Novel Specific Molecular Targets of Bacteroides fragilis and Bacteroides fragilis BFS17 and Their Rapid Detection Methods
By combining pan-genome analysis and specific primer design with PCR and qPCR methods, the problems of long time consumption and high cost of traditional detection methods have been solved, enabling rapid, simple, low-cost and highly specific detection and quantitative analysis of Bacteroides fragilis and the probiotic strain Bacteroides fragilis BFS17.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-24
- Publication Date
- 2026-03-10
AI Technical Summary
Existing technologies are insufficient for the accurate and rapid detection and quantification of Bacteroides fragilis and the probiotic strain Bacteroides fragilis BFS17. Traditional methods are time-consuming, complex, and costly, and existing molecular detection methods are difficult to distinguish between Bacteroides fragilis and closely related microorganisms.
Using pan-genome analysis technology, the core genome of Bacteroides fragilis was analyzed using Prokka and Roary software. Specific primers were designed and combined with PCR and qPCR methods to achieve specific detection and quantitative analysis of Bacteroides fragilis and Bacteroides fragilis BFS17.
It achieves rapid, simple, and low-cost specific detection, and can accurately identify and quantify Bacteroides fragilis and the probiotic strain Bacteroides fragilis BFS17 in samples. The operation is simple and the results are highly specific.
Smart Images

Figure CN116426660B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of microbial technology and pharmaceutical technology, specifically relating to novel specific molecular targets of Bacteroides fragilis and Bacteroides fragilis BFS17 and their rapid detection methods. Background Technology
[0002] Bacteroides are among the most common symbiotic bacteria in humans, widely colonizing the human gut, oral cavity, respiratory tract, and reproductive tract, and are closely related to human health. Among the 78 species and 5 subspecies of the genus Bacteroides, *Bacteroides fragilis* has the greatest impact on human health. *Bacteroides fragilis* is a Gram-negative, short rod-shaped, capsule-forming, non-spore-forming, obligate anaerobic microorganism. This bacterium can decompose peptone and glucose, producing various substances such as succinic acid, acetic acid, formic acid, lactic acid, and propionic acid, participating in carbohydrate fermentation, nitrogenous substance utilization, and the biotransformation of bile acids and steroids in the human body. On the one hand, *Bacteroides fragilis* can assist the human body in producing microbial K, regulating immunity, and promoting health; on the other hand, some *Bacteroides fragilis* may carry toxin-encoding genes, producing *Bacteroides fragilis* toxin (BFT), causing symptoms such as diarrhea in the host. Among these achievements, the inventors previously isolated a strain of Bacteroides fragilis BFS17 (GDMCC 63172) from the intestines of healthy human subjects in my country. This bacterium can produce high levels of GABA, effectively alleviating intestinal inflammation, enhancing intestinal barrier function, and improving gut-related anxiety and depression, showing promising application prospects. Therefore, the accurate and sensitive detection of the presence of Bacteroides fragilis, especially Bacteroides fragilis BFS17, and the quantitative analysis of Bacteroides fragilis and Bacteroides fragilis BFS17 are of significant practical importance.
[0003] Currently, the detection of *Bacteroides fragilis* mainly relies on morphological detection and biochemical assays after isolation and culture. These methods require anaerobic enrichment and selective culture of samples, followed by microscopic examination or a series of biochemical identifications after obtaining single bacteria. These methods are time-consuming, complex, and costly, hindering early identification and quantification of *Bacteroides fragilis* and preventing accurate quantitative analysis. In recent years, molecular biological detection based on polymerase chain reaction (PCR) has gradually replaced traditional culture and biochemical assays due to its speed, simplicity, accuracy, and low cost, becoming one of the most promising new detection technologies for microorganisms. The key to novel PCR-based molecular detection methods is to design detection methods based on nucleotide sequences specific to the microbial species. While some patents involve molecular detection schemes for *Bacteroides fragilis*, they primarily rely on primer design based on specific sequences in the general microbial genome, such as the 16S rRNA gene. Although these schemes can effectively distinguish *Bacteroides fragilis* from common microorganisms like *Escherichia coli*, they struggle to differentiate it from closely related microorganisms such as *Bacteroides monomorpha* and *Bacteroides pleomorpha*. Currently, there is no specific or rapid detection method for Bacteroides fragilis BFS17, which has good probiotic effects.
[0004] In 2005, Tettelin et al. proposed the concept of a microbial pangenome, which refers to the total number of genes in a species. Within a species' pangenome, genes can be categorized into three types: core genes (conserved across all strains), dispensable genes (found in some individuals and related to species differentiation, conferring competitive advantage within the community), and strain-specific genes (specifically found in a particular individual). Researchers use high-performance computers to collect the complete genome information of a species from global public databases and their own databases. Using software such as Prokka and Roary for computational analysis, they can efficiently obtain the species' pangenome and core genome information. By comparing the core genes of a species with those of other species in the database, species-specific core genes can be identified. Designing detection primers based on species-specific core genes has become a more precise method for microbial detection.
