Rice gene OsPI4K and its application in rice blast resistance

Abstract

The present invention discloses a protein related to rice blast resistance, its coding gene and applications. The protein related to rice blast resistance disclosed by the present invention is A1) or A2): A1) a protein with an amino acid sequence of SEQ ID NO: 2; A2) a protein obtained by substituting and / or deleting and / or adding one or several amino acid residues to the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing and having the same function as the protein shown in SEQ ID NO: 2. Experiments have proved that the present invention has clarified that the protein related to rice blast resistance has a negative regulatory function on rice blast resistance, providing an endogenous gene target for the prevention and control of rice blast.

Description

Technical Field

[0001] The present invention belongs to the field of plant genetic engineering, and particularly relates to the application of a rice gene OsPI4K and its encoded protein in resistance to rice blast. Background Art

[0002] Rice is one of the most important food crops for modern humans, and more than half of the world's population takes rice as the staple food. Rice blast, caused by Magnaporthe oryzae in the phylum Ascomycota of the fungal kingdom, is one of the most destructive rice diseases, widely prevalent in rice-growing regions worldwide, resulting in huge yield losses and deterioration of rice quality. The infection of rice by Magnaporthe oryzae can be divided into seedling blast, leaf blast, collar blast, node blast, panicle neck blast and grain blast according to the damage period and organs, among which the most serious one is panicle neck blast, and even complete failure of production may occur in severe cases. There are various means for the prevention and control of rice blast, such as agricultural control, chemical control, etc., but these means all have their limitations. Starting from cultivation, adopting reasonable variety layout methods and improving cultivation conditions, etc., requires a large amount of labor input and is not easy to implement. As for chemical control, once the best period for applying pesticides is missed, its control effect will be significantly reduced, and excessive use of pesticides will also bring problems of food safety and environmental pollution. In comparison, cultivating new rice varieties with broad-spectrum resistance to rice blast is an economical and effective means for the prevention and control of rice blast. Therefore, it is particularly important to discover disease-resistant genes in different rice varieties.

[0003] In nature, plants are subjected to various abiotic and biotic stresses. Reactive oxygen species (ROS), as a key signaling molecule, play an important role in abiotic and biotic stress responses. Abiotic stresses such as drought and salinization can induce plants to produce ROS, and ROS further induces guard cells to close stomata to reduce water loss. In order to maintain homeostasis, excessive ROS produced will be scavenged by a series of enzymes and non-enzyme antioxidants. In biotic stress, the immune responses triggered by pathogen-associated molecular patterns (PAMPs), namely PAMP-triggered immunity (PTI), and effector-triggered immunity (ETI) will both cause bursts of ROS. High concentrations of reactive oxygen species can inhibit the spread of pathogens in plant cells and lead to hypersensitive cell death, thus achieving the effect of inhibiting pathogen infection.

[0004] Type-II phosphoinositide-4 kinases (PI4Ks) are a large number of kinases in plants. However, the functions of most type-II PI4Ks are still unclear. Type-II PI4Ks generally contain a kinase domain and several ubiquitin-like (UBL) domains. The reported type-II PI4Ks are mainly involved in plant growth and development. For example, AtPI4Kγ5 in Arabidopsis interacts with the membrane-bound NAC transcription factor ANAC078 and phosphorylates it, thus playing a role in regulating auxin synthesis and cell division. AtPI4Kγ2 interacts with MIEL1 and regulates its degradation, and further stabilizes the transcription factor MYB30, which inhibits auxin metabolism. AtPI4Kγ3 is induced by abiotic stress. Overexpression of AtPI4Kγ3 enhances the tolerance to ABA by reducing the accumulation of ROS. Overexpression of TaPI4KIIγ in wheat can improve the ability of wheat to scavenge ROS, thereby enhancing the tolerance to salt stress and drought stress. Multiple type-II PI4Ks have the ability to scavenge ROS in plant cells, suggesting that they may also play a role in plant biotic stress, such as resistance to Magnaporthe oryzae. However, so far, there is no report on the application of OsPI4K protein in rice disease resistance, and the specific biochemical function of OsPI4K protein in rice is also unknown. Summary of the Invention

[0005] The technical problem to be solved by the present invention is how to improve the resistance of rice to Magnaporthe oryzae. The present invention finds that knocking out the OsPI4K gene in rice by biotechnological means can significantly improve the resistance of rice to Magnaporthe oryzae, while overexpressing the OsPI4K gene in rice will weaken the resistance of rice to Magnaporthe oryzae. Further, we find that OsPI4K regulates the resistance of rice to Magnaporthe oryzae by regulating the expression of disease resistance-related genes and the level of ROS in cells.

[0006] Based on this, to solve the above technical problems, the present invention provides a protein related to rice resistance to Magnaporthe oryzae and its coding gene OsPI4K. Specifically, the CRISPR / Cas9 method is used to knock out the OsPI4K gene and the Agrobacterium-mediated transformation is used to overexpress the OsPI4K gene, and it is clarified that the OsPI4K gene has a negative regulatory function on rice resistance to Magnaporthe oryzae, providing an endogenous gene target for the prevention and control of Magnaporthe oryzae.

[0007] The name of the protein related to rice resistance to Magnaporthe oryzae provided by the present invention is OsPI4K, which is as follows A1) or A2):

[0008] A1) The protein with the amino acid sequence of SEQ ID NO.2;

[0009] A2) A protein which has the amino acid sequence shown as SEQ ID NO.2 in the sequence listing, with substitution and / or deletion and / or addition of one or several amino acid residues, and has the same function as the protein shown in Sequence 2.

