Application of SlEXP1 and SlCEL2 genes in improving storage and transportability of tomato fruits

By synergistically editing the SlEXP1 and SlCEL2 genes, the recombinant vector CDC45-1300 was constructed, which significantly improved the firmness of tomato fruits. This solved the problem that single gene knockout could not effectively improve storage and transportability, and achieved a significant increase in fruit firmness and an extension of the storage and transport period.

CN116355952BActive Publication Date: 2026-05-19ZHEJIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ZHEJIANG UNIV
Filing Date
2023-01-09
Publication Date
2026-05-19

AI Technical Summary

Technical Problem

In existing technologies, knocking out the SlEXP1 or SlCEL2 gene alone cannot effectively slow down the softening rate of tomato fruit, resulting in poor storage and transportability. There is a lack of effective multi-gene synergistic catalytic methods to improve fruit firmness.

Method used

By designing guide RNA to insert into the CDC45-1300 vector, and using Agrobacterium EHA101 to infect and transform tomato cotyledons, SlEXP1 and SlCEL2 directional transgenic mutants were obtained, achieving simultaneous knockout of two key cell wall genes. The recombinant vector CDC45-1300 was then constructed to achieve gene editing.

Benefits of technology

It significantly improves the firmness of tomato fruits, increasing the firmness of the whole fruit by 57% during the color-breaking stage, 62% during the red fruit stage, and 96% during the skin piercing stage, extending the storage and transportation period by at least 2 weeks and significantly improving storage and transportation properties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004044084190000011
    Figure HDA0004044084190000011
  • Figure HDA0004044084190000012
    Figure HDA0004044084190000012
  • Figure HDA0004044084190000021
    Figure HDA0004044084190000021
Patent Text Reader

Abstract

The present application provides SlEXP1 and SlCEL2 Application of genes in improving storage and transportation of tomato fruits. Fruit softening is a complex process of cell wall hydrolysis and expansion, involving a series of synergistic catalysis of cell wall loosening and degradation related enzymes, and fruit firmness is an important indicator to measure the softening process, especially the postharvest shelf life softening rate directly affects the storage and transportation of fruits. In the past 30 years, the work on tomato has proved that knocking out a degradation enzyme coding gene cannot effectively slow down the fruit softening rate, and thus improve the storage and transportation of fruits. In the present application, two cell wall metabolism related genes SlEXP1 and SlCEL2 are simultaneously edited by gene editing, and the obtained double mutant shows that it can improve the fruit firmness, and thus improve the storage and transportation of tomato fruits. The present application provides a new strategy and means for improving the storage and transportation of fruits.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of biotechnology and genetic engineering, and relates to the application of SlEXP1 and SlCEL2 genes in improving the storage and transportability of tomato fruits, namely, the SlEXP1 and SlCEL2 double mutants and their synergistic effect to improve the firmness of tomato fruits and delay the softening process, thus improving the storage and transportability of tomato fruits. Technical Background

[0002] Fruit texture changes after ripening mainly fall into two categories: softening and lignification. Tomato fruit exhibits a typical softening type, and due to its well-developed genetic transformation system, it has been widely studied as a model fruit. Tomato softening is primarily caused by the relaxation and degradation of the primary cell wall. Currently, expansine (EXP) is considered a relaxation protein located on the cell wall, lacking enzymatic activity. EXP protein relaxes the cell wall structure by breaking the non-covalent bonds between filaments and xylglucan, facilitating cell wall degradation enzymes to access substrates and ultimately hydrolyze the cell wall, leading to fruit softening. Over the past 30 years, fruit softening research has focused on key encoding genes of proteins and enzymes related to primary cell wall relaxation and degradation, including SlEXP1, SlPME2, SlPG2a, SlPL, SlTBG4, SlEXP1, SlXTH5, and SlCEL2, all of which have undergone transgenic validation. Except for SlPL, the relationship between other genes and fruit softening remains largely unknown. Knocking out a single degradation enzyme encoding gene does not effectively slow down the rate of fruit softening or improve storage and transportability. Therefore, simultaneously knocking out two or more key cell wall metabolism genes with synergistic catalytic effects shows great promise for obtaining new germplasm materials with improved storage and transport resistance. No reports have been found regarding attempts to improve tomato fruit firmness using the SlEXP1 and SlCEL2 double knockout mutant. Summary of the Invention