[0005] Therefore, using pan-genome analysis to mine core genes within Bacteroides fragilis and strain-specific genes of Bacteroides fragilis BFS17, and designing primers and optimizing detection conditions based on these specific genes, is of great significance for the efficient and accurate identification of Bacteroides fragilis and Bacteroides fragilis BFS17 in samples. Summary of the Invention:
[0006] The purpose of this invention is to overcome the shortcomings of existing technologies and provide novel specific targets and corresponding detection schemes for detecting and identifying Bacteroides fragilis and the probiotic strain Bacteroides fragilis BFS17. This invention obtains the core genomic information of Bacteroides fragilis using the MP scheme in the Pan-Genomics Analysis Pipeline (PGAP) software for prokaryotes. Based on the NCBI database and all Bacteroides fragilis genome information isolated and detected by the inventors, protein sequences of Bacteroides fragilis-specific genes are extracted. Then, BLAST analysis is performed and compared with the non-redundant protein database in the NCBI database to remove protein sequences that can be compared to genes from other species, thus obtaining the core genes of Bacteroides fragilis. Further comparison with the NCBI database yields the specific molecular target SEQ ID NO.1 and the specific molecular target SEQ ID NO.2 for Bacteroides fragilis BFS17, used to identify the presence of Bacteroides fragilis and the probiotic strain Bacteroides fragilis BFS17 in samples.
[0007] This invention provides a set of molecular targets for detecting Bacteroides fragilis and Bacteroides fragilis BFS17. The molecular target nucleotide sequence of Bacteroides fragilis is shown in SEQ ID NO.1, and the molecular target nucleotide sequence of the probiotic strain Bacteroides fragilis BFS17 is shown in SEQ ID NO.2.
[0008] The present invention also provides a set of primers for detecting Bacteroides fragilis and Bacteroides fragilis BFS17, wherein the primer set includes primers for detecting Bacteroides fragilis, including the primers shown in SEQ ID NO.3 and SEQ ID NO.4; and primers for detecting Bacteroides fragilis BFS17, including the primers shown in SEQ ID NO.5 and SEQ ID NO.6.
[0009] The present invention also provides a method for detecting Bacteroides fragilis and Bacteroides fragilis BFS17, wherein DNA is extracted from the sample, and then PCR amplification is performed using the primer set described above for detecting Bacteroides fragilis. If a band size of 204 bp is obtained, Bacteroides is present; if a band size of 203 bp is obtained, Bacteroides fragilis is present.
[0010] Preferably, the PCR reaction system consists of 12.5 μL of 2×PrimeSTAR Max Premix, 1 μL of 10 μmol / L forward primer, 1 μL of 10 μmol / L reverse primer, 1 μL of 2.5 ng / μL template DNA, and 9.5 μL of ddH2O.
[0011] Preferably, the PCR reaction program is as follows: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 60℃ annealing for 5 s, 72℃ extension for 5 s, for a total of 35 cycles; 72℃ extension for 10 min.
[0012] This invention also provides a qPCR detection method for quantifying Bacteroides fragilis and the probiotic strain Bacteroides fragilis BFS17, comprising the following steps:
[0013] (1) Using the primer sets described above for detecting Bacteroides fragilis and Bacteroides fragilis BFS17, standard curves for Bacteroides fragilis and Bacteroides fragilis BFS17 were plotted respectively.
[0014] (2) The above primer set for detecting Bacteroides fragilis and Bacteroides fragilis BFS17 was used to perform qPCR amplification on the sample to obtain the ct value of the sample. The content of Bacteroides fragilis and probiotic strain Bacteroides fragilis BFS17 in the sample was calculated according to the standard curve.
[0015] Preferably, the qPCR amplification system is as follows: 5 μL of 2×SYBR Green Premix reaction solution, 1 μL of template DNA to be tested, 0.5 μL each of forward and reverse primers (10 μmol / L), and 3 μL of sterile double-distilled water.
[0016] Preferably, the qPCR reaction program is a two-step PCR reaction program: preheating at 95°C for 30 seconds; two-step amplification at 95°C for 5 seconds and annealing at 60°C for 30 seconds, for a total of 40 cycles.
[0017] The present invention also provides a kit for detecting Bacteroides fragilis and the probiotic strain Bacteroides fragilis BFS17, which includes the primer set described above for detecting Bacteroides fragilis and Bacteroides fragilis BFS17.
