White spot syndrome virus-resistant peptide derived from litopenaeus vannamei and application of white spot syndrome virus-resistant peptide

By cloning the laccase-like protein gene from Litopenaeus vannamei and recombinantly expressing the anti-white spot syndrome virus peptide in prokaryotes, the problem of WSSV prevention and control has been solved, achieving efficient and safe prevention and control in shrimp.

CN121555448APending Publication Date: 2026-02-24SHENZHEN INST OF GUANGDONG OCEAN UNIV +1
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202511757075.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-26
Publication Date
2026-02-24

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively control the explosive mortality of shrimp caused by white spot syndrome virus (WSSV). Traditional chemical agents and vaccines suffer from reduced efficacy and insufficient immune response, and there is a lack of efficient and safe prevention and control methods.

Method used

The laccase-like protein gene was cloned from Litopenaeus vannamei, and a recombinant peptide protein against white spot syndrome virus was obtained through prokaryotic recombination expression. This protein was then co-incubated with WSSV and injected into shrimp to inhibit viral replication and bind to the envelope proteins VP26 and VP28.

Benefits of technology

It significantly inhibits WSSV replication in shrimp, improves shrimp survival rate, and provides an efficient and safe prevention and control solution.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121555448A_ABST
    Figure CN121555448A_ABST
Patent Text Reader

Abstract

The invention provides an anti-white spot syndrome virus peptide derived from litopenaeus vannamei, and belongs to the technical field of biology. The amino acid sequence of the anti-white spot syndrome virus peptide provided by the invention is as shown in SEQ ID NO.1, and the nucleotide sequence of the coding gene is as shown in SEQ ID NO.2. The invention further provides a recombinant expression vector and host bacteria containing the anti-white spot syndrome virus peptide gene, and application of the recombinant expression vector and host bacteria in anti-white spot syndrome virus drugs, vaccines, feeds and feed additives, and the recombinant expression vector and host bacteria have wide application prospects and economic benefits.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to an anti-white spot syndrome virus peptide derived from Litopenaeus vannamei. Background Technology

[0002] White Spot Syndrome Virus (WSSV) is a double-stranded DNA virus that causes explosive mortality in shrimp, resulting in White Spot Disease (WSD) which has caused outbreaks worldwide. WSSV is highly contagious and can spread across ponds via water, feed, farming equipment, and even birds. Infected shrimp develop characteristic white spots on their bodies, and their hepatopancreas rapidly dies, leading to near 100% mortality within as little as 48 hours. Furthermore, WSSV can survive in the environment for months, making it difficult to completely eradicate contaminated ponds in the short term, thus becoming a major vulnerability in large-scale shrimp farming and causing enormous economic losses to shrimp aquaculture every year.

[0003] Currently, the control measures for WSSV still have significant shortcomings, making it difficult to form an effective barrier. The application of traditional chemical agents and antibiotics has fallen into a vicious cycle of "decreasing efficacy - increasing drug resistance." Furthermore, antibiotics are not very effective against viral infections themselves, and their overuse can disrupt the balance of shrimp gut microbiota, leading to drug resistance and ultimately resulting in a situation where "medication is ineffective." In the area of ​​non-chemical control, existing technologies also have limitations. Regarding vaccine development, because invertebrates such as shrimp lack specific immune response systems, traditional vaccines are difficult to induce effective immune protection, and to date, no commercially available WSSV vaccine has been put into use. While aquaculture management measures such as water quality control and seedling quarantine can reduce the risk of infection, they cannot address existing viral contamination in the environment and are difficult to strictly implement in large-scale aquaculture scenarios due to limitations in scale and cost. In other words, there are currently no effective treatments. Therefore, developing efficient and safe WSSV prevention and control methods has become a crucial breakthrough direction for the sustainable development of shrimp aquaculture. Summary of the Invention

[0004] In order to solve the problems existing in the prior art, the purpose of this invention is to provide an anti-white spot syndrome virus peptide derived from Litopenaeus vannamei, its encoding gene and its application.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides an anti-white spot syndrome virus peptide derived from Litopenaeus vannamei, the amino acid sequence of which is shown in SEQ ID NO.1.

[0006] The present invention also provides a gene encoding the above-mentioned anti-leukoderma viral peptide, the nucleotide sequence of which is shown in SEQ ID NO.2.

[0007] The present invention also provides a recombinant expression vector containing the above-mentioned genes.

[0008] Preferably, the expression vector includes pET28a.

[0009] The present invention also provides a host bacterium containing the above-mentioned recombinant expression vector.