[0010] In order to facilitate the purification of the protein in A1), a fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of the protein shown in Sequence 2 can also be used; the tag can be Poly-Arg (RRRRR), Poly-His (HHHHHH), FLAG (DYKDDDDK), Strep-tag II (WSHPQFEK), c-myc (EQKLISEEDL), etc.

[0011] The rice blast resistance-related protein described in A1)-A2) generally comes from rice in nature. That is, generally speaking, it is a natural product, and it can also be artificially expressed or synthesized. It can also be synthesized first by its coding gene and then obtained by biological expression. The coding gene of the protein in A2) can be obtained by deleting the codons of one or several amino acid residues in the DNA sequence shown as Sequence 1 in the sequence listing, and / or performing missense mutations of one or several nucleotide pairs, and / or linking the coding sequence of the above-mentioned tag to its 5'-end and / or 3'-end. Among them, Sequence 2 (OsPI4K) in the sequence listing consists of 606 amino acid residues.

[0012] The coding gene of the blast resistance-related protein also belongs to the protection scope of the present invention.

[0013] Preferably, the coding gene is as follows 1) or 2) or 3) or 4):

[0014] 1) The coding sequence is a cDNA molecule or DNA molecule at positions 1-1818 of Sequence 1 in the sequence listing.

[0015] 2) The cDNA molecule or DNA molecule shown as Sequence 1 in the sequence listing.

[0016] 3) A cDNA molecule or DNA molecule that has 75% or more identity with the nucleotide sequence defined in 1) or 2) and encodes the blast resistance-related protein.

[0017] 4) A cDNA molecule or DNA molecule that hybridizes with the nucleotide sequence defined in 1) or 2) under stringent conditions and encodes the blast resistance-related protein.

[0018] In an embodiment of the present invention, the blast resistance-related protein and its coding gene are the following gene or protein:

[0019] A rice gene OsPI4K, whose open reading frame nucleotide sequence is shown as SEQ ID NO.1.

[0020] The protein encoded by the rice gene OsPI4K described above has an amino acid sequence as shown in SEQ ID NO.2.

[0021] Sequence 1 in the Sequence Listing consists of 1,818 nucleotides. The nucleotides from positions 1 to 1,818 at the 5' end of Sequence 1 are the coding sequence, which encodes the protein shown in Sequence 2 of the Sequence Listing.

[0022] Since those of ordinary skill in the art can easily use existing technologies, such as methods of sequence recombination and point mutation, to mutate the nucleotide sequence encoding OsPI4K in the present invention. Those artificially modified nucleotides having 75% or higher identity with the nucleotide sequence of OsPI4K isolated in the present invention, as long as they encode the OsPI4K protein and have the same function, are all derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention. The term "identity" used herein refers to the sequence similarity with the natural nucleic acid sequence. "Identity" includes nucleotide sequences having 75% or higher identity with the nucleotide sequence encoding SEQ ID NO.1 of the present invention. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0023] The present invention also provides the application of the anti - Magnaporthe oryzae - related protein described above and its encoding gene OsPI4K in regulating the disease resistance of rice to Magnaporthe oryzae.

[0024] The application of the biological material related to the anti - Magnaporthe oryzae - related protein in regulating the disease resistance of rice to Magnaporthe oryzae also belongs to the protection scope of the present invention; the biological material is any one of the following B1) to B9):

[0025] B1) A nucleic acid molecule encoding the anti - Magnaporthe oryzae - related protein;

[0026] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0027] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0028] B4) A recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);

[0029] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2);

[0030] B6) A transgenic plant tissue containing the nucleic acid molecule described in B1), or a transgenic plant tissue containing the expression cassette described in B2);

[0031] B7) A transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant organ containing the expression cassette described in B2);

[0032] B8) A nucleic acid molecule that inhibits the expression of the gene encoding the rice blast resistance-related protein described above;

[0033] B9) An expression cassette, recombinant vector, recombinant microorganism or transgenic plant cell line containing the nucleic acid molecule described in B8).

[0034] The use of the rice blast resistance-related protein or its encoding gene as a target for screening pesticides against rice blast also belongs to the scope of protection of the present invention.

[0035] The present invention also provides a method for cultivating disease-resistant transgenic plants, including: inhibiting the expression of the gene encoding the rice blast resistance-related protein in the target plant to obtain a disease-resistant transgenic plant with higher disease resistance than the target plant.

[0036] The target plant is rice; specifically, the rice variety Nipponbare in the present invention. The disease resistance is rice blast resistance.

[0037] The method for inhibiting the rice blast resistance-related protein in the target plant is to use the CRISPR / Cas9 method to knockout the gene encoding the rice blast resistance-related protein.

[0038] The specific operation includes: selecting a CRISPR / Cas9 editing target site in the open reading frame coding region of the OsPI4K gene, constructing an OsPI4K knockout vector, then transferring the recombinant vector into Agrobacterium, and obtaining an ospi4k knockout mutant through Agrobacterium-mediated rice callus transformation technology and screening. At the same time, use the homologous recombination method to construct an OsPI4K overexpression vector, and transform rice callus by Agrobacterium-mediated method to obtain a rice line overexpressing OsPI4K. After successfully constructing the knockout line and overexpression line, the rice blast resistance was identified by the method of scratching and inoculating rice leaves. At the same time, the rice blast resistance of the ospi4k knockout mutant was also evaluated under field conditions and the transcriptional levels of disease resistance-related genes in the knockout rice were detected.

[0039] The nucleotide sequence of the above CRISPR / Cas9 editing target site is shown as SEQ ID NO.3.

[0040] The promoter that initiates the transcription of the coding gene OsPI4K in the above recombinant expression vector can be the ubiquitin promoter, the 35S promoter or the Actin1 promoter. In the present invention, the promoter that initiates the transcription of the coding gene OsPI4K is specifically the ubiquitin promoter.