[0018] Preferably, the kit further includes: 2×PCR Mix, template DNA, and DEPC water.
[0019] The present invention also provides the above-mentioned molecular targets for detecting Bacteroides fragilis and the probiotic strain Bacteroides fragilis BFS17, and the primer set for detecting Bacteroides fragilis and the probiotic strain Bacteroides fragilis BFS17, and their application in the detection of Bacteroides fragilis and the probiotic strain Bacteroides fragilis BFS17.
[0020] The beneficial effects of this invention are:
[0021] This invention discloses a specific detection target and related detection method for identifying Bacteroides fragilis, the probiotic strain Bacteroides fragilis BFS17, and other microorganisms. Compared with existing technologies, the detection method of this invention has the advantages of short detection time, simple operation, high accuracy, low cost, and no need for microbial culture experiments. It can detect the presence of Bacteroides fragilis and the probiotic strain Bacteroides fragilis BFS17 in samples, making it highly practical. The specific detection target of this invention has single specificity, the detection result is specific, and the result interpretation is simple. This invention can both qualitatively and quantitatively determine the presence of Bacteroides fragilis and the probiotic strain Bacteroides fragilis BFS17 in samples, and has a wide range of applications.
[0022] This invention employs a pan-genomic approach to obtain specific core genes for *Bacteroides fragilis* and the probiotic strain *Bacteroides fragilis* BFS17, and designs characteristic primers capable of sensitively detecting both *Bacteroides fragilis* and the probiotic strain *Bacteroides fragilis* BFS17. Furthermore, this method can rapidly and easily distinguish *Bacteroides fragilis*, the probiotic strain *Bacteroides fragilis* BFS17, and other microbial strains. This invention offers advantages such as ease of operation, high specificity, quantifiability, and low detection cost.
[0023] Bacteroides fragilis BFS17 was deposited on February 16, 2023, at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province, 510070, China, with accession number GDMCC No: 63172. Attached image description:
[0024] Figure 1 The alignment results of the 16S rRNA gene sequence of Bacteroides fragilis BFS17 with those of Bacteroides fragilis ATCC 25285 and Bacteroides fragilis NCTC 9343 in the NCBI database showed that the 16S rRNA gene sequence of BFS17 had the highest similarity with the 16S rRNA gene sequences of Bacteroides fragilis ATCC 25285 and Bacteroides fragilis NCTC 9343 in the NCBI database, with a gene coverage of 100% and a similarity of 99.43%.
[0025] Figure 2 This demonstrates the specific beneficial organism discovery of Bacteroides fragilis BFS17.
[0026] A. To compare the amino acid metabolism and synthesis genes of different Bacteroides fragilis strains through genomic analysis, it was found that although all Bacteroides fragilis isolates carried the glutamate decarboxylase synthesis gene gadB, compared with other Bacteroides fragilis strains with poorer effects, BFS17 and BFS22, which had good anti-inflammatory effects, specifically contained the amino acid synthesis gene gadC. B. Dynamic observation showed that the γ-aminobutyric acid (GABA) level in the supernatant of Bacteroides fragilis BFS17 and BFS22 fermentation broth continuously increased with the extension of culture time and the increase of bacterial count. Under the same culture conditions, the GABA production level of BFS17 was significantly higher than that of BFS22.
[0027] Figure 3 This is a heatmap of gene expression within *Bacteroides fragilis* obtained from pan-genomic analysis: the left side shows a gene phylogenetic tree constructed based on the pan-genome sequences of representative *Bacteroides fragilis* strains; the right side shows the presence (black) or absence (white) of various genes in each representative *Bacteroides fragilis* strain. Analysis revealed that *Bacteroides fragilis* has 739 core genes.
[0028] Figure 4 This invention provides rapid detection results for *Bacteroides fragilis* and the probiotic strain *Bacteroides fragilis* BFS17: A. Detection results of *Bacteroides fragilis*-specific primers on 5 *Bacteroides fragilis* isolates and 19 non-*Bacteroides fragilis* strains: It can be seen that when the specific primers were used to detect 5 different species of *Bacteroides fragilis* (BF1-BF5), bright bands appeared at 204bp, while when the specific primers were used to detect 19 non-*Bacteroides fragilis* strains (BF6-BF24), no bands were detected at 204bp; B. *Bacteroides fragilis* BS17 Detection of specific primers for probiotic strain Bacteroides fragilis BFS17 and 23 non-BFS17 strains: It can be seen that when using specific primers to detect probiotic strain Bacteroides fragilis BFS17, a bright band appears at 203bp. However, when using specific primers to detect the other 5 Bacteroides fragilis isolates (1-5), 1 Bacteroides polymorpha (6), 1 Bacteroides monomorpha (7), 1 Bacteroides ovata (8), and 15 common human and food-derived microbial strains (9-23), no band is detected at 203bp.