[0010] Preferably, the host bacterium includes Escherichia coli BL21(DE3).

[0011] The present invention also provides the application of the above-mentioned gene or recombinant expression vector or host bacteria in the preparation of recombinant protein of anti-leukoderma viral peptide.

[0012] This invention also provides a method for preparing a recombinant viral peptide protein against vitiligo syndrome, comprising the following steps: The above genes were ligated into a prokaryotic expression vector to obtain a recombinant vector; the constructed recombinant vector was transformed into Escherichia coli, positive clones were induced to express, the expression precipitate was collected, and the inclusion body protein was purified to obtain the recombinant protein of anti-leukoderma viral peptide.

[0013] This invention also provides the application of the anti-white spot syndrome virus peptide or gene or recombinant expression vector or host bacterium or preparation method prepared above in the preparation of shrimp aquaculture-related products.

[0014] Preferably, the shrimp aquaculture-related products include drugs, vaccines, feed, and feed additives for treating white spot syndrome virus.

[0015] Compared with the prior art, the beneficial effects of the technical solution of the present invention are as follows: This invention is the first to clone the lacase-like protein gene from Litopenaeus vannamei and verify through experiments that it participates in the immune defense against WSSV. Furthermore, it uses an expression vector and Escherichia coli to perform prokaryotic recombinant expression to obtain a recombinant lacase-like protein C-terminal peptide with anti-white spot syndrome virus biological activity, namely, anti-white spot syndrome virus peptide recombinant protein.

[0016] The recombinant protein against white spot syndrome virus peptide provided by this invention, after being co-incubated with WSSV and injected into shrimp, can inhibit the replication level of WSSV in shrimp. Moreover, the recombinant protein can directly bind to WSSV and its envelope proteins VP26 and VP28. The anti-WSSV activity of this recombinant protein provides an efficient and safe solution for the prevention and control of WSSV in aquaculture shrimp farming, and has broad application prospects and economic benefits. Attached Figure Description

[0017] Figure 1 Schematic diagram of the laccase-like protein domain in Litopenaeus vannamei and the location of the anti-white spot syndrome viral peptide.

[0018] Figure 2 SDS-PAGE results of recombinant expression and purification of anti-leukoderma viral peptides: 1-3 represent protein expression, inclusion body protein and purified protein, respectively.

[0019] Figure 3 The results of the experiments verifying the anti-WSSV activity of the recombinant protein are as follows: A shows the interference efficiency, survival rate, and WSSV copy number in Litopenaeus vannamei after WSSV injection 48 hours after RNA interference; B shows the interference efficiency, survival rate, and WSSV copy number in Procambarus clarkii after WSSV injection 48 hours after RNA interference; C shows the survival rate and WSSV copy number in Litopenaeus vannamei after co-incubation with the recombinant protein; and D shows the survival rate and WSSV copy number in Procambarus clarkii after co-incubation with the recombinant protein.

[0020] Figure 4 Results of the interaction between anti-WSSV recombinant protein and WSSV envelope proteins VP19, VP24, VP26 and VP28. Detailed Implementation

[0021] This invention is the first to discover a laccase subtype in Litopenaeus vannamei that possesses the typical three copper oxidase domains but lacks the highly conserved copper ion binding site typical of laccases, making it a lacase-like protein. This invention found that the expression of this lacase-like protein was significantly upregulated after WSSV infection in shrimp. RNAi interference with its in vivo expression resulted in a significant increase in shrimp mortality and WSSV copy number after WSSV reinfection, while recombinant protein injection produced the opposite results, indicating that the lacase-like protein possesses anti-WSSV immune function. Further research in this invention revealed that its anti-WSSV immune function originates from a peptide at the C-terminus of the lacase-like protein, namely an anti-white spot syndrome virus peptide.

[0022]

[0023] The anti-white spot syndrome viral peptide of the present invention is a protein with a relative molecular mass of about 40 kDa, containing a Cu-oxidase_2 domain, and its sequence similarity with Chinese white shrimp, Japanese white shrimp, red swamp crayfish and red swamp crayfish is 89.47%, 83.95%, 57.48% and 54.57%, respectively.

[0024] The present invention also provides a recombinant expression vector containing the above-mentioned gene, wherein the expression vector is a prokaryotic expression vector, preferably including pET28a. As an optional embodiment, the recombinant expression vector is formed by ligating the gene shown in SEQ ID NO.2 into the expression vector pET28a. EcoR I and Sac Between the I sites, a recombinant expression vector was obtained.

