LSA10563 gene and its application in regulating lettuce fertility

Abstract

The present invention discloses the LSA10563 gene and its application in regulating the fertility of lettuce. The amino acid sequence encoded by the LSA10563 gene disclosed in the present invention is the protein of SEQ ID No. 3. Experiments have proved that after editing the LSA10563 gene of the present invention, the male fertility of plants can be significantly reduced, indicating that the LSA10563 gene and the protein encoded by it can regulate the male fertility of plants, and male sterile plants can be cultivated by knocking out this gene, which has good application prospects.

Description

Technical Field

[0001] The present invention relates to the LSA10563 gene in the field of biotechnology and its application in regulating the fertility of lettuce. Background Art

[0002] Lettuce (Lactuca sativa L.) is a plant of the genus Lactuca in the Compositae family. It originated from the Mediterranean coast of Europe and western Asia and was domesticated from wild species. It is one of the three major leafy vegetables globally and has important economic value. In the past two decades, the global production has doubled. As a common vegetable worldwide, the demand and consumption of lettuce in China are also increasing continuously and it has now become an important vegetable in the national vegetable basket.

[0003] Lettuce is a diploid plant, strictly self-pollinated, with a very low natural outcrossing rate. Its flower organs are very small and the flowering time of each flower lasts for a short time, making hybridization difficult and it is hard to obtain hybrid seeds. Currently, the seeds used in production are generally inbred lines. Previous laboratory observations have shown that lettuce has obvious heterosis in terms of yield, pest and disease resistance, etc. Therefore, creating male sterile lines for the production of lettuce hybrid seeds is of great significance in production.

[0004] In recent years, with the great development of the CRISPR / Cas9 gene editing technology, it can directly achieve targeted knockout, knock-in and site-directed mutagenesis of animal and plant genes, and quickly create mutants with target traits. Now, male sterile mutants have been constructed in various crops such as maize, rice, Chinese cabbage, rape, wheat, etc. using this technology, but there is no relevant report in lettuce. Summary of the Invention

[0005] The technical problem to be solved by the present invention is how to cultivate male sterile plants.

[0006] To solve the above technical problem, the present invention first provides the application of a protein or a substance regulating the content or activity of the protein in regulating the male fertility of plants;

[0007] The name of the protein is LSA10563, and it is any one of the following A1), A2) or A3):

[0008] A1) A protein with an amino acid sequence of SEQ ID No.3;

[0009] A2) A protein obtained by substituting and / or deleting and / or adding one or several amino acid residues to the amino acid sequence shown in SEQ ID No.3 in the sequence listing and having the same function;

[0010] A3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2).

[0011] The substance for regulating the content or activity of LSA10563 can be a substance that inhibits or increases the content or activity of LSA10563. The regulation of plant male fertility can be to inhibit or increase plant male fertility.

[0012] The LSA10563 protein in the above A2) is a protein having 75% or more identity with the amino acid sequence of the protein shown in SEQ ID No. 3 and having the same function. The 75% or more identity means having 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity.

[0013] In the above application, the substance can be any one of the following B1) to B9):

[0014] B1) A nucleic acid molecule encoding LSA10563;

[0015] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0016] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0017] B4) A recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);

[0018] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2);

[0019] B6) A transgenic plant tissue containing the nucleic acid molecule described in B1), or a transgenic plant tissue containing the expression cassette described in B2);

[0020] B7) A transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant organ containing the expression cassette described in B2);

[0021] B8) A nucleic acid molecule that reduces the content or activity of LSA10563;

[0022] B9) An expression cassette, recombinant vector, recombinant microorganism, transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the nucleic acid molecule described in B8).