[0029] Figure 5 This invention relates to the quantitative detection of samples containing Bacteroides fragilis and the probiotic strain Bacteroides fragilis BFS17. The qPCR detection protocol provided by this invention is used to quantitatively detect samples containing Bacteroides fragilis and the probiotic strain Bacteroides fragilis BFS17: A(1) The results indicate that when the concentration of Bacteroides fragilis colonies in the sample is ≥1×10 2When the concentration of CFU / mL is ≥1×10⁻⁶, a fluorescent signal can be detected in the sample. A(2) The present invention has a good quantitative detection effect on samples containing different concentrations of Bacteroides fragilis colonies, and the standard curve has a high degree of fitting. B(1) The results suggest that when the concentration of Bacteroides fragilis BFS17 colonies in the sample is ≥1×10⁻⁶, the fluorescence signal can be detected in the sample. 2 When CFU / mL, a fluorescent signal can be detected in the sample. B(2) The present invention has a good quantitative detection effect on samples containing different concentrations of probiotic strain Bacteroides fragilis BFS17 colonies, and the standard curve has a high degree of fitting. Detailed implementation method:
[0030] To more concisely and clearly demonstrate the technical solution, purpose, and advantages of the present invention, the present invention will be further described in detail below with reference to specific embodiments and accompanying drawings.
[0031] Example 1: Target mining for Bacteroides fragilis detection based on pan-genomics
[0032] I. Isolation and Preservation of Bacteroides
[0033] Intestinal samples were collected from 30 healthy young adults in my country. Under aseptic conditions, 0.1g of each intestinal sample was resuspended in 10mL of physiological saline, and 0.5mL of the bacterial suspension was serially diluted. Physiological saline was then added to prepare 10... -1 Up to 10 -9 Dilute gradient bacterial suspensions, select 10 -7 10 -8 10 -9 Three gradient bacterial suspensions were each transferred at 100 μL to Bacteroides isolation medium, spread evenly using a spreader, and then incubated anaerobically at 37°C for 48 h. Morphologically typical colonies from the plates were streaked onto Bacteroides isolation medium for purification. After purification, single colonies were inoculated onto Bacteroides liquid medium for expansion, and anaerobically cultured at 37°C for 48 h. The cultures were then stored in a -80°C ultra-low temperature freezer with 30% glycerol. A total of 82 probiotic strains were isolated from 30 gut samples from healthy young adults.
[0034] II. Identification of Bacteroides
[0035] Bacterial DNA was extracted using a bacterial DNA extraction kit (Garrity Biotech, China), and then PCR amplification was performed using 2×PCR mix (Garrity Biotech). The universal primers for the 16S rRNA gene (27F and 1492R) were used (Garrity GM, et al., 2016). The PCR reaction conditions were: pre-denaturation at 95℃ for 5 min; 35 cycles of 95℃ for 30 s, 56℃ for 30 s, and 72℃ for 1 min 30 s; followed by annealing and extension at 72℃ for 10 min. The PCR products were gel-cleaved and then subjected to first-generation sequencing. The obtained 16S rRNA gene sequence was compared with the NCBI database (https: / / blast.ncbi.nlm.nih.gov), and the results showed the highest homology with Bacteroides. Figure 1 For strains whose Identity and Coverage are both greater than 99% similar to known Bacteroides in the comparison results, they can be identified as Bacteroides.
[0036] After identification, 42 of the 82 probiotic strains were found to be Bacteroides (including BFS17 and BFS22). The 16S rRNA gene sequence of the strain claimed in this patent was compared with the NCBI database (https: / / blast.ncbi.nlm.nih.gov), and the results indicated that it had the highest homology with *Lactobacillus fragilis*, and was named *Bacteroides fragilis* BFS17. *Bacteroides fragilis* BFS17 was deposited on February 16, 2023, at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province, 510070, China, with accession number GDMCC No. 63172.
