A strain of Lactobacillus helveticus capable of co-producing ferulic acid and arabinoxylan and its application

Abstract

The present application provides a strain of Lactobacillus helveticus that co-produces ferulic acid and arabinoxylan and its application, the Lactobacillus helveticus is named Lactobacillus helveticus (Lactobacillus helveticus) LH-10, and the strain has been deposited in the China Center for Typical Microorganisms Collection (CCTCC) located in Wuhan University, Wuhan, China on October 21, 2022, with a deposit number of CCTCCNO: M 20221634. The strain has good acid and alkali resistance and bile salt resistance, can ferment and produce ferulic acid esterase, and can ferment crops or their by-products, such as wheat bran and corn, with the strain to produce high-yield free ferulic acid and water-soluble arabinoxylan, the application can increase the utilization value of food and its by-products, and has high safety for whole grain food processing.

Description

Technical Field

[0001] The present application relates to the field of microorganisms, and in particular to a strain of Lactobacillus helveticus capable of co-producing ferulic acid and arabinoxylan and an application thereof. Background Art

[0002] Any discussion of the prior art throughout the specification should not be considered as an admission that such prior art is widely known or forms part of the common general knowledge in the field.

[0003] Ferulic acid is chemically known as 3-methoxy-4-hydroxycinnamic acid, which is a derivative of cinnamic acid and is widely found in the plant kingdom. Ferulic acid is a type of phenolic compound. Like other phenolic substances, it has strong antioxidant properties and can regulate the body's immune function by inhibiting membrane lipid peroxidation. It has also been proven to have good effects in regulating blood sugar, lowering blood pressure, and protecting cardiovascular and cerebrovascular systems.

[0004] Arabinoxylan is a non-starch polysaccharide with a complex and diverse structure composed of two pentose sugars, arabinose and xylose. It is usually found in plants in the form of polysaccharide-phenolic acid binding. The free arabinoxylan has the effects of reducing cholesterol absorption, improving blood sugar metabolism, regulating immunity and promoting the growth of beneficial intestinal microorganisms.

[0005] As an indispensable member of whole grain foods, improving the nutritional value and commercial value of wheat bran is currently the biggest challenge for the food industry. Wheat bran contains a large amount of phenolic acid substances, with ferulic acid being the most widely present. Most ferulic acid is combined with macromolecular substances through ester bonds, glycosidic bonds and ether bonds to form bound ferulic acid, such as the polysaccharide-phenolic acid structure formed by arabinoxylan and ferulic acid. The content of free ferulic acid in plant cell walls is extremely low, which reduces the nutritional value and utilization rate of wheat bran. Ferulic acid esterase can hydrolyze ferulic acid ester bonds, release free ferulic acid, and at the same time release a large amount of arabinoxylan, greatly improving the nutritional value and utilization rate of wheat bran.

[0006] The purpose of the present invention is to overcome or improve at least one disadvantage of the prior art, or to provide a useful alternative. Unless the context clearly requires otherwise, throughout the specification and claims, the words "include", "comprises", etc. should be interpreted from an inclusive perspective rather than an exclusive or exhaustive perspective; that is, from the perspective of "including, but not limited to". Summary of the invention

[0007] The present invention provides a strain of Lactobacillus helveticus capable of co-producing ferulic acid and arabinoxylan. The present invention measures the growth characteristics of the strain, including the optimum pH value, temperature, fermentation time, inoculation amount and bile salt resistance. The strain has good acid and alkali resistance and bile salt resistance and can produce ferulic acid esterase. The present invention also optimizes the fermentation culture conditions to obtain the highest ferulic acid esterase activity. The strain of the present invention can release a large amount of free ferulic acid and water-soluble arabinoxylan by fermenting food crops or food by-products such as corn or wheat bran, which can greatly increase the utilization value of the food and its by-products and improve the safety of whole grain food processing.

[0008] Specifically, the present invention provides the following technical solutions:

[0009] In the first aspect of the present invention, the present invention provides a strain of Lactobacillus helveticus LH-10 (hereinafter referred to as strain LH-10), which was deposited in the China Center for Type Microorganism Collection (CCTCC) located in Wuhan University, Wuhan, China on October 21, 2022, with a deposit number of CCTCC NO: M20221634.