[0023] In the above application, the nucleic acid molecule described in B1) can be any of the following b11) or b12) or b13) or b14) or b15):

[0024] b11) The coding sequence is the cDNA molecule or DNA molecule of SEQ ID No.2 in the sequence listing;

[0025] b12) The DNA molecule shown as SEQ ID No.2 in the sequence listing;

[0026] b13) The DNA molecule shown as SEQ ID No.1 in the sequence listing;

[0027] b14) A cDNA molecule or DNA molecule that has 75% or more identity with the nucleotide sequence defined in b11) or b12) or b13) and encodes LSA10563;

[0028] b15) A cDNA molecule or DNA molecule that hybridizes with the nucleotide sequence defined in b11) or b12) or b13) or b14) under stringent conditions and encodes LSA10563;

[0029] B8) The nucleic acid molecule is an sgRNA targeting the nucleic acid molecule described in B1);

[0030] B9) The recombinant vector, the recombinant microorganism, the transgenic plant cell line, the transgenic plant tissue or the transgenic plant organ can also express Cas9 protein.

[0031] Wherein, the nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA, etc.

[0032] Those of ordinary skill in the art can easily mutate the nucleotide sequence encoding LSA10563 protein of the present invention by using known methods, such as directed evolution and point mutation methods. Those artificially modified nucleotides that have 75% or higher identity with the nucleotide sequence of the LSA10563 protein isolated from the present invention, as long as they encode LSA10563 protein and have the function of LSA10563 protein, are all derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention.

[0033] As used herein, the term "identity" refers to the sequence similarity with the natural nucleic acid sequence. "Identity" includes nucleotide sequences having 75% or higher, or 85% or higher, or 90% or higher, or 95% or higher identity with the nucleotide sequence encoding the protein consisting of the amino acid sequence shown as SEQ ID No.3 of the present invention. Identity can be evaluated by the naked eye or computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0034] In the above application, the stringent conditions may be as follows: Hybridization is carried out at 50 °C in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 and 1 mM EDTA, and washing is carried out at 50 °C in 2×SSC, 0.1% SDS; it may also be: Hybridization is carried out at 50 °C in a mixed solution of 7% SDS, 0.5 M NaPO 4 and 1 mM EDTA, and washing is carried out at 50 °C in 1×SSC, 0.1% SDS; it may also be: Hybridization is carried out at 50 °C in a mixed solution of 7% SDS, 0.5 M NaPO 4 and 1 mM EDTA, and washing is carried out at 50 °C in 0.5×SSC, 0.1% SDS; it may also be: Hybridization is carried out at 50 °C in a mixed solution of 7% SDS, 0.5 M NaPO 4 and 1 mM EDTA, and washing is carried out at 50 °C in 0.1×SSC, 0.1% SDS; it may also be: Hybridization is carried out at 50 °C in a mixed solution of 7% SDS, 0.5 M NaPO 4 and 1 mM EDTA, and washing is carried out at 65 °C in 0.1×SSC, 0.1% SDS; it may also be: Hybridization is carried out at 65 °C in a solution of 6×SSC, 0.5% SDS, and then the membrane is washed once with 2×SSC, 0.1% SDS and once with 1×SSC, 0.1% SDS; it may also be: Hybridization and membrane washing are carried out 2 times at 68 °C in a solution of 2×SSC, 0.1% SDS, 5 min each time, and then hybridization and membrane washing are carried out 2 times at 68 °C in a solution of 0.5×SSC, 0.1% SDS, 15 min each time; it may also be: Hybridization and membrane washing are carried out at 65 °C in a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS.

[0035] The above 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

[0036] In the above application, the expression cassette (LSA10563 gene expression cassette) containing the nucleic acid molecule encoding the LSA10563 protein described in B2) refers to DNA that can express the LSA10563 protein in a host cell. This DNA may not only include a promoter that initiates the transcription of the LSA10563 gene, but also include a terminator that terminates the transcription of the LSA10563 gene. Further, the expression cassette may also include an enhancer sequence.

[0037] An existing expression vector can be used to construct a recombinant vector containing the LSA10563 gene expression cassette.