[0037] III. Discovery and Validation of Beneficial Metabolites of Bacteroides fragilis
[0038] 1. Genome of beneficial metabolites of Bacteroides fragilis BFS17 at the genomic level
[0039] Comparative genomic analysis of BFS17, BFS22, and other Bacteroides fragilis isolates that did not improve IBS inflammation was performed using Prokka and Roary software. The results are as follows: Figure 2As shown in Figure A. Comparative genomic analysis revealed that all *Bacteroides fragilis* strains in this study carried the gadB gene, while only *Bacteroides fragilis* BFS17 and BFS22 carried both gadB and gadC genes. Strains without anti-inflammatory effects did not carry the gadC gene. Current research indicates that the gadB gene encodes a glutamate decarboxylase within the bacteria. This enzyme catalyzes the decarboxylation of glutamate intracellularly, consuming a proton to generate γ-aminobutyric acid (GABA) (De Biase D, Mol Microbiol, 2012). In 2012, Professor Shi Yigong's team at Tsinghua University discovered that bacterially synthesized GABA cannot be directly transported to the extracellular space; it requires an antitransporter protein, GadC (encoded and synthesized by the gadC gene), to transport GABA from intracellular to extracellular space (Dan Ma, Nature, 2012). GadC can increase the yield of GABA in the fermentation supernatant of the strain, and it can also help the strain remove intracellular acidic substances such as GABA, thereby relieving the inhibitory effect of acidic substances on the growth of the strain.
[0040] Current research indicates that GABA, especially lipopeptide-containing GABA produced by microorganisms, is closely related to IBS symptoms such as visceral hypersensitivity, abdominal pain, and depression and anxiety (Laroute V, et al. Elife, 2022; Petitfils C, et al. Gut. 2022.). Therefore, BFS17 and BFS22 may improve IBS symptoms, alleviate visceral hypersensitivity, and reduce levels of depression and anxiety by synthesizing and secreting GABA.
[0041] 2. Validation of beneficial metabolites of Bacteroides BFS17 at the metabolomics level
[0042] Single colonies of BFS17 were picked and transferred to BHIych medium for anaerobic fermentation at 37°C. During fermentation, the GABA content in the fermentation metabolites of BFS17 was quantitatively analyzed using a GABA micro-method assay kit (ELISA, China). The results are as follows: Figure 2As shown in Figure B, the bacterial counts of BFS17 and BFS22 gradually increased with prolonged fermentation time, and the GABA content in the fermentation supernatant also gradually increased. At 24 hours, the GABA content in the supernatant of BFS17 was already higher than that of BFS22 (521.34 mg / L vs 185.85 mg / L, P < 0.001). This difference increased with time, reaching 1089.36 mg / L in the BFS17 fermentation supernatant at 48 hours, higher than that of the BFS22 fermentation supernatant (515.50 mg / L). At 72 hours, the GABA content in the BFS17 fermentation supernatant reached a high of 1221.64 mg / L, higher than that of the BFS22 fermentation supernatant (546.43 mg / L). These results suggest that BFS17 has a stronger GABA synthesis function than BFS22.
[0043] IV. Download the Bacteroides whole genome database from the NCBI GenBank database and the database previously established by the inventors' team, which contains 455 Bacteroides fragilis genome sequences. After annotating all Bacteroides fragilis genome sequences using Prokka software (v1.13), the pan-genome analysis software Roary was used to cluster functional genes with ≥85% similarity into the same gene cluster, generating a matrix list of all analyzed genomes, as shown in the attached figure. Figure 3 As shown in the diagram, genes common to all *Bacteroides fragilis* in the matrix list are considered core genes of *Bacteroides fragilis*. Nucleotide sequences of the core genes of *Bacteroides fragilis* were extracted and compared one by one with the NCBI non-redundant protein database. Sequences also present in other species were removed, and the remaining sequences were identified as potential specific molecular targets for *Bacteroides fragilis*. Simultaneously, specific nucleotide sequences of the probiotic strain *Bacteroides fragilis* BFS17 were extracted and compared with the NCBI non-redundant protein database. Sequences also present in other species were removed, and the remaining sequences were identified as potential specific molecular targets for *Bacteroides fragilis* BFS17. Primers were designed for these potential specific molecular targets using the NCBI Primer-BLAST database to obtain corresponding detection primers and target fragments. The target fragments were then compared again with the NCBI non-redundant gene database to remove sequences with a similarity >85% in other species, obtaining strain-specific molecular targets suitable for molecular detection. Subsequently, the screened targets were applied to actual samples for detection. Targets exhibiting good detection specificity and sensitivity in actual samples were selected as specific molecular targets for detecting *Bacteroides fragilis* and the probiotic strain *Bacteroides fragilis* BFS17.
[0044] Following the above procedure, further screening and verification analysis were conducted to obtain specific molecular target sequences SEQ ID NO.1 to SEQ ID NO.2 that specifically identify Bacteroides fragilis and Bacteroides fragilis BFS17. That is, the specific recognition nucleotide sequence of Bacteroides fragilis is shown in SEQ ID NO.1, and the specific recognition nucleotide sequence of the probiotic strain Bacteroides fragilis BFS17 is shown in SEQ ID NO.2.