[0010] The strain LH-10 of the present invention has a small round colony on an MRS plate culture medium, which is white and has a single colony with neat edges. After Gram staining, the strain LH-10 is Gram-positive, has a long rod shape under a 100-fold optical microscope, has no flagella, does not produce spores, and does not move.

[0011] The strain LH-10 of the present invention was subjected to physiological and biochemical identification, and the results were positive for esculin test, cellobiose fermentation, maltose fermentation, mannitol fermentation, salicin test, sorbitol fermentation, sucrose fermentation, raffinose fermentation, inulin fermentation, lactose fermentation, and 1% sodium hippurate test.

[0012] The strain LH-10 of the present invention has good growth ability, grows rapidly, can grow at 25-45°C, grows well at 30-37°C, can grow in an environment of pH 5-9, grows well in an environment of pH 6-8, and has good acid and alkali resistance and bile salt resistance. In addition, the strain LH-10 of the present invention can produce ferulic acid esterase.

[0013] In a second aspect of the present invention, the present invention provides a bacterial agent comprising the Lactobacillus helveticus LH-10 and / or its metabolites described in the first aspect.

[0014] In the third aspect of the present invention, the present invention provides a composition comprising the Lactobacillus helveticus LH-10 and / or its metabolites as described in the first aspect.

[0015] In an embodiment of the present invention, the composition is a food or a medicine.

[0016] Lactobacillus helveticus belongs to the genus Lactobacillus. In 2020, the National Health Commission of the People's Republic of China issued the "Announcement on 53 "Three New Foods" Including Lactobacillus helveticus R0052 (No. 4 of 2020)", approving Lactobacillus helveticus as a strain that can be used in infant food. In an embodiment of the present invention, the food includes infant food, adult food and elderly food.

[0017] In an embodiment of the present invention, the composition may further contain an auxiliary material, and may be prepared into a suitable form, such as solid, semi-solid or liquid, etc., according to methods known in the art. The auxiliary material is pharmaceutically or food acceptable. Among them, suitable auxiliary materials may be types known in the art, such as solvents, diluents, flavoring agents, etc.

[0018] In the fourth aspect of the present invention, the present invention provides the use of Lactobacillus helveticus LH-10 described in the first aspect in producing ferulic acid esterase.

[0019] In a fifth aspect of the present invention, the present invention provides a method for producing ferulic acid esterase, comprising fermenting the Lactobacillus helveticus LH-10 described in the first aspect.

[0020] In an embodiment of the present invention, the fermentation conditions for obtaining ferulic acid esterase by fermenting strain LH-10 are: fermentation temperature of 25-40° C., fermentation time of 36-96 h, pH of 5-7, and inoculation amount of 1-5%.

[0021] In particular, when the fermentation conditions were fermentation temperature of 35° C., fermentation time of 48 h, pH of 6, and inoculation amount of 5%, the activity of ferulic acid esterase produced by the fermentation strain LH-10 was higher.

[0022] In the sixth aspect of the present invention, the present invention provides the use of Lactobacillus helveticus LH-10 described in the first aspect in the production of ferulic acid and / or arabinoxylan.

[0023] In a seventh aspect of the present invention, the present invention provides a method for producing ferulic acid and / or arabinoxylan using Lactobacillus helveticus LH-10, comprising: fermenting crops or their by-products with Lactobacillus helveticus LH-10.

[0024] In an embodiment of the present invention, the crops or their by-products include food or their by-products, including but not limited to wheat bran, corn, etc.

[0025] In some embodiments of the present invention, the method comprises: fermenting crops or their by-products with Lactobacillus helveticus LH-10 to obtain fermentation liquid, and extracting free phenolic acid and arabinoxylan; the phenolic acid is ferulic acid.

[0026] In these embodiments, the fermentation conditions are: fermentation temperature of 25-40°C, fermentation time of 36-96h, pH of 5-7, and inoculation amount of 1-5%; in particular, when the fermentation conditions are fermentation temperature of 35°C, fermentation time of 48h, pH of 7, and inoculation amount of 5%, the strain LH-10 has better growth ability and the activity of the produced ferulic acid esterase is higher. Under these conditions, fermentation of crops or their by-products can release a large amount of free ferulic acid and water-soluble arabinoxylan.