[0025] The present invention also provides a host bacterium containing the above-mentioned expression vector, wherein the host bacterium is Escherichia coli, preferably including Escherichia coli BL21(DE3).

[0026] This invention also provides the application of the above-mentioned gene or genome expression vector or host bacteria in the preparation of recombinant anti-leukoderma viral peptide protein. The method for preparing the recombinant anti-leukoderma viral peptide protein includes the following steps: ligating the gene shown in SEQ ID NO. 2 into a prokaryotic expression vector to obtain a recombinant vector; transforming the constructed recombinant vector into *Escherichia coli*, obtaining a positive clone, and inducing expression; collecting the expression precipitate; and then purifying the inclusion body protein to obtain the recombinant anti-leukoderma viral peptide protein. Preferably, the induction of expression includes induction with IPTG, wherein the final IPTG concentration is 0.1 mM; and the purification includes purification with a Ni-NTA matrix.

[0027] This invention also provides the application of the recombinant anti-white spot syndrome virus peptide, gene, or genome expression vector, host bacterium, or preparation method obtained above in the preparation of shrimp aquaculture-related products. Preferably, the products include drugs, vaccines, feeds, and feed additives for anti-white spot syndrome virus, and the shrimp include Litopenaeus vannamei and Procambarus clarkii.

[0028] The technical solutions of this invention will be clearly and completely described below with reference to the embodiments thereof. Obviously, the described embodiments are only a part of the embodiments of this invention, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0029] Unless otherwise specified, the following embodiments are all conventional methods.

[0030] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0031] Example 1 Amplification of the gene fragment of the anti-WSSV viral peptide (C-terminal anti-WSSV peptide of lacase-like protein): Total RNA was extracted from Litopenaeus vannamei using the TransZol Up Plus RNA Kit. mRNA purification and cDNA reverse transcription were performed using the BD SMARTer™ RACE cDNA Amplification Kit. Using the reverse-transcribed cDNA as a template, the C-terminal anti-WSSV peptide gene fragment of the lacase-like protein was amplified using PrimeSTAR® Max DNA Polymerase reagent on a PCR instrument (forward primer: SEQ ID NO.3: GGGAATTCGGCAGCCTCGTGTCGC, reverse primer: SEQ ID NO.4: CGAGCTCTTAACACGAGGGGAAGT). Figure 1 In the diagram, purple highlights indicate internal repeat sequences, gray highlights indicate copper-containing domains, and red letters indicate the bases corresponding to amino acids. The PCR reaction solution consisted of 2 μL PrimeSTAR® Max DNA Polymerase (5 U / μL, 50 μL 2×PCR Buffer; 4 μL each of forward and reverse primers, 10 μM; 2 μL dNTP Mixture; 100 ng cDNA template, brought to 100 μL with sterile distilled water). The PCR amplification program was: 94℃ pre-denaturation for 3 min, 35 cycles: 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, and final extension at 72℃ for 10 min, stored at 4℃. Electrophoresis was performed on a 1.5% agarose gel, and the results were photographed and observed using a gel imaging system before product recovery. PCR product recovery was performed according to the OMEGA agarose gel DNA recovery kit instructions. The concentration of the recovered product was determined using a nucleic acid concentration analyzer.

[0032] After obtaining the C-terminal anti-WSSV peptide gene fragment of the lacase-like protein, the fragment was ligated into the pMD19-T vector using the pMD19-T Vector kit, transformed into *E. coli* DH5α, and then analyzed. Bioinformatics analysis revealed that the full-length C-terminal anti-WSSV peptide gene fragment of the lacase-like protein was 1143 bp (SEQ ID NO.2), derived from the 2758-3900 bp portion of the lacase-like protein gene, encoding a protein of 380 aa length and approximately 40 kDa (SEQ ID NO.1). Domain analysis showed that it contains a Cu-oxidase_2 domain. Sequence similarity analysis indicated that its sequence shared 89.47%, 83.95%, 57.48%, and 54.57% similarity with those of *Litopenaeus vannamei*, *Litopenaeus japonicus*, *Procambarus clarkii*, and *Procambarus clarkii*, respectively.

[0033] Example 2 Recombinant expression of the anti-WSSV viral peptide (C-terminal anti-WSSV peptide of a lacase-like protein): 1. Constructing an expression carrier The purified PCR product with enzyme digestion sites and the pET-28a plasmid were processed using enzyme digestion sites corresponding to the primers. EcoR I and Sac I. Double digestion with restriction endonucleases. The digestion system and procedure are as follows: purified product / pET-28a plasmid, 25 μL; EcoR I endonuclease, 1 μL; Sac I restriction enzyme, 1 μL; 10×QuickCut Green Buffer, 5 μL; ddH2O, 18 μL, 30℃, 5 minutes. Then, using T4 ligase, the fragment was ligated into the prokaryotic expression vector pET28a, which was transformed into E. coli DH5a competent cells by heat shock, cultured overnight, and white colonies were picked for PCR identification. Positive clones were sent to Shanghai Bioengineering Co., Ltd. for sequencing verification.