[0038] In the above application, the vector may be a plasmid, cosmid, phage or viral vector. Specifically, the plasmid may be the pKSE401 vector.

[0039] B8) The target sequence of the sgRNA may be sgRNA1: GGTGCCACAACTCTCTATC; and / or, sgRNA2: AGATGGGTTCGGACTTAGC.

[0040] B9) The recombinant vector may be a recombinant vector prepared using the CRISPR / Cas9 system that can reduce the content of LSA10563. The recombinant vector can express an sgRNA targeting the nucleic acid molecule described in B1).

[0041] In the above application, the microorganism may be yeast, bacteria, algae or fungi. Among them, the bacteria may be Agrobacterium, such as Agrobacterium tumefaciens GV3101.

[0042] In the above application, the transgenic plant cell line, transgenic plant tissue and transgenic plant organ do not include propagation materials.

[0043] The present invention also provides the following X1) or X2):

[0044] X1) A method for inhibiting plant male fertility, comprising: reducing the content or activity of LSA10563 in a recipient plant, or inhibiting the expression of the gene encoding LSA10563 in the recipient plant, or knocking out the gene encoding LSA10563 in the recipient plant, to obtain a target plant with reduced male fertility compared to the recipient plant, thereby achieving the inhibition of plant male fertility;

[0045] X2) A method for cultivating a plant with reduced male fertility, comprising: reducing the content or activity of LSA10563 in a recipient plant, or inhibiting the expression of the gene encoding LSA10563 in the recipient plant, or knocking out the gene encoding LSA10563 in the recipient plant, to obtain a target plant with reduced male fertility compared to the recipient plant.

[0046] In the above method, the methods described in X1) and X2) can be achieved by gene editing of the gene encoding LSA10563 using the CRISPR / Cas9 system.

[0047] The encoding gene may be the nucleic acid molecule.

[0048] The methods described in X1) and X2) can be specifically achieved by introducing the recombinant vector described in B9) into the recipient plant to obtain a plant with LSA10563 gene editing.

[0049] In an embodiment of the present invention, the methods described in X1) and X2) are achieved by deleting positions 108 - 112 of sequence 1 and / or deleting positions 108 - 116 of sequence 1.

[0050] The present invention also provides a product for suppressing plant male fertility, and the product contains (or its activity is) the substance that regulates the content or activity of LSA10563.

[0051] In the present invention, the plant may be M1) or M2) or M3):

[0052] M1) Dicotyledonous plants or monocotyledonous plants;

[0053] M2) Compositae plants;

[0054] M3) Lettuce.

[0055] LSA10563 or the substance that regulates the content or activity of LSA10563 also belongs to the protection scope of the present invention.

[0056] Experimental results show that after editing the LSA10563 gene of the present invention, the male fertility of plants can be significantly reduced. This indicates that the LSA10563 gene and the protein encoded by it can regulate the male fertility of plants, and male sterile plants can be cultivated by knocking out this gene, which has good application prospects.

[0057] The present invention will be further described in detail below in conjunction with specific embodiments. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not constitute any limitation to the present invention in any way. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] Figure 1 It shows the detection results of the expression levels of LSA10563 and LSA27952 genes. Among them, N1151-1 represents an anther length of 0.5 mm; N1151-2 represents an anther length of 1 mm; N1151-3 represents an anther length of 2 mm.

[0059] Figure 2 It is a schematic diagram of the pKSE401 vector.

[0060] Figure 3 It is the I 2 -KI staining map of lettuce pollen. A: Wild type; B: LSA10563-1 plant; C: LSA10563-2 plant; D: LSA27952-1 plant.

[0061] Figure 4 It is a paraffin section map of lettuce anthers at different developmental stages. A: Wild type; B: LSA10563-1 plant; C: LSA10563-2 plant; D: LSA27952-1 plant. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0062] In the experimental methods of the following examples, unless otherwise specified, they are all conventional methods, carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, instruments, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels. In the following examples, for quantitative tests, three repeated experiments are set, and the results are averaged. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence list is the 5'-terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3'-terminal nucleotide of the corresponding DNA / RNA.