[0027] In some embodiments of the present invention, the content of free ferulic acid in corn after fermentation with strain LH-10 is 9.3 times that of ordinary corn, and the content of water-soluble arabinoxylan is 3.45 times that of ordinary corn; in some embodiments of the present invention, the content of free ferulic acid in wheat bran after fermentation with strain LH-10 is 7.46 times that of ordinary wheat bran, and the content of water-soluble arabinoxylan is 10.06 times that of ordinary wheat bran.

[0028] The strain LH-10 of the present invention can ferment to produce a large amount of free ferulic acid and water-soluble arabinoxylan. Ferulic acid has strong antioxidant properties and can regulate the immune function of the human body by inhibiting membrane lipid peroxidation. It has been verified that it has good effects of regulating blood sugar, lowering blood pressure and protecting cardiovascular and cerebrovascular vessels. Free arabinoxylan has the effects of reducing cholesterol absorption, improving blood sugar metabolism, regulating immunity and promoting the growth of beneficial intestinal microorganisms.

[0029] Compared with the prior art, the present invention has the advantages that: the present invention provides a strain of Lactobacillus helveticus LH-10, which has good growth performance, can ferment to produce ferulic acid esterase, and can ferment food crops to produce a large amount of free ferulic acid and water-soluble arabinoxylan, and its output far exceeds the output of conventional fermented food crops, so it has good medical and edible value. Therefore, the strain can be used to prepare medicines or foods, and the strain can be used to produce ferulic acid esterase, and can also be used to ferment food crops to co-produce ferulic acid and arabinoxylan, which can increase the utilization value of food and its by-products, and improve the safety of whole grain food processing. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] The drawings constituting part of the present application are used to provide a further understanding of the present application. The illustrative embodiments and descriptions of the present application are used to explain the present application and do not constitute an improper limitation on the present application. The implementation scheme of the present application is described in detail below in conjunction with the drawings, wherein:

[0031] Figure 1 Shown are clearing zones produced by strain LH-10 in MRS medium with ethyl ferulate as the sole carbon source.

[0032] Figure 2 The HPLC chromatogram of the fermentation broth of strain LH-10 is shown.

[0033] Figure 3 The colony morphology characteristics of strain LH-10 are shown.

[0034] Figure 4 The microscopic morphology (100×) characteristics of strain LH-10 are shown (scale bar 10 μm).

[0035] Figure 5 The results of physiological and biochemical identification of strain LH-10 are shown.

[0036] Figure 6 The growth curve (A) and ferulic acid esterase activity (B) of strain LH-10 are shown.

[0037] Figure 7 Shown are the effects of fermentation temperature on the growth (A) and ferulic acid esterase activity (B) of strain LH-10.

[0038] Figure 8 Shown are the effects of pH on the growth (A) and ferulic acid esterase activity (B) of strain LH-10.

[0039] Fig. 9 Shown are the effects of inoculum size on growth (A) and ferulic acid esterase activity (B) of strain LH-10.

[0040] Fig.10 Shown are the effects of bile salt content on the growth (A) and ferulic acid esterase activity (B) of strain LH-10.

[0041] Fig.11 The release of free ferulic acid from wheat bran fermented by strain LH-10 is shown.

[0042] Fig.12 The release of water-soluble arabinoxylan from wheat bran fermented by strain LH-10 is shown.

[0043] Fig.13 Shown is the release of free ferulic acid from fermented corn by strain LH-10.

[0044] Fig.14 The release of water-soluble arabinoxylan from corn fermented by strain LH-10 is shown. DETAILED DESCRIPTION

[0045] The present application is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or according to the conditions recommended by the manufacturer.

[0046] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. The reagents or raw materials used in this application can be purchased through conventional channels. Unless otherwise specified, the reagents or raw materials used in this application are used in a conventional manner in the art or in accordance with the product instructions. In addition, any method and material similar to or equivalent to the content described herein can be applied to the method of this application. The preferred implementation methods and materials described in the text are for demonstration purposes only.

