Quantitative amplification system for human DNA sample and application thereof

Abstract

The application discloses a human DNA sample quantitative amplification system and application thereof, and the amplification system comprises a primer and probe compound for specifically amplifying four target sequences; wherein the four target sequences are two autosomal target genes CSF1PO and TPOX, one Y chromosome target gene SRY and one non-human synthetic oligonucleotide IPC. Advantages are as follows: (1) the amplification system and the kit thereof can be applied to all forensic DNA analysis, four different target genes can be simultaneously amplified in one tube, human total DNA and human male DNA can be quantitatively and qualitatively evaluated, and information about sample degradation and inhibitor condition is provided. The primer and probe are high in specificity and sensitivity, and the minimum detection limit can reach 1 pg level. (2) the kit effectively simplifies the steps of qPCR reaction operation, improves the accuracy and precision of the test, and is suitable for all collected sample sources in forensic DNA analysis.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology and relates to forensic DNA analysis technology, specifically a quantitative amplification system for human DNA samples and its application. Background Technology

[0002] High-purity DNA samples are a prerequisite for obtaining high-quality sequencing results. Based on efficient DNA extraction methods, quantitative analysis of the extracted DNA samples is essential.

[0003] Forensic samples are diverse and complex, and challenging samples often include trace or micro-volume samples, highly degraded DNA samples, mixed samples, and inhibited samples. These sample factors may prevent further STR analysis, such as uncertainty about which STR kit to use or the amount of sample required for STR analysis. Therefore, a reliable, sensitive, and rapid method is needed to evaluate DNA extracts.

[0004] The fundamental purpose of DNA quantification is to estimate the amount of amplifiable DNA. Because the relative amount of DNA present in forensic samples varies greatly, a quantification method with a wide dynamic range is required. Furthermore, since PCR technology used in DNA detection is highly sensitive, the optimal quantification method should also be very sensitive. Real-time quantitative PCR, with a dynamic range of up to five orders of magnitude, is currently the preferred method that meets both of these conditions. Summary of the Invention

[0005] Technical problem solved: To overcome the shortcomings of existing technologies, this invention employs TaqMan real-time quantitative PCR technology, which can simultaneously quantify total human DNA and human male DNA in samples, and assess sample DNA degradation and PCR inhibitor residues after extraction. Results obtained using this kit help make critical decisions in the STR analysis workflow, greatly improving experimental efficiency and allowing for more careful use of precious samples.

[0006] Technical solution: A quantitative amplification system for human DNA samples, wherein the amplification system includes primer and probe complexes for specifically amplifying the following four target sequences; wherein the four target sequences are: two autosomal target genes CSF1PO (GenBank: AC011382.4) and TPOX (GenBank: AC105450.1), one Y chromosome target gene SRY (GenBank: AP023484.1), and one non-human synthetic oligonucleotide IPC.

[0007] Preferably, the non-human synthetic oligonucleotide IPC is an artificially modified cloning plasmid, the nucleotide sequence of which is shown in SEQ ID NO:13:

[0008] CGCCACGGTCACGGAGCACGAGAAATTCCACTTTACCCACCGTGAACGCCGTAATCATTGGATCTACTTTCCTTCTACGCCAAGTAAATCAATTGTTTGCTTCAACCATCATTTCGGCTTTGAACGTGCCGCTTGATACTGACA.

[0009] Preferably, the primer and probe complex sequences are as follows: the primer sequence for the CSF1PO gene is SEQ ID NO:1-2, and the probe sequence is SEQ ID NO:3; the primer sequence for the TPOX gene is SEQ ID NO:4-5, and the probe sequence is SEQ ID NO:6; the primer sequence for the SRY gene is SEQ ID NO:7-8, and the probe sequence is SEQ ID NO:9; and the primer sequence for the IPC oligonucleotide is SEQ ID NO:10-11, and the probe sequence is SEQ ID NO:12.

[0010] Preferably, the final concentration of the primer and probe complex is: 0.4 μM for SEQ ID NO:1-2, 0.16 μM for SEQ ID NO:3; 0.24 μM for SEQ ID NO:4-5, 0.1 μM for SEQ ID NO:6; 0.3 μM for SEQ ID NO:7-8, 0.12 μM for SEQ ID NO:9; 0.2 μM for SEQ ID NO:10-11, and 0.1 μM for SEQ ID NO:12. The specific primer and probe sequences and concentrations are shown in Table 1.