[0034] 2. Transformed expression strain Recombinant plasmids were extracted using the FastPure® Plasmid mini kit. The correctly sequenced recombinant plasmids were transformed into *E. coli* BL21(DE3) competent cells using a heat shock method, while simultaneously transforming pET28a empty vectors as a control. After overnight culture, positive clones were picked and subjected to PCR detection (forward primer: SEQ ID NO.5: TAATACGACTCACTATAGGG, reverse primer: SEQ ID NO.6: GCTAGTATTGCTCAGCGG) and sequencing to screen for positive strains. Glycerol was added to the positive bacterial culture to a final concentration of 20% and stored at -20°C for later use.

[0035] 3. Induction of expression and purification The correctly sequenced strain was used for induction of expression. 10 μL of the correctly sequenced strain was added to 1 mL of liquid LB medium (containing 100 μg / mL Amp); cultured at 37°C with a shaker at 200 rpm until OD was reached. 600 At a concentration of 0.6, IPTG was added to a final concentration of 0.1 mM. Expression was induced overnight at 16°C, followed by centrifugation at 5000 rpm for 5 min, and cell collection was performed. The cells were resuspended in 20 mL of PBS, and PMSF was added to a final concentration of 1 mM. The cells were then sonicated at 200V for 10 s with a 10 s interval at 4°C for 6 min, followed by centrifugation at 4000 rpm for 30 min at 4°C. The precipitate was collected. After resuspending in 2 mL of PBS, protein expression was detected by SDS-PAGE electrophoresis. Protein purification was performed using Ni-IDA agarose gel purification resin, and the purified protein was analyzed by SDS-PAGE electrophoresis. The electrophoresis results are shown below. Figure 2 As shown in the figure, the purified protein has a distinct band at 40 kDa, which is consistent with the predicted value of Litopenaeus vannamei Laccase-like protein C at 40 kDa.

[0036] Example 3 Validation of the anti-WSSV function of recombinant protein containing the C-terminal anti-WSSV peptide of a lacase-like protein in live Litopenaeus vannamei / Procambarus clarkii: dsRNAs of the Laccase-like protein C and EGFP (enhanced green fluorescent protein) genes were prepared using the Novizan T7 RNAi Transcripion Kit, yielding dsLaccase-like protein C and dsEGFP. The experiment was divided into a dsLaccase-like protein C group (experimental group) and a dsEGFP group (control group), with a dosage of 2 μg / g shrimp and an injection volume of 50 μL of dsRNA in both groups. Injection was performed intramuscularly between the second and third pleopods of Litopenaeus vannamei / Procambarus clarkii. Forty-eight hours after dsRNA injection, blood cells were collected from both the experimental and control groups. Three samples from each treatment group were mixed, and RNA and cDNA were extracted and reverse transcribed. Laccase-like protein C gene expression was analyzed by qPCR to detect the interference efficiency. Forty-eight hours after dsRNA injection, each shrimp was injected with 50 μL of WSSV virus solution (3.65 × 10⁻⁶). 6 (Copies / μg DNA). Shrimp mortality was observed and recorded every 4 hours after WSSV injection, and dead shrimp were collected. Muscle tissue from each group of shrimp was collected 48 hours after WSSV injection and stored at -80℃ for genomic DNA extraction. The extracted genomic DNA was used for virus copy number detection to calculate the virus copy number in the samples.

[0037] Litopenaeus vannamei and Procambarus clarkii were randomly divided into three groups: rLaccase-like protein C group, BSA protein group, and PBS group. 1 μg / mL of recombinant protein, BSA protein (control), and 1×PBS (control) were co-incubated with WSSV at room temperature for 2 h, followed by injection into Litopenaeus vannamei / Procambarus clarkii. The concentration of WSSV used for incubation was 4.64 × 10⁻⁶. 5 DNA copies / μg was injected at a dose of 50 μL per shrimp. Shrimp mortality was observed and recorded every 4 hours post-injection, and dead shrimp were collected. At 48 hours post-injection, muscle tissue from each group of shrimp was collected and stored at -80℃ for genomic DNA extraction. The extracted genomic DNA was used for viral copy number detection to calculate the viral copy number in the samples.