[0047] Example

[0048] 1. Strain Screening

[0049] (1) Preliminary screening of bacterial strains

[0050] Screening was performed from the commercially available Biostime infant probiotic powder. The powder was made into a suspension at a ratio of 1% with sterile water in an ultra-clean workbench. 100 μL was evenly spread on an MRS medium plate with ethyl ferulate as the sole carbon source. After culturing under appropriate conditions, a transparent circle was found on the plate (see Figure 1 ), indicating that the strain was able to degrade ethyl ferulate. The microorganism producing the transparent zone was isolated and purified and named LH-10.

[0051] MRS medium with ethyl ferulate as the sole carbon source: peptone 10.0 g / L, beef powder 5.0 g / L, yeast powder 4.0 g / L, Tween 80 1.0 g / L, sodium acetate·7H2O 5.0 g / L, K2HPO4·7H2O 2.0 g / L, ammonium citrate 2.0 g / L, MgSO4·7H2O 0.2 g / L, MnSO4·4H2O 0.05 g / L, agar 15.0 g / L, sterilized at 121°C and high temperature and high pressure for 20 min, then cooled to 50-60°C, add 15 mL / L of ethyl ferulate solution sterilized by 0.22 μm membrane filtration, and immediately shake and pour on the plate. Preparation of ethyl ferulate solution: ethyl ferulate is dissolved in N, N-dimethylformamide to a final concentration of 10% W / V, and sterilized by filtration.

[0052] (2) Strain rescreening

[0053] The screened single LH-10 colony was inoculated into MRS broth medium (MRS-methyl ferulate liquid medium) with methyl ferulate as the sole carbon source and liquid fermentation was carried out under suitable conditions. The fermented bacterial liquid was centrifuged at low temperature and high speed to obtain the supernatant as the crude enzyme liquid. 2 mL of the crude enzyme liquid and 2 mL of methyl ferulate solution were bathed in a 30°C water bath for 30 minutes. The enzyme was inactivated in a boiling water bath for 10 minutes and then the reaction was terminated to obtain the enzymatic solution. The enzymatic solution was passed through a 0.22 μm membrane and the crude enzyme solution after enzyme inactivation was used as a blank control.

[0054] MRS-methyl ferulate liquid medium: peptone 10.0g / L, beef powder 8.0g / L, yeast powder 4.0g / L, Tween 80 1.0g / L, sodium acetate·H2O 5.0g / L, K2HPO4·7H2O 2.0g / L, ammonium citrate 2.0g / L, MgSO4·7H2O0.2g / L, MnSO4·4H2O 0.05g / L, sterilize at 121℃ and high temperature and high pressure for 20min, then cool to 50-60℃, add 15mL / L methyl ferulate solution sterilized by 0.22μm membrane filtration, shake well and pour into the plate immediately. Preparation of methyl ferulate solution: methyl ferulate is dissolved in N,N-dimethylformamide, the final concentration is 10% W / V, and filter sterilized.

[0055] (3) Ferulic acid esterase activity assay

[0056] The ferulic acid content in the supernatant was quantitatively analyzed by HPLC. The definition of ferulic acid esterase activity is: the amount of enzyme required to hydrolyze ferulic acid methyl ester to generate 1 μmol of ferulic acid per minute at 30°C is 1 enzyme activity unit (1U). The linear relationship between the peak area Y of the HPLC chromatogram of ferulic acid and the concentration of ferulic acid was calculated using ferulic acid as the standard: Y = 59255X-58.112 (R 2=0.9999), based on which the ferulic acid content in the crude enzyme solution was calculated and converted into ferulic acid esterase activity in the crude enzyme solution.

[0057] HPLC detector brand model and detection conditions are as follows: Agilent 1100, C18 column 250mm×4.6mm, 5mm, column temperature: 40℃, wavelength: 320nm, injection volume 10μL, mobile phase A: 0.1% acetic acid-water solution, mobile phase B: methanol, A:B=72:28, 15min, constant flow rate: 1.0mL / min. The fermentation broth HPLC chromatogram is shown in Figure 2 The results are shown in Table 1.

[0058] Table 1

[0059] Blank control Fermentation Broth Ferulic acid esterase activity / U Not detected 90.35±5.17

[0060] 2. Strain Identification

[0061] (1) Colony morphology and microscopic identification

[0062] The colonies of strain LH-10 on MRS plate medium are small, white, single colonies with neat edges, such as Figure 3 By Gram staining, the LH-10 strain was Gram-positive, and under a 100x optical microscope, it was long rod-shaped, without flagella, did not produce spores, and did not move. Figure 4 .