[0041] In one embodiment of the present invention, a method for cultivating disease-resistant transgenic plants is also provided, including: transferring the coding gene of the protein related to rice blast resistance into a target plant, and screening to obtain a susceptible transgenic plant with disease resistance lower than that of the target plant.

[0042] The target plant is rice; the disease resistance is rice blast resistance.

[0043] Through the above experiments, it was found that the rice gene OsPI4K has application potential in rice blast resistance. Specifically, knocking out the OsPI4K gene significantly improves the resistance of rice to rice blast; while overexpressing OsPI4K in rice shows more susceptibility than the wild type. Therefore, OsPI4K is a gene that negatively regulates the resistance of rice to rice blast in rice, and editing this gene provides a potential endogenous gene target for cultivating resistant varieties and controlling the occurrence of rice blast fungi. Description of the Drawings

[0044] Figure 1 It is for the identification of ospi4k knockout mutants and the identification of agronomic traits. A is the identification of knockout mutants. WT is the reference gene sequence. 4# and 12# are two lines of ospi4k knockout mutants, ospi4k-4 and ospi4k-12. An A was inserted into the coding region of 4#, and a G was inserted into the coding region of 12#. Both are homozygous mutants and cause premature termination of translation. B is the field phenotypes of the wild type and the mutants. Their growth is similar, and knocking out ospi4k does not affect the agronomic traits of rice; NPB is wild type rice, and ospi4k-4 and ospi4k-12 are two lines of ospi4k knockout mutants.

[0045] Figure 2 It is for the phenotype of inoculating Magnaporthe oryzae by scratching the leaves of the mutant ospi4k. A is the phenotype picture of inoculating Magnaporthe oryzae by scratching the leaves of the mutant ospi4k and the wild type rice Nipponbare. The Magnaporthe oryzae strain used is the wild type strain P131. B is the statistical chart of the diseased area four days after inoculation. Data analysis was performed using one-way ANOVA (p < 0.01, one-way ANOVA with post-hoc Turkey tests). The diseased area of Magnaporthe oryzae on the wild type leaves is significantly larger than that of the ospi4k knockout. C is to detect the biomass of Magnaporthe oryzae in the corresponding leaves four days after inoculation using real-time fluorescence quantitative nucleic acid amplification. The calculation method of biomass is 2 [CT(OsUbq)-CT(MoPot2)] , MoPot2 and OsUbq are conserved genes in Magnaporthe oryzae and rice, respectively. Data analysis was performed using one-way ANOVA (p < 0.01, one-way ANOVA with post-hoc Turkey tests). In the figure, NPB is wild-type rice, and ospi4k-4 and ospi4k-12 are two lines of ospi4k knockout mutants.

[0046] Figure 3 This shows the phenotype of the mutant ospi4k after inoculation with Magnaporthe oryzae in the field. A shows a comparison of the incidence of rice blast on the leaves of knockout mutant rice and wild-type rice at the booting stage. The number and area of lesions on the leaves of the ospi4k knockout mutants were significantly smaller than those on wild-type rice. B shows the results of the disease index survey in the field. The disease index of wild-type rice was significantly higher than that of the ospi4k knockout mutants. Data analysis was performed using one-way ANOVA (p < 0.05, one-way ANOVA with post-hoc Turkey tests). In the figure, NPB is wild-type rice, and ospi4k-4 and ospi4k-12 are two lines of ospi4k knockout mutants.

[0047] Figure 4 This shows the expression levels of pathogenesis-related genes detected by real-time fluorescence quantitative PCR 18 hours after inoculation with Magnaporthe oryzae. The results showed that the expression levels of multiple pathogenesis-related genes such as PR1a, PR2, PR3, and PR5 were significantly increased in the ospi4k knockout mutant lines compared with wild-type rice. In the figure, NPB is wild-type rice, and ospi4k-4 and ospi4k-12 are two lines of ospi4k knockout mutants.

[0048] Figure 5 This shows the acquisition and phenotypic analysis of transgenic lines overexpressing the OsPI4K gene. A shows the expression levels of the OsPI4K gene detected by real-time quantitative PCR in wild-type and overexpressing plants. Data analysis was performed using one-way ANOVA (p < 0.01, one-way ANOVA with post-hoc Turkey tests). B shows the phenotypic diagram of the disease after inoculation with Magnaporthe oryzae P131 by scratching the leaves of the OsPI4K overexpressing line and wild-type WT four days later. C shows the statistical chart of the disease area four days after inoculation. Data analysis was performed using one-way ANOVA (p < 0.01, one-way ANOVA with post-hoc Turkey tests). The disease area of wild-type rice was significantly smaller than that of the OsPI4K overexpressing line. D shows the detection of the biomass of Magnaporthe oryzae four days after inoculation using real-time fluorescence quantitative PCR. The biomass was calculated as 2 [CT(OsUbq)-CT(MoPot2)]Data analysis was performed using one-way ANOVA (p<0.01, one-way ANOVA with post-hoc Turkey tests). Detailed implementation mode

[0049] The present invention will be further described in detail below in conjunction with the specific implementation modes.

[0050] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods.

[0051] Unless otherwise specified, the materials, reagents, etc. used in the following examples can all be obtained from commercial channels.

[0052] In the following examples, all quantitative tests were set up with three repeated experiments, and the results were averaged.