[0045] Example 2: Establishment of a novel rapid detection method for Bacteroides fragilis and Bacteroides fragilis BFS17
[0046] (1) This embodiment provides a method for detecting Bacteroides fragilis and Bacteroides fragilis BFS17, the specific operation is as follows:
[0047] Based on the *Bacteroides fragilis* and *Bacteroides fragilis* BFS17 specific detection targets SEQ ID NO.1–SEQ ID NO.2 obtained in Example 1, primers SEQ ID NO.3–SEQ ID NO.6 capable of specifically amplifying the target and obtaining the target fragment were designed using Primer-BLAST software, as shown in Table 1, to obtain a rapid detection method, including the following steps:
[0048] Table 1 Primer sequences for specific PCR detection of Bacteroides and Bacteroides fragilis
[0049]
[0050] PCR detection system and amplification procedure:
[0051] Genomic DNA was extracted from the microorganisms to be tested using a microbial genomic DNA extraction kit (Huankai, China), and then added to the PCR detection reaction system for Bacteroides fragilis and Bacteroides fragilis BFS17. The PCR reaction system for Bacteroides fragilis and Bacteroides fragilis BFS17 was prepared as follows:
[0052]
[0053] The following are the PCR reaction conditions:
[0054]
[0055] After PCR, 5 μL of the PCR product was subjected to 1.5% agarose gel electrophoresis. If the electrophoresis result showed a single amplified band at the target band, it indicated that the sample contained the corresponding *Bacteroides fragilis* or probiotic strain *Bacteroides fragilis* BFS17; if no single amplified band appeared, the sample did not contain *Bacteroides fragilis* or probiotic strain *Bacteroides fragilis* BFS17. In this invention, the target band size for detecting *Bacteroides fragilis* was 204 bp, and Sanger sequencing yielded the nucleotide sequence shown in the underlined segment of SEQ ID NO. 1; the target band size for detecting *Bacteroides fragilis* BFS17 was 203 bp, and Sanger sequencing yielded the nucleotide sequence shown in the underlined segment of SEQ ID NO. 2.
[0056] (2) Sensitivity and specificity evaluation of rapid detection methods for novel Bacteroides fragilis-specific targets
[0057] The electrophoresis results of five isolates of Bacteroides fragilis from different sources and 19 other common non-Bacteroides fragilis strains were detected using the scheme described in step (1) above (primers BF_F and BF_R). The electrophoresis results are attached. Figure 4 As shown in A, the results are interpreted as shown in Table 2.
[0058] Table 2. Detection results of novel specific targets for Bacteroides fragilis.
[0059]
[0060] (3) Sensitivity and specificity evaluation of a rapid detection method for a novel specific target of Bacteroides fragilis BFS17
[0061] Using the scheme described in step (1) above (primers S17_F and S17_R), the probiotic strain Bacteroides fragilis BFS17, five other Bacteroides fragilis isolates (1-5), one Bacteroides polymorpha (6), one Bacteroides monomorpha (7), one Bacteroides ovalis (8), and 15 common human and food-derived microbial strains (9-23) were detected. The electrophoresis results are attached. Figure 4 As shown in B, the results are interpreted as shown in Table 3.
[0062] Table 3. Detection results of novel specific targets for Bacteroides fragilis.
[0063]
[0064]
[0065] Example 3: Quantitative Detection Method for Novel Novel Specific Targets of Bacteroides fragilis and Bacteroides fragilis BFS17
[0066] (1) This embodiment provides a method for quantitative detection of Bacteroides fragilis and the probiotic strain Bacteroides fragilis BFS17 in a sample, using SEQ.ID NO.3~SEQ ID NO.6 as primers for qPCR amplification reaction. The specific operation is as follows:
[0067] Primers for Bacteroides fragilis to recognize specific nucleotides
[0068] Forward primer sequence SEQ.ID NO.3
[0069] 5′-GAGCTTTTGTAGCTGTCCGC-3′
[0070] Reverse primer sequence SEQ.ID NO.4
[0071] 5′-CGCCTGCCTGTTTGTCTTTG-3′
[0072] Primers for Bacteroides fragilis BFS17 to recognize specific nucleotides
[0073] Forward primer sequence SEQ ID No. 5
[0074] 5′-GTTAATCATCGCTGCGGCAC-3′
[0075] Reverse primer sequence SEQ ID No. 6
[0076] 5′-CAACTTCACGTCGCACGAAT-3′
[0077] ① Template DNA preparation: Microbial DNA was extracted from samples containing Bacteroides fragilis or Bacteroides fragilis BFS17 using a microbial DNA extraction kit as the template to be tested;
[0078] ② qPCR detection system and amplification procedure:
[0079] The DNA template preparation method for qPCR detection follows the tissue microbial DNA extraction protocol. The qPCR reaction system for Bacteroides detection is configured as follows:
[0080]
[0081] The following is the qPCR amplification program:
[0082]
[0083] ③ Reading qPCR results:
[0084] Using Roche The system was amplified and detected using a 96 fluorescence quantitative amplification instrument, and software was used. 96SW 1.1 Read the amplification results. If a fluorescence signal is generated in the blank control (where no fluorescence signal is present), it indicates that the sample contains *Bacteroides fragilis* or the probiotic strain *Bacteroides fragilis* BFS17 corresponding to the detection primers; if no fluorescence signal is generated, the sample does not contain *Bacteroides fragilis* or the probiotic strain *Bacteroides fragilis* BFS17 corresponding to the detection primers.