[0038] The results are as follows Figure 3As shown, A represents the interference efficiency, survival rate, and WSSV copy number in Litopenaeus vannamei after 48 hours of RNA interference followed by WSSV injection; B represents the interference efficiency, survival rate, and WSSV copy number in Procambarus clarkii after 48 hours of RNA interference followed by WSSV injection; C represents the survival rate and WSSV copy number in Litopenaeus vannamei after co-incubation with recombinant protein; and D represents the survival rate and WSSV copy number in Procambarus clarkii after co-incubation with recombinant protein.

[0039] Figures A-B show that 48 hours after WSSV infection, the transcription level of Laccase-like protein C was significantly reduced, and the survival rate of WSSV-infected shrimp after interference was significantly reduced, indicating that Laccase-like protein C has an anti-WSSV effect. Figures C-D show that in infected Litopenaeus vannamei and Procambarus clarkii, the survival rate of the WSSV co-incubation group with rLaccase-like protein C was significantly higher than that of the two control groups: the WSSV co-incubation group with BSA protein and the WSSV co-incubation group with PBS. Furthermore, the WSSV viral copy number in the WSSV co-incubation group with recombinant protein was significantly lower than that in the two control groups, indicating that rLaccase-like protein C inhibits WSSV replication in Litopenaeus vannamei and Procambarus clarkii.

[0040] Example 4 Interaction between recombinant proteins and WSSV envelope proteins: The LvLaccase-like protein C sequence (SEQ ID NO.2) obtained by cloning was ligated into the pAc5.1-V5 vector (Invitrogen, V411020) to... EcoR I and SacI. Double digestion with restriction endonucleases, using the same digestion system and procedure as in Example 2, yielded recombinant plasmids expressing the V5 tag. The sequences of VP19, VP24, VP26, and VP28 were then constructed into pAc5.1-GFP using the same method, resulting in recombinant plasmids expressing the GFP tag (VP19 Gene ID: 927053; VP24 Gene ID: 927246, VP26 Gene ID: 927264, and VP28 Gene ID: 926741). To investigate the interaction between LvLaccase-like protein C and VP19, VP24, VP26, and VP28, the four recombinant plasmids were co-transfected into Drosophila S2 cells. Cells were collected after 48 hours, washed three times with pre-cooled PBS, and lysed for 30 min in IP lysis buffer (Beyotime, P0013) containing a protease inhibitor (CWBio, CW2200S). The immunoprecipitates were then analyzed by SDS-PAGE and Western blotting. The results are as follows Figure 4 As shown, the results indicate that LvLaccase-like protein C can interact with the WSSV envelope proteins VP26 and VP28.

[0041] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A peptide derived from Litopenaeus vannamei that combats white spot syndrome virus, characterized in that, Its amino acid sequence is shown in SEQ ID NO.

1.

2. The gene encoding the anti-leukoderma viral peptide of claim 1, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

2.

3. A recombinant expression vector containing the gene of claim 2.

4. The recombinant expression vector according to claim 3, characterized in that, The expression vector includes pET28a.

5. A host bacterium containing the recombinant expression vector according to any one of claims 3 to 4.

6. The host bacterium according to claim 5, characterized in that, The host bacteria include Escherichia coli BL21(DE3).

7. The use of the gene of claim 2, the recombinant expression vector of any one of claims 3-4, or the host bacterium of any one of claims 5-6 in the preparation of recombinant peptide protein against vitiligo syndrome virus.

8. A method for preparing a recombinant viral peptide protein against vitiligo syndrome, characterized in that, Includes the following steps: The gene described in claim 2 is ligated into a prokaryotic expression vector to obtain a recombinant vector; the constructed recombinant vector is transformed into Escherichia coli, a positive clone is formed, and expression is induced; the expression precipitate is collected, and the inclusion body protein is purified to obtain the recombinant protein of anti-leukoderma viral peptide.

9. The application of the anti-white spot syndrome virus peptide recombinant protein prepared by the method described in claim 1, the gene described in claim 2, the recombinant expression vector described in any one of claims 3-4, the host bacterium described in any one of claims 5-6, or the preparation method described in claim 8, in the preparation of shrimp aquaculture-related products.

10. The application according to claim 9, characterized in that, The shrimp aquaculture-related products include drugs, vaccines, feed, and feed additives for treating white spot syndrome virus.

Citation Information

Cited By

  • Application of scopoletin in preparation of medicine for resisting white spot syndrome

    CN121714563A