[0053] Example 1: Cloning of the rice OsPI4K gene

[0054] In the early stage of this experiment, a rice cDNA library was screened using a Magnaporthe oryzae effector protein as a bait, and a possible candidate gene was screened. Through sequencing and sequence alignment, the screened gene was determined to be LOC_Os04g57300. LOC_Os04g57300 encodes a protein containing 605 amino acids, with a ubiquitin-like (Ubl) domain at the N-terminus and a kinase domain from amino acids 172 to 413, which was named OsPI4K. According to the cDNA sequence of OsPI4K, a pair of amplification primers was designed and OsPI4K was successfully cloned from the total cDNA of Nipponbare leaves. The full length of OsPI4K is 1818 bp. The nucleotide sequences of the primers used for cloning OsPI4K cDNA are as follows:

[0055] OsPI4K-F (SEQ ID NO.4): 5’-ATGTCGCCCAATCTGGAG-3’,

[0056] OsPI4K-R (SEQ ID NO.5): 5’-TCAAAACTTGCAGGAAGT-3’

[0057] It was found by real-time fluorescence quantitative PCR that the transcription of OsPI4K could be detected in the roots, stems, leaves and panicles of the normal-growing rice variety Nipponbare, especially with the highest transcription level in the leaves, proving that it is a gene with normal transcriptional expression. Since OsPI4K interacts with the effector proteins of Magnaporthe oryzae, it is speculated that OsPI4K may play a regulatory role in the immune response of rice. The nucleotide sequence of the open reading frame of the OsPI4K gene is shown as SEQ ID NO.1; the nucleotide sequence from the 1st to 1818th positions at the 5' end of SEQ ID NO.1 is the coding sequence, and the amino acid sequence encoded by it is shown as SEQ ID NO.2.

[0058] SEQ ID NO.1:

[0059] atgtcgccca atctggagag ccacatcaag agccaggtgc cggcgctgct gctgaggcgc60ttcttcggcg gggcggggcg gcggcgggtg ttcgtgcaga cggagactgg gtgcgtgctg120ggcatggacc tcgaccgcag cgacaacgcg cacacggtga agcgccggct gcagctcgcg180ctcaacgtgc ccaccggcga gacctcgctc accttcggcg accgcgtcct ggagaatgac240ctctccttca tccgcccgga ctcgccgctg ctgctcaccc gcaacagcat caaccggagc300tgctccacgc cctgcctctg cccggtgtcc aaggacttcg agcacaagga tcgcagcggc360ctggtcgaga tgctcggctg ctcgatcagc tgcgcccgcg tgaagcgcct cgtcgacgac420gtggtcaccg ccatcaggag cggcgtggat ccggtcccca ttggcagtgg gcttggtggc480tcctactact tcaggaacat ctccggcgac agggttgcca tcgtgaagcc gacggatgag540gagccttttg cacccaacaa cccgaagggg ttcgtcggga gagcgcttgg gcagccggga600ctgaagaaat ctgtcagggt gggagagaca gggttcaggg aggtggcggc gtacctgttg660gatcatgata acttcgcaaa tgttcctccg acggcgttgg tgaagatcac acactcaatt720ttccatatca attgtccggt gaacggcggc agtccagctc atgatcagaa gcagcaggtt780tccagcaaga tcgcttcgtt tcagcagttc atcgcgcatg acttcgatgc cagtgatcat840ggcacgtcga gcttcccggt tgctgctgtt cataggatcggcatactgga tatcagaatt900ttcaacactg acaggcatgc tggtaatgtg ctggtgagga agcttgatgg tggcaccggt960cgctttggtt gtcagacgga attgtttcca attgatcatg gcctgtgctt gccagagaat1020ttggaggacc cttatttcga gtggatccac tgggctcagt catcaatccc attctctgaa1080gaggagctcg agtacattaa gaatcttgat ccaatgaggg atgtggcaat gctgcgtagg1140gagcttccta taatccgcga ggcctgcctt cgtgtcctgg tgctgtgcac aatcttcctt1200aaggaggctg ctgcttctgg tctttgcttg gcagagatag gtgagatgat gaccagggag1260ttcagagggt tggaggagga accgagcaag ctggaggttg tctgcatgga agctaggaga1320aaattagctg agtgggaacc atactcacct gtcatcgaac aaggggagga catggatttc1380caattctcac tggacatgtt aggagagtac aatgatgtga ttaggtcacc aagattcaat1440ggcttaggag caaaggggaa tggtttcaga aaccctcttt caaagcttgt ggagagcatc1500gatgaggaca atgatgatga tgatggccga agtgaatctt ccaagcgttc atcggagcgt1560gtccattctg gagggttgaa gttccccagt gctgataaat ccagcggttc taacggcagt1620gtgcatgctc tgaacaggag tgcagacgaa cagcttccat caagtgtata cttcgtcagg1680ctgtcggaca tgaatgcaga agagtggaat atattccttg agaagttcca ggagctgctg1740aaagaagctctgcaggagcg tgcggcggct gcagggcagc ggatgaagca gcggctgggc1800acttcctgca agttttga 1818

[0060] SEQ ID NO.2:

[0061] MSPNLESHIK SQVPALLLRR FFGGAGRRRV FVQTETGCVL GMDLDRSDNA HTVKRRLQLA60LNVPTGETSL TFGDRVLEND LSFLIRPDSP LLLTRNSINR SCSTPCLCPV SKDFEHKDRS120GLVEMLGCSI SCARVKRLVD DVVTAIRSGV DPVPIGSGLG GSYYFRNISG DRVAIVKPTD180EEPFAPNNPK GFVGRALGQP GLKKSVRVGE TGFREVAAYL LDHDNFANVP PTALVKITHS240IFHINCPVNG GSPAHDQKQQ VSSKIASFQQ FIAHDFDASD HGTSSFPVAA VHRIGILDIR300IFNTDRHAGN VLVRKLDGGT GRFGCQTELF PIDHGLCLPE NLEDPYFEWI HWAQSSIPFS360EEELEYIKNL DPMRDVAMLR RELPIIREAC LRVLVLCTIF LKEAAASGLC LAEIGEMMTR420EFRGLEEEPS KLEVVCMEAR RKLAEWEPYS PVIEQGEDMD FQFSLDMLGE YNDVIRSPRF480NGLGAKGNGF RNPLSKLVES IDEDNDDDDG RSESSKRSSE RVHSGGLKFP SADKSSGSNG540SVHALNRSAD EQLPSSVYFV RLSDMNAEEW NIFLEKFQEL LKEALQERAA AAGQRMKQRL600GTSCKF 606