[0011] Table 1 Primer and probe sequences and corresponding concentrations

[0012]

[0013] Preferably, the probe is labeled with a fluorescent group and a quenching group at both ends; wherein the fluorescent group is any one of FAM, VIC, ROX and CY5, and the quenching group is any one of BHQ1, BHQ2 and BHQ3, and each probe uses a different fluorescent group.

[0014] Preferably, the amplification system includes a reaction mixture, the components of which and their final concentrations are as follows: MgCl2, 3 mM; Tris-HCl, 50 mM; KCl, 50 mM; dNTPs, 0.2 mM; UNG enzyme, 0.01 U / μL; Taq, 0.1 U / μL; BSA, 0.5 g / L.

[0015] The application of any of the above-described human DNA sample quantitative amplification systems in the preparation of forensic DNA analysis kits.

[0016] Preferably, the samples for the forensic DNA analysis include human blood, bloodstains, semen, saliva, bodily fluids, hair, muscle, or tissues / organs.

[0017] Preferably, the samples for forensic DNA analysis include human genomic DNA obtained using the Chelex method and magnetic bead extraction method.

[0018] Preferably, the limit of detection of the kit can reach 1 pg.

[0019] The kit includes DNA standards and DNA standard diluent. The DNA standards are Human DNA (100 ng / μL 9948) quantitative standard. The serially diluted DNA standards are prepared by diluting the Human DNA quantitative standard from 50 ng / μL to 5 pg / μL using the DNA standard diluent.

[0020] The amplification program of the human DNA quantitative amplification system described above is as follows: digestion at 37°C for 2 min, pre-denaturation at 95°C for 2 min; denaturation at 95°C for 5 s, annealing at 58°C for 45 s, and 40 cycles.

[0021] The design principle of the amplification system described in this invention is that DNA quantification can not only determine the amount of DNA in a sample, but also assess DNA quality, such as whether it involves mixed sexes, degradation, and inhibitors. The target genes for DNA quantification amplification must be present only in the human genome, have a low mutation rate, and exhibit minimal copy number differences between individuals. This invention selects two autosomal loci with low mutation rates and good conservation from 13 CODIS STR loci as target genes: CSF1PO and TPOX. The amplification fragment design for the target gene CSF1PO is relatively short, used for quantifying total DNA quantity, and is more suitable for trace amounts of DNA and degraded DNA. The amplification fragment design for the target gene TPOX is relatively long, and the degree of DNA degradation can be assessed by PCR amplification and detection of these two target genes of different lengths. Furthermore, larger fragments are more susceptible to inhibitors than smaller fragments; the amplification results of TPOX and IPC can be used to assess the inhibitor status in the sample. SRY is a male-specific locus, highly conserved evolutionarily, and is used as the target gene for quantifying male DNA quantity in this invention.

[0022] Beneficial effects: (1) The human DNA quantitative amplification system and kit provided by this invention can be applied to all forensic DNA analyses. It can simultaneously amplify four different target genes in a single tube, perform quantitative and qualitative assessments of total human DNA and human male DNA, provide information on sample degradation and inhibitors, provide guidance for the next step of DNA analysis, improve the success rate of analysis, and simplify the workflow. The primers and probes are highly specific and sensitive, with a detection limit as low as 1 pg.

[0023] (2) The kit in this invention effectively simplifies the preparation steps of the reaction solution for qPCR reactions. The reagents in the kit can be used directly in the experiment, reducing the workload of the operator and improving the accuracy and precision of the test. It is applicable to all sample sources collected in forensic DNA analysis, including but not limited to human blood, bloodstains, semen, saliva, body fluids, hair, muscle or tissue organs. Attached Figure Description

[0024] Figure 1A Melting curves of primers designed for the SA target during amplification. Figure 1B Melting curves of primers designed for LA targets during amplification. Figure 1C Melting curves during primer amplification for target M. Figure 1D Melting curves during primer amplification for IPC targets.