[0085] (2) Evaluation of the sensitivity of the new detection protocol for Bacteroides fragilis or Bacteroides fragilis BFS17
[0086] Apply physiological saline to a concentration of 1×10 9 Bacteroides fragilis or Bacteroides fragilis BFS17 at CFU / mL were diluted 10-fold to obtain a concentration of 10. 8 10 7 10 6 10 5 10 4 10 3 10 2 10 1 After extracting DNA from the pure culture of the strain at CFU / mL, the qPCR protocol was used to quantitatively detect Bacteroides fragilis or Bacteroides fragilis BFS17 in the sample. Each concentration sample was tested in triplicate.
[0087] Plotting a standard curve: Plot the logarithm of the concentration of *Bacteroides fragilis* or *Bacteroides fragilis* BFS17 in the sample on the x-axis and the corresponding real-time Ct value of qPCR on the y-axis. The resulting curve is the standard curve for the quantitative detection of *Bacteroides fragilis* or *Bacteroides fragilis* BFS17. The standard curve is attached. Figure 5 A(2), Appendix Figure 5 As shown in B(2), the detection limit of the primer pair for Bacteroides fragilis or Bacteroides fragilis BFS17 in the sample is 1×10⁻⁶. 2 CFU / mL. The results indicate that the standard curve for the detection of *Bacteroides fragilis* was y = -2.3394x + 32.215, with a correlation coefficient R0. 2 The correlation coefficient R is 0.9265; the standard curve for the detection of Bacteroides fragilis is y = -2.3886x + 33.607, and the correlation coefficient R is 0.9265. 2 It is 0.9194.
[0088] (3) qPCR quantitative detection of Bacteroides fragilis or Bacteroides fragilis BFS17 in actual samples
[0089] A 1g human fecal sample was collected, and microbial DNA was extracted from the fecal sample using a fecal microbial DNA extraction kit. The DNA was then analyzed by qPCR according to Example 3(1). Using Bacteroides fragilis-specific primers, the Ct value of the sample was found to be 22.30±0.13. Based on the standard curve, the amount of Bacteroides fragilis in the sample was calculated to be 1×10⁻⁶. 4.24 CFU / mL; qPCR detection using Bacteroides fragilis BFS17-specific primers revealed a Ct value of 24.72 ± 0.04 for the tested sample. Based on the standard curve, the amount of Bacteroides fragilis BFS17 in the sample was calculated to be 1 × 10⁻⁶. 3.72 CFU / mL.
[0090] 1. Specific recognition nucleotide sequences of Bacteroides
[0091] SEQ.ID NO.1
[0092] ATGC GAGCTTTTGTAGCTGTCCGCCAATTGGCCTCGGCTCTTCCGGTGAATGACATCACCAGGCTGCAA GATGAAAATAAAAGAGTTAAAAGAATATGTAGAAGCGGCATTTGCCGATTACAATGATATTAATGAAGATACGAGGAT GCAACTTGAATTAATTAATCAGGCAATTGCTGAATTGCAGGCCAAAGACAAACAGGCAGGCG GAAAAACTCGTAATCCGATCGGTTTTATATC
[0093] TTATTAA
[0094] 2. Specific recognition nucleotide sequences of Bacteroides fragilis
[0095] SEQ.ID NO.2
[0096] ATGAACAAGAACATCAGACAAAA GTTAATCATCGCTGCGGCACTTATGATTGCCGCAAC
[0097] CGCCTCCCGCTTTCGCACAGGGAAACGGTCTGGCTGGCATCAACGAAGCCACCTCTATGG
[0098] TGAGTTCGTATTTCGACCCCGGCACGAAATTAATCTACGCCATCGGCGCGGTAGTCGGGC
[0099] TTATCGGTGGCGTGAAAGTGTACGGAAAATTCGTGCGACGTGAAGTTG CGTAA
[0100] 3. Primers for Bacteroides fragilis to recognize specific nucleotides
[0101] Forward primer sequence SEQ.ID NO.3
[0102] 5′-GAGCTTTTGTAGCTGTCCGC-3′
[0103] Reverse primer sequence SEQ.ID NO.4
[0104] 5′-CGCCTGCCTGTTTGTCTTTG-3′
[0105] 4. Primers for Bacteroides fragilis BFS17 to recognize specific nucleotides
[0106] Forward primer sequence SEQ.ID NO.5
[0107] 5′-GTTAATCATCGCTGCGGCAC-3′
[0108] Reverse primer sequence SEQ.ID NO.6
[0109] 5′-CAACTTCACGTCGCACGAAT-3′
[0110] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.