[0062] Example 2: Obtaining ospi4k gene knockout plants

[0063] To verify the effect of the OsPI4K gene on the resistance of rice to Magnaporthe oryzae, we used the CRISPR / Cas9 technology to edit LOC_Os04g57300. Using the OsPI4K gene LOC_Os04g57300 as a target, a CRISPR / Cas9-based sgRNA sequence (5’-GGTCGAGATGCTCGGCTGCT-3’) (SEQ ID NO.3) was designed, and the DNA fragment containing the encoding sgRNA sequence was ligated into a vector carrying CRISPR / Cas (the commercial CRISPR / Cas vector BGK03 was purchased from Baige Gene Technology (Jiangsu) Co., Ltd.). The detailed method for creating the pC1300-Cas9 vector refers to the literature "Wang, C., Shen, L., Fu, Y., Yan, C. and Wang, K. (2015). A simple CRISPR / Cas9 system for multiplex genome editing in rice. Journal of Genetics and Genomics, 42: 703-706". The detailed vector construction method refers to the patent "Construction and application of a plant multi-gene knockout vector, CN105112435B" as follows:

[0064] (1) Primer design

[0065] Design a primer pair for constructing gRNA: Add GGCA before the OsPI4K-T1 forward sequence to obtain the primer OsPI4K-T1F; add AAAC before the reverse complementary sequence of OsPI4K-T1 to obtain the primer OsPI4K-T1R. The specific sequences are as follows:

[0066] OsPI4K-T1F: 5’-ggcaGGTCGAGATGCTCGGCTGCT-3’

[0067] OsPI4K-T1R: 5’-aaacAGCAGCCGAGCATCTCGACC-3’

[0068] (2) Construction of the gRNA expression cassette:

[0069] The SK-gRNA was digested with AarI enzyme (purchased from Ferment Company) to form a vector with sticky ends. For the detailed method of creating the SK-gRNA vector, refer to the literature "Wang, C., Shen, L., Fu, Y., Yan, C. and Wang, K. (2015). A simple CRISPR / Cas9 system for multiplex genome editing in rice. Journal of Genetics and Genomics, 42: 703-706". The enzyme digestion reaction system was as follows: 10×buffer 5 μL, 50×oligonucleotide 1 μL, Aar I 2 μL, vector SK-gRNA (0.1 μg) 10 μL, ddH 2 O 32 μL, with a total volume of 50 μL. The digestion was carried out at 37 °C for 3 hours, and the small amount of agarose gel DNA recovery kit (Zhuangmeng Gel Mini Purification Kit; ZP202) was used for purification according to the product manual; the linear vector SK-gRNA / AarI was obtained. 20 μL of each of the 100 μM primers OsPI4K--T1F and OsPI4K--T1R were mixed, incubated at 100 °C for 5 minutes and then placed at room temperature for slow annealing to form a fragment with sticky ends. The vector and the fragment were ligated with T4 enzyme (purchased from NEB Company), and the reaction was as follows: vector SK-gRNA / AarI (30 ng) 1.5 μL, 10×T4 ligase buffer 1 μL, annealed product 7 μL, T4 ligase 0.5 μL, with a total volume of 10 μL, and the reaction was carried out at room temperature for 1 hour. 5 μL of the ligation product was transformed into Escherichia coli competent cell DH5α to obtain the ligation plasmid. The general primer T7 (5’-TAATACGACTCACTATAGG-3’) on SK was used for sequencing to confirm the correct construction of the clone, and the gRNA expression cassette SK-gRNA was obtained.

[0070] (3) Ligation of the target gRNA expression cassette and the knockout vector pC1300-Cas9

[0071] The SK-gRNA plasmid was digested with Bgl II and Kpn I, and a band of about 0.6 kb was recovered by gel cutting. This fragment was ligated between the Kpn I and BamH I recognition sites of the pC1300-Cas9 binary vector (purchased from Baige Gene Technology (Jiangsu) Co., Ltd.) to obtain the final binary expression vector pC1300-Cas9-SK-gRNA for knocking out OsPI4K. The ligation reaction was as follows: vector pC1300-Cas9 / Kpn I + BamH I (30 ng) 1 μL, fragment SK-gRNA / Bgl II + Kpn I (25 ng) 1 μL, 10×T4 ligase buffer 1 μL, ddH 2 O 6.5 μL, T4 ligase 0.5 μL, total volume 10 μL, and reacted at room temperature for 1 hour. 5 μL of the ligation product was transformed into Escherichia coli competent cell DH5α to obtain the ligation plasmid. Sequencing was performed using the primer pC1300-F (5’-ACACTTTATGCTTCCGGCTC-3’) to determine the correct clone.