[0003] The purpose of this invention is to provide the application of the SlEXP1 and SlCEL2 genes in improving the storage and transportability of tomato fruits. This invention designs guide RNAs based on the nucleotide sequences of SlEXP1 and SlCEL2, inserts them into the CDC45-1300 vector, electropoises them into Agrobacterium EHA101, and transforms tomato cotyledons to obtain SlEXP1 and SlCEL2 directed transgenic tomato mutants. The sgRNA sequences of SlEXP1 are shown in SEQ ID NO.1 and SEQ ID NO.2, and the sgRNA sequences of SlCEL2 are shown in SEQ ID NO.3 and SEQ ID NO.4. The gRNAs are designed based on the nucleotide sequences of SlEXP1 (SEQ ID NO.5) and SlCEL2 (SEQ ID NO.6).

[0004] This invention simultaneously edits the SlEXP1 and SlCEL2 genes, and the resulting double mutant can improve the firmness of tomato fruits, thereby improving the storage and transportability of tomato fruits.

[0005] This invention provides information on nucleotide sequence target mutations in the double mutants ec and single mutants exp1 and cel2 of SlEXP1 and SlCEL2.

[0006] This invention provides truncated amino acid sequences of SlEXP1 and SlCEL2 in the double mutant ec, which have lost their functions, as shown in SEQ ID NO.7 and SEQ ID NO.8.

[0007] This invention provides a truncated amino acid sequence of SlEXP1 with loss of function in the single mutant exp1, as shown in SEQ ID NO. 9, and a truncated amino acid sequence of SlCEL2 with loss of function in the single mutant cel2, as shown in SEQ ID NO. 10.

[0008] This invention provides a method for constructing a recombinant vector (CDC45-1300) by fusing the gRNAs of SlEXP1 and SlCEL2 into the CDC45-1300 vector.

[0009] This invention utilizes Agrobacterium infection to transform recombinant plasmids into tomatoes, obtaining SlEXP1 and SlCEL2 directed mutant tomato fruits, and then performing phenotypic analysis.

[0010] This invention involves gene editing of two key cell wall genes, SlEXP1 and SlCEL2. When SlEXP1 and SlCEL2 are mutated individually, there is no significant difference in fruit firmness compared to the control fruit. However, when both SlEXP1 and SlCEL2 are knocked out simultaneously, high-firm fruit is obtained. Whole fruit compression tests show a 57% increase in firmness during the color-breaking stage and a 62% increase during the red fruit stage. Peel puncture tests show a 96% increase in firmness during the color-breaking stage and a 71% increase during the red fruit stage. Post-harvest shelf life tests show that the double-knockout mutant with both SlEXP1 and SlCEL2 knocked out can maintain its firmness for at least two weeks. This indicates that changes in fruit firmness require the coordinated action of multiple cell wall genes. Obtaining high-firm fruit improves storage and transportability, and multi-gene targeted mutation is a suitable strategy. Attached Figure Description

[0011] Figure 1 Correlation analysis of SlEXP1 and SlCEL2 expression in different fruit tissues showed that they were co-expressed.

[0012] Figure 2 .Target site editing status of nucleotide sequences in SlEXP1 and SlCEL2 mutants, (A) represents inserted bases, and ---- represents deleted bases.

[0013] Figure 3 Analysis of fruit firmness in SlEXP1 and SlCEL2 mutant tomatoes.