[0025] Figure 2 shows the linear range detection results of the real-time PCR detection method according to a specific embodiment of the present invention, wherein... Figure 2A These are amplification patterns of DNA standards at different concentrations after testing. Figure 2B To construct a standard curve for SA target DNA using concentration and Ct value, Figure 2C To construct a standard curve for LA target DNA using concentration and Ct value, Figure 2D This is a standard curve for the M target DNA constructed using concentration and Ct value.

[0026] Figure 3 The results are species-specific detection results of the fluorescence quantitative PCR detection method according to a specific embodiment of the present invention.

[0027] Figure 4A This is the autosomal typing map of sample 1 containing the inhibitor. Figure 4B This is the autosomal typing map of sample 2 containing the inhibitor.

[0028] Figure 5 The results of different ratios of male and female mixed samples obtained by the real-time quantitative PCR detection method according to a specific embodiment of the present invention are shown.

[0029] Figure 6A This is the autosomal typing map of degradation sample 1. Figure 6B For the autosomal typing map of degradation sample 2, Figure 6C For the Y chromosome genotyping map of degradation sample 1, Figure 6D The Y chromosome typing map of degradation sample 2. Detailed Implementation

[0030] The following embodiments further illustrate the content of the present invention, but should not be construed as limiting the present invention. Modifications and substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are all within the scope of the present invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0031] Example 1: Determination of the amplification system

[0032] I. Design of Specific Primers and Establishment of Multiplex Amplification System

[0033] Specifically, it includes the following steps:

[0034] (1) Design of specific amplification primers and probes

[0035] Target gene sequences were downloaded from the UCSC or NCBI websites based on their names or chromosomal locations. Next, highly conserved regions with uniform base distribution were selected for primer and probe design. Following TaqMan primer and probe design principles, Primer-BLAST software was used for automatic searching, Oligo software for analysis and evaluation, and the NCBI database was used to compare and analyze primers and probes designed using Primer-BLAST software.

[0036] (2) Primer and probe verification

[0037] First, primer monoamplification melting curve analysis was performed to eliminate primers with non-specific amplification or low amplification efficiency. Second, primer reamplification melting curve analysis was performed, involving the stacking and mixing of each primer individually to eliminate primers with non-specific amplification or low amplification efficiency. Then, probe validation was performed. First, primer-probe monoamplification experiments were conducted to eliminate probes with low amplification efficiency, followed by primer-probe reamplification experiments, i.e., all four sets of primers and probes were mixed and tested. The final primer and probe sequences and concentrations are shown in Table 1. Figure 1A , Figure 1B , Figure 1C , Figure 1D Melting curves for monoamplification of each target primer.

[0038] (3) IPC amplification template

[0039] IPCs can monitor the entire PCR reaction process, assess the validity of negative results, and monitor PCR inhibitor activity. The template for the IPC is present in the primer-probe complex, ensuring a consistent concentration in all PCR reactions. The template for the IPC is an artificially modified cloning plasmid, a synthetic sequence not found in nature, whose gene sequence is shown in SEQ ID NO:13.

[0040] III. Adjusting the PCR reaction mixture

[0041] In addition to the target-specific amplification primers and probes mentioned above, the reaction system of this kit also includes a reaction mixture containing MgCl2, Tris-HCl, KCl, dNTPs, UNG enzyme, Taq enzyme, and BSA. The concentration of each component can be adjusted as needed.

[0042] Specifically, in the PCR amplification system, Mg can be... 2+ An orthogonal experiment was designed to optimize the concentrations of MgCl2, dNTPs, and Taq polymerase to prepare a PCR reaction mixture, which was then added to the PCR system. The final reaction mixture contained the following concentrations: 3.0 mM MgCl2, 50 mM Tris-HCl, 50 mM KCl, 0.2 mM dNTPs, 0.01 U / μL UNG enzyme, 0.1 U / μL Taq polymerase, and 0.5 mg / mL BSA.

[0043] Example 2: Method of using the reagent kit of this application

[0044] The specific steps for detecting human genomic DNA using this kit are as follows:

[0045] (1) Preparation of a series of diluted standards

[0046] The 100 ng / μL DNA standard was diluted with DNA standard diluent to concentrations of 50 ng / μL, 5 ng / μL, 0.5 ng / μL, 0.05 ng / μL and 0.005 ng / μL, respectively, and these were used as five quantitative standards of known concentrations.