[0072] Agrobacterium-mediated transformation was used for the transformation of the rice variety Nipponbare. The specific transformation method can be referred to the literature "YI Zili, CAO Shouyun, WANG Li, CHU Chengcai, LI Xiang, HE Sijie, TANG Zuoshun, ZHOU Puhua, TIAN Wenzhong, Study on Improving the Frequency of Agrobacterium-mediated Transformation of Rice, Acta Genetica Sinica, 2001, 28(4): 352-358". The transformed rice calli were induced to differentiate and root in the medium containing different plant hormones, and finally the candidate rice seedlings were obtained. We designed a pair of identification primers in the region adjacent to the target site to identify the transgenic plants. The sequences of the identification primers are as follows:

[0073] JDOsPI4K-F (SEQ ID NO.6): 5’-GCGTCCTGGAGAATGACCTC-3’,

[0074] JDOsPI4K-R (SEQ ID NO.7): 5’-AAAAGGCTCCTCATCCGTCG-3’

[0075] The specific operation is as follows: Extract the genomic DNA of candidate rice leaves using the CTAB method: 1) Cut about 50 mg of rice leaves and put them into a 2 ml EP tube, add magnetic beads and break them with an MP shaker (4 m / s, 20 s). 2) Add 500 μl of CTAB to the broken rice leaves and heat them on a heating block at 65 °C for 15 minutes, shaking 2 - 3 times during this period. 3) Add 250 μl each of phenol and chloroform and shake well. 4) Centrifuge at 4 °C and 12000 rpm for 15 minutes. 4) Take the supernatant, add twice the volume of absolute ethanol and precipitate at -20 °C for 30 minutes. 5) Centrifuge at 4 °C and 12000 rpm for 15 minutes, discard the supernatant, and wash the precipitate twice with 75% alcohol. 6) Dry the precipitate and add ddH 2 O to obtain the total DNA of rice leaves. Use the above identification primers to amplify the target fragment. The specific reaction system is as follows: PCR mix: 25 μl, ddH 2 O: 20 μl, JDOsPI4K-F primer: 2 μl, JDOsPI4K-R primer: 2 μl, DNA template: 1 μl. By sequencing the amplified fragment, we identified two independent transgenic knockout positive plants, named ospi4k-4 and ospi4k-12 respectively. ospi4k-4 and ospi4k-12 inserted 1 base A and 1 base G at the exon respectively, causing a frameshift mutation in the coding region and ultimately leading to premature termination of translation ( Figure 1 in A). Observe the field phenotypes of the knockout and wild-type plants at the heading stage. It was found that compared with the wild-type, the agronomic traits of the knockout plants were not affected ( Figure 1 in B). We also detected the yield. In the case of not inoculating Magnaporthe oryzae, there were no differences in the tiller number, seed setting rate, number of grains per panicle and 1000-grain weight between the ospi4k knockout plants and the wild-type. The above data prove that the ospi4k knockout plants did not affect the rice yield, laying a foundation for the application of the OsPI4K gene.

[0076] Example 3. Obtaining of OsPI4K gene overexpression plants

[0077] First, construct the recombinant expression vector pCAMBIA1305-Ubi-OsPI4K. Design the forward primer 5’- atagagctc GTGCAGCGTGACCCGGT-3’ (the underlined part is the Sac I site) and the reverse primer 5’- ataggatccAAGTAACACCAAACAACAGGGT-3’ (the underlined part is the Bam HI site). Using the binary vector pUbiGUSPlus (Prutin Biotechnology (Beijing) Co., Ltd.) as a template, the ubiquitin promoter was amplified. The PCR product was recovered and purified. Specifically, a small amount of agarose gel DNA recovery kit (Zhuangmeng Gel Mini Purification Kit; ZP202) was used for purification according to the product manual. The purified product was ligated to the pMD18-T simple (TaKaRa) vector and verified by sequencing. The plasmid with correct sequencing was double-digested with Sac I and Bam HI. After the digestion products were recovered, they were ligated into the Sac I and Bam HI double-digestion sites of the pCAMBIA1305 vector (Prutin Biotechnology (Beijing) Co., Ltd.) to obtain pCAMBIA1305-Ubi, which contains the ubiquitin promoter, hygromycin selection gene, N-terminal 3-HA tag, and other necessary components. According to the vector sequence, a pair of amplification primers containing vector homologous arms was designed, and the open reading frame sequence of the OsPI4K gene was amplified from Nipponbare rice cDNA using the amplification primers. The primer sequences are as follows: (the underlined part is the vector homologous arm)

[0078] Ubi-3HA-57300-F (SEQ ID NO.8):

[0079] 5’- CCAGATTACGCTTCTAAGCTT ATGTCGCCCAATCTGGAG-3’

[0080] Ubi-3HA-57300-R (SEQ ID NO.9):

[0081] 5’- GTCTTTGTAGTCAGAAAGCTT TCAAAACTTGCAGGAAGT-3’

[0082] The PCR amplification product was obtained by a recovery and purification process to acquire the OsPI4K gene fragment. The pCAMBIA1305-Ubi vector was cut with the restriction enzyme Hind III (Takara). The specific enzyme digestion system was as follows: Hind III: 1 μl; 10× buffer: 3 μl; pCAMBIA1305-Ubi (100 μg / μl): 10 μl; ddH2O: 16 μl. After reacting at 37°C for 5 hours, the vector was recovered and purified. The purification was specifically carried out using a small amount of agarose gel DNA recovery kit (Zhuangmeng Gel Mini Purification Kit; ZP202) according to the product manual. The above two were subjected to homologous recombination by a homologous recombinase (Novizan Biotech Co., Ltd., Nanjing). The specific homologous recombination system was: homologous recombinase: 1 μl; 5× buffer: 2 μl; linearized pCAMBIA1305-Ubi vector: 1 μl; OsPI4K gene fragment: 2 μl; ddH2O: 4 μl. After reacting at 37°C for 0.5 hours, the ligation product was transformed into Escherichia coli competent cells DH5α to obtain an Escherichia coli strain containing the recombinant plasmid. The plasmid was extracted using a plasmid extraction kit (Zhuangmeng; ZP101) according to the instructions. After the plasmid was sequenced, sequence alignment was performed. After the sequencing was correct, the recombinant expression vector pCAMBIA1305-Ubi-OsPI4K containing the OsPI4K gene was obtained.