[0063] The pCBC-DT1T2 vector in the following examples (Yu Mingsen et al., Establishment of the CRISPR / Cas9 gene editing system in lettuce, Acta Phytophysiologica Sinica, 2017, Issue 04), the public can obtain this biological material from the applicant. This biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0064] The pKSE401 vector in the following examples (Yu Mingsen et al., Establishment of the CRISPR / Cas9 gene editing system in lettuce, Acta Phytophysiologica Sinica, 2017, Issue 04), the public can obtain this biological material from the applicant. This biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0065] Example 1: Detection of the expression levels of LSA10563 gene and LSA27952 gene

[0066] Anthers at different developmental stages (0.5 mm; 1 mm; 2 mm) of the lettuce variety 'American Big Fast Growth' were sampled, total RNA of the anthers was extracted and reverse transcribed, and the expression levels of LSA10563 and LSA27952 genes were detected by real-time fluorescence quantification.

[0067] The primers used for detecting the LSA10563 gene were: CTTAGCTGGGCACCTTGTCA and TCCCTCTTCCACCAGTGAGT;

[0068] The primers used for detecting the LSA27952 gene were: TTCCGGGAAGGTCCCTACAT and GTGGCCGAATTCACCAGGTA.

[0069] Results ( Figure 1 ) showed that the expression level of the LSA10563 gene was relatively high at the initial stage of lettuce anther development and almost not expressed at the later stage of anther development; the expression level of the LSA27952 gene gradually decreased with the development of lettuce anthers.

[0070] In Lactuca sativa var. americana, the genomic DNA of the LSA10563 gene is as shown in SEQ ID No. 1, its CDS sequence is as shown in SEQ ID No. 2, and it encodes the LSA10563 protein shown in SEQ ID No. 3; the genomic DNA of the LSA27952 gene is as shown in SEQ ID No. 4, its CDS sequence is as shown in SEQ ID No. 5, and it encodes the LSA10563 protein shown in SEQ ID No. 6.

[0071] Example 2, LSA10563 gene, LSA27952 gene

[0072] In this example, the CRISPR / Cas9 system was used to edit the LSA10563 gene and LSA27952 gene of lettuce to detect the effects of the two genes on anther development. The vectors used in the CRISPR / Cas9 system were the pCBC-DT1T2 vector (chloramphenicol resistance, containing the gRNA expression cassette) and the pKSE401 vector (used to transform Agrobacterium tumefaciens GV3101 competent cells for lettuce genetic transformation).

[0073] 1. Vector construction

[0074] For the LSA10563 gene and LSA27952 gene, two target sites were designed for each gene. The two target sites of the LSA10563 gene were: sgRNA1: GGTGCCACAACTCTCTATC; sgRNA2: AGATGGGTTCGGACTTAGC; the two target sites of the LSA27952 gene were: sgRNA1: CACTTGCAGCCGCCGGAGTT; sgRNA2: CTTACGAAACTCCGATCGCT.

[0075] After digesting the pKSE401 vector with BsaI restriction endonuclease, it was ligated to the DNA fragments containing the two target sites of the LSA10563 gene and LSA27952 gene respectively. The recombinant vector targeting the LSA10563 gene obtained was denoted as LSA10563-sgRNA, and the recombinant vector targeting the LSA27952 gene obtained was denoted as LSA27952-sgRNA.

[0076] The sequences of the DNA fragments containing the two target sites of the LSA10563 gene are as follows:

[0077]

[0078] The sequences of the DNA fragments containing the two target sites of the LSA27952 gene are as follows:

[0079]

[0080] 2. Genetic transformation of lettuce

[0081] The LSA10563-sgRNA and LSA27952-sgRNA obtained in step 1 were respectively introduced into Agrobacterium tumefaciens GV3101, and then, using the large and fast-growing lettuce in the United States as the recipient plant, genetic transformation was carried out respectively to obtain LSA10563 gene-edited plants and LSA27952 gene-edited plants.