[0063] MRS plate culture medium: peptone 10.0 g / L, beef extract powder 5.0 g / L, yeast extract powder 4.0 g / L, glucose 20.0 g / L, dipotassium hydrogen phosphate 2.0 g / L, triammonium citrate 2.0 g / L, sodium acetate 5.0 g / L, magnesium sulfate 0.2 g / L, manganese sulfate 0.05 g / L, agar 15.0 g / L, Tween 80 1.0 g / L, sterilize at 121°C for 20 min.

[0064] (2) Colony 16S rDNA sequence determination

[0065] A single colony of the LH-10 strain was picked, and the genomic DNA of the strain was extracted. The 16S rDNA was amplified and sequenced using the bacterial universal primers 27F: AGAGTTTGATCCTGGCTCAG and 1492R: GGTTACCTTGTTACGACTT. The sequence was uploaded to NCBI and compared with all known bacterial 16S rDNA sequences in the database. It was determined to be Lactobacillus helveticus and named Lactobacillus helveticus LH-10.

[0066] (3) Identification of physiological and biochemical characteristics

[0067] The physiological and biochemical characteristics of strain LH-10 were identified. Figure 5 and Table 2.

[0068] Table 2 Physiological and biochemical identification results of strain LH-10

[0069] Biochemical reactions result Escin + Cellobiose + maltose + Mannitol - Salicin + Sorbitol - sucrose + Raffinose - Inulin + lactose + 1% Sodium Hippurate -

[0070] (4) Strain preservation and registration

[0071] Lactobacillus helveticus LH-10 was deposited in the China Center for Type Microorganism Collection (CCTCC) on October 21, 2022, with the deposit number: CCTCC NO: M 20221634. The 16S rDNA sequence of the strain has been registered in Genebank, and its accession sequence number is: OP721064, and its sequence is shown in SEQ ID NO.1.

[0072] 3. Growth characteristics and ferulic acid esterase production characteristics of strain LH-10

[0073] (1) Fermentation time

[0074] A single colony of strain LH-10 was inoculated into a sterilized MRS broth medium and cultured for 24 h under appropriate conditions to obtain a seed solution, which was inoculated into a MRS-ethyl ferulate liquid medium at a volume fraction of 1%. Every 12 h, 5 mL of the mixed bacterial solution was taken and centrifuged at 9000 rpm for 10 min. The bacteria were resuspended in 5 mL of sterile saline and the OD600 value was determined. The supernatant was used to determine the ferulic acid esterase activity. The enzyme-inactivated sample was used as a blank control. The strain growth curve and ferulic acid esterase activity results are shown in Figure 2. Figure 6 shown.

[0075] MRS broth medium: peptone 10.0 g / L, beef extract powder 8.0 g / L, yeast extract powder 4.0 g / L, glucose 20.0 g / L, dipotassium hydrogen phosphate 2.0 g / L, diammonium hydrogen citrate 2.0 g / L, sodium acetate 5.0 g / L, magnesium sulfate 0.2 g / L, manganese sulfate 0.04 g / L, Tween 80 1.0 g / L, sterilize at 121°C and high temperature and high pressure for 20 min.

[0076] MRS-ethyl ferulate liquid medium: peptone 10.0g / L, beef powder 8.0g / L, yeast powder 4.0g / L, Tween 80 1.0g / L, sodium acetate·H2O 5.0g / L, K2HPO4·7H2O 2.0g / L, ammonium citrate 2.0g / L, MgSO4·7H2O0.2g / L, MnSO4·4H2O 0.05g / L, sterilize at 121℃ and high temperature and high pressure for 20min, then cool to 50-60℃, add 15mL / L ethyl ferulate solution sterilized by 0.22μm membrane filtration, shake well and pour into the plate immediately. Preparation of ethyl ferulate solution: ethyl ferulate is dissolved in N,N-dimethylformamide, the final concentration is 10% W / V, and filter sterilized.

[0077] Results: The optimum culture time of strain LH-10 and the culture time with the highest ferulic acid esterase activity were both 48 h.

