NO: 3;

[0046] (2) Primer design for RNAi interference fragments

[0047] Primers for the target gene were designed using Primerpremier 5.0 based on the sequence information, and restriction enzyme sites SacⅠ (gagctc) and XbaⅠ (tctaga) were added to both ends of the primers, respectively.

[0048] The upstream primer sequence is shown in SEQ ID NO.6: ACA GAGCTC TCTCCCTACGCAATGTCA

[0049] The downstream primer sequence is shown in SEQ ID NO.7: GGC TCTAGA CAGGCGAGGTGTTAATCT

[0050] The underlined parts are enzyme cleavage sites, and all primers were synthesized by qualified biotechnology companies;

[0051] Meanwhile, a GFP sequence fragment from the prokII-GFP vector with a similar fragment size was selected as a negative control.

[0052] (3) RNAi interference fragments were obtained by PCR amplification, cloned by conventional methods, and then sequenced for verification.

[0053] (4) Construction of prokaryotic expression system

[0054] For the bacterial culture with correct sequencing in (3), plasmid extraction was performed using the TIANprep Mini Plasmid Kit (centrifuge column type) from Tiangen. The extracted LmCHS1 and GFP interference fragment single clone plasmids were double-digested with L4440 plasmid and electrophoresed. The target band was recovered using the ordinary agarose gel DNA recovery kit from Tiangen, and ligated with T4 ligase and transformed into HT115 Escherichia coli competent cells.

[0055] (5) Induction of dsRNA expression and total nucleic acid extraction

[0056] The target gene and GFP bacterial culture were inoculated at a ratio of 1:50 into LB liquid medium (5g yeast extract, 10g peptone, 10g sodium chloride, dissolved in 1L deionized water, pH adjusted to 7.2, sterilized at 115℃ for 30 min) containing 100mg / L ampicillin and 50mg / L tetracycline. The medium was then incubated overnight at 37℃ with shaking at 200 rpm. Afterward, the bacterial culture was mixed at a ratio of 1:100 to the culture medium and incubated at 37℃ with shaking at 200 rpm for approximately 3-4 hours until OD was reached. 600 =0.5, add 1mM IPTG to the bacterial culture to induce double-stranded RNA expression, incubate at 37℃ with shaking at 200 rpm for about 5-6 hours, then extract total nucleic acid with phenol and chloroform:

[0057] A. Set the refrigerated centrifuge to 4°C in advance, and ventilate the ultra-clean workbench after UV sterilization.

[0058] B. Collect 1 mL of IPTG-induced bacterial culture and uninduced bacterial culture, centrifuge at 4℃ and 10000 rpm for 5 min, and discard the supernatant.

[0059] C. Add 700 μL of STE buffer (pH 5.0) to suspend the precipitate, add an equal volume of phenol:chloroform mixture (25:24, pH = 8.0), vortex for more than 100 seconds until the cells are fully lysed;

[0060] Centrifuging at 13000g for 5 minutes at 4℃ will allow you to observe clear stratification of the mixture, with the upper layer being the total nucleic acid of the bacteria.

[0061] Purification of dsRNA:

[0062] A. Take a portion of the supernatant and add 10:1 volume of RNase A dilution solution to digest with DNase III. The reaction time is 37℃ for 5 min and 75℃ for 5 min.

[0063] B. After digestion, add 5xRNALoading Buffer in a 5:1 ratio and detect the results using 1.5% agarose gel electrophoresis;

[0064] C. If induction is successful, a dsRNA band of the same length as the target fragment can be observed.

[0065] Example 3: Application of insect resistance to LmCHS1 gene dsRNA in *Pteris vittata*

[0066] (1) Uptake of LmCHS1 gene dsRNA by leaf-bearing borer larvae

[0067] Third-instar leaf borer larvae with consistent and good growth were selected as experimental insects. Fresh walnut tree leaves were picked, and HT-L4440-LmCHS1 bacterial cells were diluted with double-distilled water at twice the volume. The solution was sprayed on the leaf surface, dried, and then used to feed the larvae. Fresh leaves were replaced twice a day. Each treatment consisted of 20 larvae and was repeated 3 times.

[0068] (2) Observe the larval stage in (1).

[0069] Over 24 hours, abnormalities were observed on the larvae's body surface, with some larvae failing to complete the molting process normally or dying after molting due to the inability to form a normal body surface. Figure 1 After 96 hours, the larval mortality rate was 72.22%, while the GFP control group had a mortality rate of 40%. Figure 2 The effect was remarkable.

[0070] (3) Determination of LmCHS1 gene expression level in larvae

[0071] Total RNA was extracted from larvae at 24h, 48h, and 72h after larval ingestion of dsRNA using standard methods, and cDNA was synthesized. qPCR detection was performed using the TAKARA TB Green Premix Ex Taq (Tli RNase HPlus) kit. β-actin was used as an internal reference gene, and its expression level was determined by [details omitted]. The relative expression levels of the LmCHS1 gene after feeding with *Eriocaulon buergerianum* were calculated using SPSS and Origin statistical software, and then analyzed and plotted.

[0072] Compared with the control group, the mRNA expression level of the target gene in the experimental group was significantly reduced, reaching only 16.36% of that in the LmCHS1 group at 72 hours. Figure 3 The results showed that the ingestion of dsRNA by the leaf-bearing borer larvae could silence the corresponding target genes in the larvae.

[0073] Example 4: Non-target effects of gene interference

[0074] To verify the specificity of RNAi, the same method as in Example 3 was used to feed the walnut leaf beetle. The results showed that within 96 hours of feeding, the feeding status, body morphology, growth process and mortality of the walnut leaf beetle larvae were not significantly different from those of the GFP control group. Most larvae were able to complete the growth stages such as molting and pupation normally, indicating that the dsRNA of the LmCHS1 gene of the leaf beetle has no effect on non-target insects and has specificity and safety.

[0075] Obviously, the above embodiments are merely examples for clear illustration and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A chitin synthase 1 (LmCHS1) gene of the leaf-bearing moth, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

2. A dsRNA based on the chitin synthase 1 (LmCHS1) gene of the leaf-bearing moth as described in claim 1, characterized in that: The nucleotide sequence of the target fragment corresponding to the dsRNA is shown in SEQ ID NO:

3.

3. A method for synthesizing the dsRNA of the chitin synthase 1 gene of *Ceratophyllum demersum*, characterized in that, Includes the following steps: (1) Based on the gene sequence described in claim 1, primers were designed and synthesized, and the accuracy of the LmCHS1 gene sequence was determined by PCR amplification, sequencing, and sequence analysis. (2) Target sequence prediction for LmCHS1 gene RNAi interference, primer design and synthesis, PCR amplification, and obtaining target fragment SEQ ID NO: 3; (3) The target fragment was constructed into the L4440 vector and transformed into the host Escherichia coli HT115 to obtain recombinant bacteria, named HT115-L4440-LmCHS1; (4) The expression of dsRNA of the LmCHS1 gene was determined by inducing the recombinant bacteria with IPTG; 4. The application of the dsRNA according to claim 2 in the preparation of an insecticide for controlling the leafminer moth.

5. A chitin synthase 1 (LmCHS1) from the leaf-bearing moth, characterized in that: The amino acid sequence is shown in SEQ ID NO:

2.

6. The dsRNA synthesis method according to claim 3, characterized in that: The primer nucleotide sequences of the dsRNA target fragment in step (2) are shown in SEQ ID NO.6 and SEQ ID NO.7, respectively.

Images