[0082] A pair of primers were designed at both ends of the target site for the identification of gene-edited plants. The primers used are as follows:

[0083] LSA10563 gene-edited plants:

[0084] F primer: ACCCAAGTGGATGCAAGAAAAGG;

[0085] R primer: TCTCCATAAAGTCAAGAGAACCACCTT.

[0086] LSA27952 gene-edited plants:

[0087] F primer: TGCCCCTTTCATGCATACTATTTGG;

[0088] R primer: TGAAAGCTCTTGTGGTAAAGGCC.

[0089] Using the large and fast-growing lettuce in the United States as the recipient plant, LSA10563 gene-edited plants LSA10563-1 and LSA10563-2 were obtained using LSA10563-sgRNA, and LSA27952 gene-edited plant LSA27952-1 was obtained using LSA27952-sgRNA.

[0090] After sequencing, the gene editing situation of the F 0 generation is as follows (Table 1):

[0091] The LSA10563-1 plant had a homozygous mutation at Target1, with a 5-bp base deletion on both chromosomes, resulting in a frameshift mutation in the encoded protein;

[0092] The LSA10563-2 plant had a mutation at Target1, with a 5-bp base deletion on one chromosome and a 9-bp base deletion on the other chromosome, judged to be a heterozygote, resulting in a frameshift mutation in the encoded protein;

[0093] The LSA27952-1 plant has a mutation at Target1. There is a 1-bp insertion on one chromosome and no mutation on the other chromosome, which is judged to be heterozygous, resulting in a frameshift mutation in the encoded protein.

[0094] Analysis of the gene sequences of the gene-edited plants: The LSA10563-1 and LSA10563-2 plants have mutations in the first exon of the gene; the LSA27952-1 plant has a mutation in the first exon of the gene.

[0095] Table 1. Gene editing status

[0096]

[0097] 3. Phenotypic identification

[0098] Test plants: LSA10563-1 plant, LSA10563-2 plant, and LSA27952-1 plant.

[0099] 3.1 Pollen viability identification

[0100] Use the pollen viability staining solution (I2-KI method) to detect pollen viability: Take the flowers of LSA10563-1, LSA10563-2, LSA27952-1 plants and the wild-type plant Great Lakes Lettuce respectively, and drop 1-2 drops of I 2 -KI solution on a glass slide. Take an appropriate amount of pollen and immerse it in the solution to fully disperse the pollen. Cover with a cover glass and place it in a 25°C constant temperature incubator for staining for 5-10 min. Observe under a microscope. Red-brown pollen is normal viable pollen, that is, fertile pollen; yellow-brown is non-viable pollen, that is, sterile pollen. The results are as Figure 3 shown. The LSA27952-1 plant is a heterozygous mutant, and the number of viable pollen in lettuce is significantly reduced compared with the wild type; the number of viable pollen in the two LSA10563 plants is significantly reduced compared with the wild type, and most of them are infertile. Specifically, the average percentage of sterile pollen in the LSA27952-1 plant is 85%, and the average percentages of sterile pollen in LSA10563-1 and LSA10563-2 are 99.3% and 99.5% respectively. It shows that after gene editing of LSA27952 and LSA10563, it can cause the phenotype of male sterility.

[0101] 3.2 Anther paraffin section

[0102] Take the anthers of different developmental stages of the stamens of LSA10563-1, LSA10563-2, LSA27952-1 plants and the wild-type plant Great Lakes Lettuce respectively, use paraffin embedding, and use a microtome to make cross-sectional slices. The slices are stained with safranin fast green and observe the development of stamens under a microscope.