[0083] Then, the recombinant expression vector pCAMBIA1305-Ubi-OsPI4K constructed in the above steps was introduced into the embryogenic callus of the rice variety Nipponbare (Oryza sativa L. cv. Nipponbare) through the Agrobacterium strain EHA105 (Zhuangmeng; ZK294). The transformed callus was screened and differentiated to obtain multiple candidate lines. The genomic DNA of the transgenic rice was extracted using the method in Example 3, and the following primers were used to detect the hygromycin phosphotransferase gene (HPTII) fragment in the transgenic rice.

[0084] JDOE-F (SEQ ID NO.10): 5’-GCTGCGCCGATGGTTTCTACAA-3’

[0085] JDOE-R (SEQ ID NO.11): 5’-CACGGCCTCCAGAAGAAGATGTTG-3’

[0086] The PCR amplification product with a fragment of 514 bp was the transgenic positive plant. Through the above PCR preliminary identification, a total of ten transgenic lines, namely OE-1 to OE-10, were identified.

[0087] To further verify the correctness of the overexpression lines, we also analyzed the transcriptional level of OsPI4K in the overexpression lines. Using the obtained T0 generation transgenic OsPI4K rice lines and the wild-type rice Nipponbare as materials, fluorescence quantitative PCR analysis was performed with the ACTIN1 gene as the internal reference. The specific steps are as follows: Take 100 mg of fully expanded leaves from the same part of the overexpression plants and wild-type Nipponbare rice, and use the magnetic bead method for fragmentation. The fragmented tissue samples are extracted for total RNA using the Trizol reagent method (Invitrogen), reverse transcribed using MMLV reverse transcriptase (TaKaRa) with reference to the instruction manual, and then quantitative detection is performed using real-time fluorescence quantitative PCR technology according to the manufacturer's (TaKaRa) instruction manual. The specific reaction system is as follows: Fluorescence quantitative PCR mix: 10 μl; primer-F: 0.5 μl; primer-R: 0.5 μl; ddH 2 O: 8 μl; reverse transcription product: 1 μl. The transcriptional expression of the OsPI4K gene was detected using a fluorescence quantitative PCR instrument (ABI 7500, USA). The specific primer sequences are shown below. The experiment was set with three replicates. Data processing was performed using the comparative Ct method, that is, the Ct value is the number of cycles experienced when the fluorescence signal in the PCR tube reaches the set threshold, ΔCt = Ct (test gene) - Ct (internal reference gene), and the 2 -ΔCt value was used to measure the transcriptional level of the gene.

[0088] qRTOsPI4K-F (SEQ ID NO.12): 5’-ATGTCGCCCAATCTGGAG-3’

[0089] qRTOsPI4K-R (SEQ ID NO.13): 5’-CACCGTGTGCGCGTTGTCG-3’

[0090] qRTOsACTIN-F (SEQ ID NO.14): 5’-CTTCATAGGAATGGAAGCTGCGGGTA-3’

[0091] qRTOsACTIN-R (SEQ ID NO.15): 5’-CGACCACCTTGATCTTCATGCTGCTA-3’

[0092] The experiment found that the transcriptional levels of the OsPI4K gene in a total of ten lines from OE-1 to OE-10 were all significantly increased. We selected two rice lines, OE-1 and OE-2, for downstream experiments. As can be seen from Figure 5 Figure A: Compared with the wild-type rice variety Nipponbare, the transcriptional levels of the OsPI4K gene in the OsPI4K overexpression rice lines OE-1 and OE-2 were both significantly increased.

[0093] Example 4, Scratching and Inoculating Rice Leaves and Phenotypic Identification

[0094] To determine the resistance of the above-mentioned rice lines to rice blast, we used the method of scratching and inoculating rice leaves for detection. First, the wild-type rice Nipponbare and the ospi4k knockout lines ospi4k-4 and ospi4k-12, as well as the OsPI4K overexpressing rice lines OE-1 and OE-2, were cultured in the greenhouse for 3 weeks until the four-leaf and one-heart stage, and fully expanded leaves at the same position were scratched. At the same time, Magnaporthe oryzae was cultured on artificial medium. The Magnaporthe oryzae used in this experiment was the wild-type strain P131, which was cultured and sporulated on OTA medium (150 ml tomato juice, 40 g oats, 20 g agar powder, 0.6 g calcium carbonate, ddH 2 O made up to 1000 ml), and the conidia were washed with 0.25% Tween water and filtered. The rice blast spore solution was diluted to 1×10 5 cells / mL using a hemocytometer. Each rice leaf to be tested was scratched at three positions: upper, middle, and lower with an inoculation needle, and 10 μl of the above spore solution was pipetted onto each scratched point. After the inoculated leaves were cultured in the dark with humidity at 28°C for 24 hours, they were transferred to normal light conditions for continued culture. The disease incidence of different rice leaves was compared 4 days after inoculation. The inoculation results of the wild-type rice and the ospi4k knockout are shown in Figure 2 A. The diseased area of the ospi4k knockout leaves was significantly smaller than that of the wild-type rice, indicating that the knockout mutation of the OsPI4K gene could significantly enhance the resistance of rice to rice blast; compared with the wild-type, the overexpressing plants had more severe disease, and the results are shown in Figure 5 B.