[0047] (2) Preparation of reaction system

[0048] Prepare the PCR reaction system as shown in Table 2 below.

[0049] Table 2 PCR reaction amplification system

[0050]

[0051] (3) PCR amplification detection

[0052] The reaction tubes were placed on a quantitative PCR instrument. Fluorescence channel selection: FAM, VIC, ROX, and Cy5 channels were selected. The final amplification program is shown in Table 3 below:

[0053] Table 3 Amplification Procedure

[0054]

[0055] (3) Results Analysis

[0056] Adjust the baseline Start and Stop values ​​and the threshold appropriately based on the image automatically analyzed by the instrument (so that the curve of the negative control is flat or below the threshold line).

[0057] Calculation of the regression equation:

[0058] The software automatically generates DNA standard curves and slope, Y-intercept, and R-values. 2 The sample was analyzed based on the regression equation: Ct=a[log(n)]+b, where a is the slope, b is the Y-intercept, and n is the DNA concentration.

[0059] Linear range testing was performed on the reagent kit of this embodiment.

[0060] 100 ng / μL DNA standard was diluted with DNA standard diluent to concentrations of 100, 50, 5, 0.5, 0.05, 0.005, and 0.001 ng / μL. The serially diluted standards were then quantitatively detected using the determined PCR system and amplification program. Results showed that the quantitative fluorescence detection method of this invention could effectively detect samples ranging from 100 to 0.001 ng / μL, demonstrating a wide quantification range. The amplification chromatograms are shown below. Figure 2A As shown, the standard curve regression equation for the SA target is Ct = -3.301[log(n)] + 25.872( Figure 2B The standard curve regression equation for the LA target is Ct = -3.225[log(n)] + 24.188( Figure 2C The standard curve regression equation for target M is Ct = -3.166[log(n)] + 25.855( Figure 2D The values ​​were calculated using the regression equations for each target, as shown in Table 4.

[0061] Table 4 Measurement Results of Series of Diluted Standards

[0062]

[0063] Species-specific detection was performed on the kit of this embodiment.

[0064] Using human DNA as a positive control and sdH2O as a blank control, the PCR system and amplification program determined above were used to detect six non-human DNA samples from pigs, cattle, sheep, chickens, dogs, and horses. Figure 3 The results showed that when six non-human DNA samples were detected using the quantitative fluorescence detection method of this invention, only the positive control reaction tube showed a specific amplification signal, while the other reaction tubes showed no fluorescence signal, indicating that the quantitative fluorescence detection method of this invention has good specificity. The kit of this embodiment was then used to detect samples containing inhibitors.

[0065] DNA standards were diluted to 0.2 ng / μL with DNA standard diluent. Different concentrations of humic acid were added to simulate different concentrations of humic acid inhibitor samples. The humic acid concentration of inhibitor sample 2 was higher than that of inhibitor sample 1. The inhibitor samples were quantitatively detected using the determined PCR system and amplification program, and simultaneously, the AGCU EX28CS kit was used for genotyping. Results showed that the quantitative detection method of this invention was used to quantitatively detect the inhibitor samples. The results are shown in Table 5. The IPC Ct value of inhibitor sample 2 was higher than that of inhibitor sample 1, indicating that LA target amplification was inhibited and no fluorescence signal was detected. Genotyping of the inhibitor samples was performed using the AGCU EX28CS kit, and the genotyping patterns are shown in Table 5. Figure 4A and 4B The inhibitor concentration in inhibitor sample 1 was not high, and good typing results were obtained. Inhibitor sample 2 had a higher inhibitor concentration, and large fragment amplification was inhibited, indicating that the fluorescence quantitative detection method of the present invention can reflect the inhibitor status in the sample.

[0066] Table 5. Detection results of humic acid inhibitor samples at different concentrations.

[0067]

[0068] The kit in this embodiment was used to test mixed male and female samples.