[0078] (2) Fermentation temperature

[0079] The strain LH-10 was inoculated into MRS-ethyl ferulate liquid medium at a 1% inoculation rate and cultured at 25°C, 30°C, 35°C, 40°C, and 45°C for 48 h. The OD600 value of the bacteria and the ferulic acid esterase activity in the crude enzyme solution were determined by centrifugation. The results are shown in Figure 7 .

[0080] MRS-ethyl ferulate liquid medium: same as above.

[0081] Results: The optimum culture temperature of strain LH-10 was 35℃, and the optimum temperature for producing ferulic acid was 35℃.

[0082] (3) Fermentation pH

[0083] The strain LH-10 was inoculated into MRS-ethyl ferulate liquid medium with pH values ​​of 3, 4, 5, 6, 7, 8, and 9 at an inoculation rate of 1%, cultured for 48 h, and the OD600 value of the bacteria and the ferulic acid esterase activity in the crude enzyme solution were determined by centrifugation. The results are shown in Figure 8 .

[0084] MRS-ethyl ferulate liquid medium: same as above.

[0085] Results: The optimum growth pH of strain LH-10 was 7, and the optimum pH for feruloyl esterase production was 6.

[0086] (4) Inoculation volume

[0087] The strain LH-10 was inoculated into MRS-ethyl ferulate liquid medium at an inoculum size of 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, and 10%, respectively, and cultured for 48 h. The OD600 value of the bacteria and the ferulic acid esterase activity in the crude enzyme solution were determined by centrifugation. The results are shown in Fig. 9 .

[0088] MRS-ethyl ferulate liquid medium: same as above.

[0089] Results: The optimum inoculum size for the growth of strain LH-10 was 5%, and the optimum inoculum size for the production of ferulic acid esterase was 5%.

[0090] (5) Bile salt content

[0091] The strain LH-10 was inoculated into MRS-ethyl ferulate liquid medium at bile salt contents of 1%, 3%, 5%, 7%, and 9%, respectively, and cultured for 48 h. The OD600 value of the bacteria and the ferulic acid esterase activity in the crude enzyme solution were determined by centrifugation. The results are shown in Fig.10 .

[0092] MRS-ethyl ferulate liquid medium: same as above.

[0093] Results: The strain LH-10 had good bile salt tolerance, but the increase of bile salt content would affect the feruloyl esterase activity.

[0094] 4. Application of strain LH-10 in fermenting wheat bran

[0095] The strain LH-10 was used to ferment wheat bran, and liquid fermentation was performed at a solid-liquid ratio of 1:1 (wheat bran + 5% strain + sterile water, the ratio of wheat bran to liquid was 1:1). The optimal fermentation conditions were: temperature 35°C, pH 6, fermentation 48h, inoculation amount 5%, fermented wheat bran (wheat bran was ground and then passed through a 40-mesh sieve and sterilized). The free phenolic acid (ferulic acid) and water-soluble arabinoxylan of the fermented wheat bran were extracted, and the ferulic acid content and arabinoxylan content in the wheat bran were determined. The results are as follows: Fig.11 , 12 shown.

[0096] The ferulic acid content was measured by HPLC.

[0097] The content of ferulic acid in the supernatant was quantitatively analyzed by HPLC. The linear relationship between the peak area Y of the HPLC chromatogram of ferulic acid and the concentration of ferulic acid was calculated using ferulic acid as the standard: Y=59255X-58.112 (R 2 =0.9999), and the ferulic acid content was calculated based on this.

[0098] HPLC detector brand model and detection conditions are as follows: Agilent 1100, C18 chromatographic column 250mm×4.6mm, 5mm, column temperature: 40°C, wavelength: 320nm, injection volume 10μL, mobile phase A: 0.1% acetic acid-water solution, mobile phase B: methanol, A:B=72:28, 15min, constant flow rate: 1.0mL / min.

[0099] The content of water-soluble arabinoxylan was determined by phloroglucinol colorimetric method.