Claims
1. A set of molecular targets for the detection of B. fragilis and B. fragilis BFS17, characterized in that, The aforementioned Bacteroides fragilis ( Bacteroides fragilis The molecular target nucleotide sequence of Bacteroides fragilis BFS17 is shown in SEQ ID NO.1, and the molecular target nucleotide sequence of Bacteroides fragilis BFS17 is shown in SEQ ID NO.
2. The Bacteroides fragilis BFS17 has the accession number GDMCC No: 63172.
2. A set of primers for detecting B. fragilis and B. fragilis BFS17, characterized by, The primer set comprises: the primer for detecting Bacteroides fragilis comprises the primer shown in SEQ ID NO. 3 and SEQ ID NO. 4; the primer for detecting Bacteroides fragilis BFS17 comprises the primer shown in SEQ ID NO. 5 and SEQ ID NO. 6, and the Bacteroides fragilis BFS17 has a preservation number of GDMCC No: 63172.
3. The molecular target of claim 1 or the primer set of claim 2 in the detection of Bacteroides fragilis and Bacteroides fragilis BFS17 in the diagnosis and treatment methods of non-diseases, and the Bacteroides fragilis BFS17 has a preservation number of GDMCC No: 63172.
4. A method for detecting Bacteroides fragilis and Bacteroides fragilis BFS 17 for diagnosis and treatment of non-disease, characterized by, DNA of the sample is extracted, and then the primer for detecting Bacteroides fragilis in claim 2 is used for PCR amplification, if a band with a size of 204 bp is obtained, then the Bacteroides fragilis is contained; the primer for detecting Bacteroides fragilis BFS17 in claim 2 is used for PCR amplification, if a band with a size of 203 bp is obtained, then the Bacteroides fragilis BFS17 is contained, and the Bacteroides fragilis BFS17 has a preservation number of GDMCC No: 63172.
5. The method of claim 4, wherein, The reaction system of the PCR amplification is 2×PrimeSTAR Max Premix 12.5 μL, forward primer 10 μmol / L 1 μL, reverse primer 10 μmol / L 1 μL, template DNA 2.5 ng / μL 1 μL, and ddH2O 9.5 μL.
6. The method of claim 4, wherein, The reaction procedure of the PCR amplification is pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 10 s, annealing at 60 ℃ for 5 s, and extension at 72 ℃ for 5 s, for a total of 35 cycles; and extension at 72 ℃ for 10 min.
7. A qPCR detection method for quantifying B. fragilis and probiotic strain B. fragilis BFS17 for diagnosis and treatment of non-disease, characterized by, The method comprises the following steps: (1) drawing standard curves of Bacteroides fragilis and Bacteroides fragilis BFS17 by using the primer set for detecting Bacteroides fragilis and Bacteroides fragilis BFS17 in claim 2; (2) performing qPCR amplification on the sample by using the primer set for detecting Bacteroides fragilis and Bacteroides fragilis BFS17 in claim 2, obtaining the ct value of the sample, and calculating the content of Bacteroides fragilis and the probiotic strain Bacteroides fragilis BFS17 in the sample according to the standard curve; The Bacteroides fragilis BFS17 has a preservation number of GDMCC No: 63172.
8. The qPCR detection method of claim 7, wherein, The qPCR amplification system is: 2×SYBR Green Premix reaction liquid 5 μL, template DNA to be detected 1 μL, 10 μmol / L forward and reverse primers each 0.5 μL, and sterilized double distilled water 3 μL.
9. The qPCR detection method of claim 7, wherein, The qPCR reaction procedure is two-step PCR, and the specific reaction procedure is: preheating at 95 ℃ for 30 s; two-step amplification at 95 ℃ for 5 s and at 60 ℃ for 30 s, for a total of 40 cycles.
10. A kit for detecting B. fragilis and B. fragilis BFS17, characterized by, The method comprises the primer set for detecting Bacteroides fragilis and Bacteroides fragilis BFS17 in claim 2, and the Bacteroides fragilis BFS17 has a preservation number of GDMCC No: 63172.
Citation Information
Patent Citations
Biomarker capable of detecting diseases and application of biomarker
CN105368944A
Methods and compositions for treating gastrointestinal and inflammatory disorders
CN113728088A