[0069] Using male and female samples of known concentrations, mixed samples with different male-to-female ratios were simulated as test templates. In 2 μL mixed samples, the male sample concentration was maintained at 0.01 ng / μL, while the female sample concentration was increased at ratios of 1:1, 1:10, 1:100, 1:1000, and 1:2000. Figure 5 The results showed that when the fluorescence quantitative detection method of the present invention was used to test mixed samples of different proportions of men and women, even when the proportion of female samples was 2000 times, the male DNA could be accurately quantified at 0.01 ng / μL.

[0070] Degradation sample detection was performed on the kit of this embodiment.

[0071] DNA standards were treated with DNase I, and the treatment time was controlled to simulate degradation samples with different degradation intensities. The determined PCR system and amplification program were used to quantitatively detect these degradation samples, and the AGCU EX28CS kit was used for genotyping. Results showed that the degradation samples were quantitatively detected using the fluorescence quantitative detection method of this invention. The results are shown in Table 6. The degradation index of sample 1 was 2.90, and the degradation index of sample 2 was 7.45. Autosomal and Y-chromosome genotyping of the degradation samples were performed using the AGCU EX28CS kit and the AGCU Y43CS kit, respectively. The autosomal genotyping map is shown in Table 6. Figure 6A and 6B Y chromosome typing map can be found Figure 6C and 6D The degradation index of sample 1 was low, and a better typing result could be obtained. The degradation of sample 2 was high, and large fragments almost lost peaks, indicating that the degradation index obtained by the fluorescence quantitative detection method of the present invention can reflect the DNA degradation status in the sample.

[0072] Table 6. Detection results of degradation samples with different degradation intensities.

[0073]

Claims

1. A quantitative amplification system for human DNA samples used in the preparation of forensic DNA analysis kits, characterized in that, The amplification system includes primer and probe complexes that specifically amplify the following four target sequences; wherein the four target sequences are: two autosomal target genes CSF1PO and TPOX, one Y chromosome target gene SRY, and one non-human synthetic oligonucleotide IPC; The non-human synthetic oligonucleotide IPC is an artificially modified cloning plasmid, and its nucleotide sequence is shown in SEQ ID NO: 13; The primer and probe complex sequences are as follows: the primer sequence for the CSF1PO gene is SEQ ID NO: 1-2, and the probe sequence is SEQ ID NO: 3; the primer sequence for the TPOX gene is SEQ ID NO: 4-5, and the probe sequence is SEQ ID NO: 6; the primer sequence for the SRY gene is SEQ ID NO: 7-8, and the probe sequence is SEQ ID NO: 9; the primer sequence for the IPC oligonucleotide is SEQ ID NO: 10-11, and the probe sequence is SEQ ID NO:

12.

2. The human DNA sample quantitative amplification system according to claim 1, characterized in that, The final concentrations of the primer and probe complexes are as follows: SEQ ID NO: 1-2: 0.4 μM; SEQ ID NO: 3: 0.16 μM; SEQ ID NO: 4-5: 0.24 μM; SEQ ID NO: 6: 0.1 μM; SEQ ID NO: 7-8: 0.3 μM; SEQ ID NO: 9: 0.12 μM; SEQ ID NO: 10-11: 0.2 μM; SEQ ID NO: 12: 0.1 μM.

3. The quantitative amplification system for human DNA samples according to claim 1, characterized in that, The probe is labeled with a fluorescent group and a quenching group at both ends; wherein the fluorescent group is any one of FAM, VIC, ROX and CY5, and the quenching group is any one of BHQ1, BHQ2 and BHQ3, and each probe uses a different fluorescent group.

4. The quantitative amplification system for human DNA samples according to claim 1, characterized in that, The amplification system includes a reaction mixture, the components of which and their final concentrations are as follows: MgCl2, 3 mM; Tris-HCl, 50 mM; KCl, 50 mM; dNTPs, 0.2 mM; UNG enzyme, 0.01 U / µL; Taq enzyme, 0.1 U / µL; and BSA, 0.5 g / L.

5. The quantitative amplification system for human DNA samples according to claim 1, characterized in that, The samples used in the forensic DNA analysis include human bodily fluids, hair, or tissues and organs.

6. The quantitative amplification system for human DNA samples according to claim 1, characterized in that, The samples analyzed for forensic DNA included human genomic DNA obtained using the Chelex method and magnetic bead extraction method.

Images