[0100] Determination of standard curve: weigh 0.1000g of D-(+)-xylose standard, dilute to 100mL with distilled water to obtain 1mg / mL standard solution, dilute to concentrations of 0, 200, 400, 800, and 1000μg / mL standard solution, add 5mL of phloroglucinol reaction solution (0.5g of phloroglucinol, 100mL of glacial acetic acid and 6mL of concentrated hydrochloric acid), mix well, react in a boiling water bath for 8min, take out and quickly cool to room temperature, measure the light absorption value at 554nm, use the D-(+)-xylose standard concentration as the horizontal axis and the measured light absorption value as the vertical axis to calculate the standard curve.

[0101] Sample determination: Weigh 0.25 g of sample, put it in a centrifuge tube, add 25 mL of distilled water, vortex at room temperature for 30 min, centrifuge at 2500 r / min for 10 min, aspirate 2 mL of supernatant into a 12 mL stopcock test tube, add 5 mL of phloroglucinol reaction solution and mix well, react in a boiling water bath for 8 min, take out and quickly cool to room temperature, measure the light absorption value at 554 nm, and calculate the content of water-soluble arabinoxylan in the sample according to the standard curve.

[0102] Results: The content of free ferulic acid in wheat bran fermented by strain LH-10 was 7.46 times that of ordinary wheat bran, and the content of water-soluble arabinoxylan was 10.06 times that of ordinary wheat bran (unfermented wheat bran powder).

[0103] 5. Application of strain LH-10 in fermentation of corn

[0104] The strain LH-10 fermented corn, and liquid fermentation was carried out with a solid-liquid ratio of 1:1 (corn powder + 5% strain + sterile water, the ratio of corn powder to liquid was 1:1). The optimal fermentation conditions were: temperature 35°C, pH 6, fermentation 48h, inoculation amount 5%, fermented corn (corn kernels were ground and then passed through a 40-mesh sieve and sterilized). The free phenolic acid (ferulic acid) and water-soluble arabinoxylan of the fermented corn were extracted, and the ferulic acid content and arabinoxylan content in the corn were determined. The results are as follows: Fig.13 , 14 shown.

[0105] The measurement methods of ferulic acid and arabinoxylan were the same as above.

[0106] Results: The content of free ferulic acid in corn fermented by strain LH-10 was 9.3 times that of ordinary corn, and the content of water-soluble arabinoxylan was 3.45 times that of ordinary corn (unfermented corn flour).

[0107] The above description is only the preferred embodiment of the present application and is not intended to limit the present application. Although the present application is described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. A strain of Lactobacillus helveticus ( Lactobacillus helveticus )LH-10 was deposited in the China Center for Type Culture Collection (CCTCC) located in Wuhan University, Wuhan, China on October 21, 2022, with the deposit number CCTCC NO:M20221634.

2. A bacterial agent comprising the Lactobacillus helveticus LH-10 according to claim 1.

3. A composition comprising the Lactobacillus helveticus LH-10 according to claim 1.

4. The composition according to claim 3, characterized in that The composition is a food or a medicine.

5. Use of Lactobacillus helveticus LH-10 according to claim 1 in producing ferulic acid esterase.

6. A method for producing ferulic acid esterase, comprising fermenting the Lactobacillus helveticus LH-10 of claim 1; The fermentation conditions are as follows: fermentation temperature is 25-40°C, fermentation time is 36-96h, pH is 5-7, and inoculation amount is 1-5%.

7. The method according to claim 6, wherein the fermentation conditions are: fermentation temperature 35°C, fermentation time 48h, pH 6, and inoculation amount 5%.

8. Use of the Lactobacillus helveticus LH-10 according to claim 1 in the production of ferulic acid and / or arabinoxylan.

9. A method for producing ferulic acid and / or arabinoxylan using Lactobacillus helveticus LH-10, comprising: Fermentation of crops or their by-products with Lactobacillus helveticus LH-10.

10. The method according to claim 9, characterized in that The crops or their by-products include food or their by-products; The method comprises: fermenting crops or their byproducts with Lactobacillus helveticus LH-10 to obtain fermentation liquid, and extracting free phenolic acid and arabinoxylan; The fermentation conditions are as follows: fermentation temperature is 25-40°C, fermentation time is 36-96h, pH is 5-7, and inoculation amount is 1-5%.

11. The method according to claim 9, characterized in that The crops or their by-products are corn or wheat bran; The fermentation conditions are as follows: fermentation temperature of 35° C., fermentation time of 48 h, pH of 7, and inoculation amount of 5%.

Images