[0103] As shown by the paraffin section results ( Figure 4 ), when the differentiation of the five layers of cells, namely the anther epidermal cells, middle layer, endothecium, tapetum, and microsporocytes, is completed in the wild type, obvious cell arrangements of each layer can be seen. However, after LSA27952 and LSA10563 were successfully knocked out, abnormal differentiation of different anther cells occurred, and obvious epidermal cells, middle layer, endothecium, tapetum, and microsporocytes were not seen. In the later stage of stamen anther development, microsporocytes go through the meiosis stage, tetrad stage, young microspore stage, uninucleate microspore stage, late uninucleate microspore stage, and early pollen grain stage, and finally form mature pollen grains. During this process, the tapetum (TP) plays a continuous and essential role in the anther: (1) nutrient supply and regulation of microsporocytes; (2) synthesis and secretion of callase to decompose the callose outer wall of the tetrad; (3) secretion of recognition proteins and transfer them to the pollen wall; (4) synthesis and secretion of sporopollenin to the mature pollen wall to enhance the stability of pollen. Compared with the wild type, LSA10563-1 plants do not have mature pollen grains, while LSA27952-1 and LSA10563-2 plants have a small amount of mature pollen grains.

[0104] The above results indicate that after gene editing of LSA10563 and LSA27952, the phenomenon of lettuce male sterility is caused in both cases, and lettuce male sterile lines can be prepared by knocking out these two genes.

[0105] The above examples involve the following sequences:

[0106] Sequence 1: LSA10563 genome

[0107]

[0108]

[0109] Sequence 2: LSA10563 CDS

[0110]

[0111] Sequence 3: LSA10563 amino acid sequence

[0112] Sequence 4: LSA27952 genome

[0113]

[0114] Sequence 5: LSA27952 CDS

[0115]

[0116]

[0117] Sequence 6: Amino acid sequence of LSA27952

[0118]

[0119] The present invention has been described in detail above. For those skilled in the art, without departing from the gist and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any modification, use or improvement of the present invention, including those that depart from the scope disclosed in this application and are made by using conventional techniques known in the art.

Claims

1. Use of a substance that reduces the protein content or activity of the amino acid sequence of SEQ ID No. 3 in reducing the male fertility of lettuce.

2. The use according to claim 1, wherein: the substance is one of the following B1) or B2): B1) A nucleic acid molecule that reduces the protein content or activity of the protein described in claim 1; B2) An expression cassette, recombinant vector, recombinant microorganism, transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the nucleic acid molecule described in B1).

3. The use according to claim 2, wherein: B1) The nucleic acid molecule is an sgRNA targeting the nucleic acid molecule encoding the protein with the amino acid sequence of SEQ ID No. 3; B2) The recombinant vector, the recombinant microorganism, the transgenic plant cell line, the transgenic plant tissue or the transgenic plant organ can also express Cas9 protein.

4. One of the following X1) or X2): X1) A method for inhibiting male fertility of lettuce, comprising: reducing the protein content or activity of the protein described in claim 1 in the recipient lettuce, or inhibiting the expression of the protein-encoding gene described in claim 1 in the recipient lettuce, or knocking out the protein-encoding gene described in claim 1 in the recipient lettuce, to obtain a target lettuce with reduced male fertility compared to the recipient lettuce, thereby achieving the inhibition of male fertility of lettuce; X2) A method for cultivating lettuce with reduced male fertility, comprising: reducing the protein content or activity of the protein described in claim 1 in the recipient lettuce, or inhibiting the expression of the protein-encoding gene described in claim 1 in the recipient lettuce, or knocking out the protein-encoding gene described in claim 1 in the recipient lettuce, to obtain a target lettuce with reduced male fertility compared to the recipient lettuce.

5. The method according to claim 4, wherein: the methods of X1) and X2) are achieved by gene editing of the protein-encoding gene described in claim 1 through the CRISPR / Cas9 system.

6. The method according to claim 4 or 5, wherein: the encoding gene is a DNA molecule with the coding sequence of SEQ ID No. 2 or SEQ ID No. 1.

Images