[0095] To further quantitatively identify the disease incidence of rice leaves, we used the software ImageJ to measure the lesion area, and the specific method referred to the software usage tutorial. The results are shown in Figure 2 B and Figure 5 C. Compared with the wild-type rice leaves, the diseased area of the ospi4k knockout leaves was significantly reduced, while the diseased area of the OsPI4K gene overexpressing lines was significantly increased. We further detected the biomass of the pathogen. The DNA extraction and fluorescence quantitative PCR methods of the inoculated leaves were as described in the above examples. The data was processed using the comparative Ct method, and the biomass calculation formula was 2 [CT(OsUbq)-CT(MoPot2)] . Where MoPot2 and OsUBQ are the genes of Magnaporthe oryzae and rice respectively, and the specific primer sequences are as follows:

[0096] q-MoPot2-F (SEQ ID NO.16): ACGACCCGTCTTTACTTATTTGG

[0097] q-MoPot2-R (SEQ ID NO.17): AAGTAGCGTTGGTTTTGTTGGAT

[0098] q-OsUBQ-F (SEQ ID NO.18): TTCTGGTCCTTCCACTTTCAG

[0099] q-OsUBQ-R (SEQ ID NO.19): ACGATTGATTTAACCAGTCCATGA

[0100] The results are as Figure 2 shown in C and Figure 5 shown in D. Compared with wild-type rice, the biomass of Magnaporthe oryzae on the leaves of ospi4k knockout rice was significantly lower than that on the leaves of wild-type rice after inoculation, while the biomass of Magnaporthe oryzae on the leaves of the overexpression lines of the OsPI4K gene was significantly higher than that of the wild-type after inoculation. These experimental results further confirmed that the OsPI4K gene plays a negative regulatory role in the process of rice resistance to Magnaporthe oryzae.

[0101] Example 5, Evaluation of the resistance of ospi4k knockout rice to Magnaporthe oryzae in the field

[0102] During the growth of rice in the field, it is affected by various biotic and abiotic stresses, and the genotypes of different Magnaporthe oryzae races in nature are also complex and diverse. Therefore, compared with inoculating Magnaporthe oryzae in the laboratory, the resistance of rice to Magnaporthe oryzae in the field can better reflect the real level. Thus, in addition to inoculating the ospi4k knockout rice in the laboratory, we also detected the resistance of the ospi4k knockout to Magnaporthe oryzae in the disease nursery in the field. Disease investigation and photographing and sampling were carried out at the heading stage of rice. The results are as Figure 3 shown in A. The number and area of lesions of the ospi4k knockout were significantly smaller than those of the wild-type leaves. Further, we investigated the disease index of different rice lines. According to the leaf lesion area and the number of lesions, the disease grade of the leaves was divided into 1-8 levels. The formula for calculating the disease index is: [Sum of the disease grades of each tiller / (Sum of the number of tillers × highest disease grade)] × 100%. Through investigation and calculation, it was found that the disease index of the ospi4k knockout rice was significantly lower than that of the wild-type rice ( Figure 3 shown in B).

[0103] Example 6, Detection of the expression levels of disease resistance-related genes in ospi4k knockout rice

[0104] The fluorescence quantitative PCR method was used to analyze the expression levels of 6 disease resistance-related genes in the mutant ospi4k and the wild-type rice Nipponbare. The specific method was as follows: Using 1×10 5Spray inoculate the mutant ospi4k and the wild-type rice Nipponbare with 1×10⁶ conidia / mL of Magnaporthe oryzae. After 18 h of inoculation, take 100 mg of rice leaves each, extract total RNA using the method in Example 3 and perform reverse transcription. Using the reverse transcription product as a template, perform quantitative PCR with the rice ACTIN1 gene as an internal reference. The primer sequences are shown in Table 1 below. The experiment is set with three replicates. Data processing is the same as in Example 3 above.

[0105] Table 1. Primers for disease resistance-related genes

[0106]

[0107]

[0108] The results are as Figure 4 shown: Compared with the wild type, the expression levels of the genes OsPR1a, PR2, OsPR3, OsPR5, OsPR10, and OsWRKY62 related to plant disease resistance were significantly up-regulated in the ospi4k knockout rice. The above results indicate that the increased resistance of ospi4k knockout rice to Magnaporthe oryzae may be caused by up-regulating the expression of disease resistance-related genes.

[0109] The above are only the preferred embodiments of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention shall fall within the scope of the present invention.

Claims

1. An anti - Magnaporthe oryzae - related protein, whose amino acid sequence is shown in SEQ ID NO.

2.

2. The coding gene of the anti - Magnaporthe oryzae - related protein according to claim 1.

3. The coding gene according to claim 2, characterized in that, the coding gene is the cDNA molecule or DNA molecule shown in sequence 1 in the sequence listing.

4. The application of knocking out the coding gene of the anti - Magnaporthe oryzae - related protein according to claim 1 in improving the disease resistance of rice to Magnaporthe oryzae.

5. The application of the biological material related to the anti - Magnaporthe oryzae - related protein described in claim 1 in regulating the disease resistance of rice to Magnaporthe oryzae; the biological material is the following B1) or B2): B1) A nucleic acid molecule that inhibits the expression of the coding gene of the anti - Magnaporthe oryzae - related protein described in claim 1; B2) An expression cassette, a recombinant vector, a recombinant microorganism containing the nucleic acid molecule described in B1).

6. The application of the anti - Magnaporthe oryzae - related protein described in claim 1 or its coding gene as a target for screening pesticides against Magnaporthe oryzae.

7. A method for cultivating a disease - resistant transgenic plant, comprising: Inhibiting the expression of the coding gene of the anti - Magnaporthe oryzae - related protein described in claim 1 in the target plant to obtain a disease - resistant transgenic plant with higher disease resistance than the target plant; the target plant is rice; the disease resistance is Magnaporthe oryzae resistance.

Images