[0014] Figure 4 Postharvest shelf-life firmness analysis of SlEXP1 and SlCEL2 mutant tomato fruits. Detailed Implementation Plan

[0015] The present invention will be further described in conjunction with the accompanying drawings and embodiments.

[0016] Example 1

[0017] 1. Plant materials

[0018] The plant material used in this scheme was tomato AC (Ailsa Craig), which was grown in the plant factory of Zhejiang University under the following conditions: 16 hours of light (26-29℃) and 8 hours of darkness (17-22℃).

[0019] 2. Construction of recombinant vectors

[0020] Using the online software tool http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / SCORE, high-resolution small guide RNAs (sgRNAs) were selected from the exons of the SlEXP1 (Solyc06g051800) and SlCEL2 (Solyc09g010210) gene sequences, and the sgRNA sequences and their inverse complementary sequences were fused together.

[0021] sgRNA sequence:

[0022] SlEXP1-sgRNA1:

[0023] 5'-GATTGGCACATGCTACATTTTACGG-3'(SEQ ID NO.1)

[0024] 3'-CCCGTAAAATGTAGCATGTGCCAAA-5'(SEQ ID NO.2)

[0025] SlCEL2-sgRNA2:

[0026] 5'-GATTGAGAGACTCCGCATTACACGA-3'(SEQ ID NO.3)

[0027] 3'-CTCGTGTAATGCGGAGTCTCTCAAA-5'(SEQ ID NO.4)

[0028] sgRNA1 and sgRNA2 were ligated into the U6-T and U3-T vectors, respectively. The plasmids that were successfully ligated were used as templates for amplification with primers U6-T FP / U6-T RP and U3-T FP / U3-T RP, respectively.

[0029] Primer sequences:

[0030] U6-T FP:ACGACGGCCAGTGCCAAGCTTCATTCGGAGTTTTTG(SEQ ID NO.11)

[0031] U6-T RP:CATCACAGGCTCGAGCTCGAGCCATTTGTCTGCAG(SEQ ID NO.12)

[0032] U3-T FP:GACAAATGGCTCGAGCTCGAGCCTGTGATGGATAAC(SEQ ID NO.13)

[0033] U3-T RP:CTTTATCATCAGGAGCCCGGGAGCTCCATTTGTC(SEQ ID NO.14)

[0034] The U6 and U3 PCR amplification products were ligated 1:1 and used as templates for PCR amplification using U6T-FP / U3T-RP. The products were then ligated overnight with the CRISPR vector CDC45-1300 (double-digested with HindIII / XmaI) at a 3:1 ratio, followed by transformation and screening for positive clones. Successfully constructed plasmids were electroporated into competent Agrobacterium tumefaciens cells (EHA101) and genetically transformed using the cotyledon infection method to obtain transgenic tomato mutants. This method simultaneously constructs the sgRNAs of two genes into a single vector, thus requiring only one genetic transformation to obtain both single-knockout and double-knockout mutants.

[0035] 3. Genetic transformation of tomatoes

[0036] Tomato seeds were soaked in tap water, shaken to sterilize and clean, and then inoculated onto 1 / 2 MS medium (MS + 1% sucrose + 0.8% agar + 100 mg / L Inositol). They were cultured at 25°C in the dark for about 3 days until rooting, then transferred to a light-controlled culture room (25°C, 16h light / 8h dark). Cotyledons of sterile seedlings were cut off with a scalpel and placed with the underside facing up in KCMS medium (MS + 3% sucrose + 0.8% agar + 100 mg / L Inositol + 100 μM Acetosyringon) lined with filter paper for pre-culture for 1 day (overnight in the dark). The cotyledonary explants were scraped and transferred to a petri dish, then inoculated with a culture of Agrobacterium (OD600≈1.0). After 2-3 minutes, the cotyledons were transferred to sterile filter paper, the residual bacterial solution was blotted dry, and the undersides were returned to the KCMS medium. After co-culturing for 2 days (in the dark), the explants were carefully transferred to 2Z medium (MS + 3% sucrose + 0.8% agar + 2 mg / L Zeatin + 320 mg / L Timentin + 3 mg / L Hygromycin); after 2-3 weeks of culture, they were transferred to 0.2Z medium (MS + 3% sucrose + 0.8% agar + 0.2 mg / L Zeatin + 320 mg / L Timentin + 3 mg / L Hygromycin), and then transferred to 0.2Z medium every 2-3 weeks; when the regenerated plantlets grew to about 1 cm, they were cut off and placed in rooting medium (MS + 3% sucrose + 0.8% agar + 320 mg / L Timentin + 3 mg / L Hygromycin) to root; after 2-4 weeks, the well-rooted and vigorous transformed seedlings were transplanted into the soil.

[0037] 3. Identification of mutant materials and acquisition of homozygous mutants

[0038] Transgenic detection primers were designed 100–200 bp upstream and downstream of SlEXP1 and SlCEL2sgRNA, respectively.

[0039] Genetically modified organism (GMO) detection primers:

[0040] SlEXP1FP:CTTCAACAACCTCAACTCC(SEQ ID NO.15)

[0041] SlEXP1RP:GGAAGGGTTTCCAGGAAGACACC(SEQ ID NO.16)

[0042] SlCEL2FP:ATGGCGCCAAAATATACCTCC (SEQ ID NO.17)

[0043] SlCEL2RP:CACATTATCTCCGGCATCG(SEQ ID NO.18)

[0044] DNA from tomato leaves of transgenic plants was used as a template for PCR amplification. The product was ligated into the pGEM-T Easy vector and incubated overnight at 4°C. The ligation product was then transformed into DH5α competent Escherichia coli cells by heat shock at 42°C. Single colonies were sequenced after screening with ampicillin. The sequencing results were compared with the original sequences of SlEXP1 and SlCEL2 to determine the editing method of the transgenic plants.

[0045] Homozygous plants were obtained through T1 generation identification and screening. Leaf DNA was extracted, and rRNA contamination was removed by RNase A treatment and quantified using Nanodrop. The DNA was diluted to 20 ng / μl and quantitatively analyzed by RT-qPCR using Cas9 primers. Cas9-negative plants were then selected. Unlike traditional transgenic plants, the mutant materials obtained by this method allow for the removal of exogenous inserted sequences through self-pollination after gene editing.

[0046] Cas9 primers:

[0047] Cas9FP:CAAGGGCTACAAAGAAGTG(SEQ ID NO.19)

[0048] Cas9RP:AGTTCACATATTTGGAGGG(SEQ ID NO.20)

[0049] 4. Fruit firmness analysis

[0050] Fruit firmness was measured using a TA-XT plus texture analyzer (Stable Micro Systems, UK), with the following parameters set: initial speed 10 mm / s. -1 The measurement speed is 1 mm / s. -1 The measured velocity was 10 mm / s. -1 The measurement depth is 1.5 mm. Each fruit is subjected to a whole-fruit compression test (using a P100 plate with a diameter of 100 mm), and two puncture tests are performed at the symmetrical point of the fruit cross section at the equator using a P2 probe with a diameter of 2 mm. The average value is taken. The fruit firmness value is repeated for at least 8 single fruits. The firmness unit is expressed in Newtons (N).

Claims

1. SlEXP1 and SlCEL2 The application of genes in improving the storage and transportability of tomato fruits is characterized by, At the same time SlEXP1 and SlCEL2 Gene editing yielded double mutants that showed increased fruit firmness, thereby improving the storage and transportability of tomato fruit.

2. The application according to claim 1, characterized in that, Regarding the SlEXP1 The gene-edited sgRNA sequences are shown in SEQ ID NO.1 and SEQ ID NO.

2. SlCEL2 The sequences of the gene-edited sgRNAs are shown in SEQ ID NO. 3 and SEQ ID NO. 4.