Wild strains and mutants with high production of T-2 toxin and their uses

Abstract

The present application discloses a wild strain, mutant strain and its use of a high-yield T2 toxin, the classification name of the wild strain is Fusarium sporotrichioides, the strain number is Fsp1, and the deposit number is CCTCC NO: M 2023693; the mutant strain is a gp2 gene deletion mutant of the wild strain. The present application is based on the screened Fusarium sporotrichioides Fsp1 with a complete synthetic gene cluster of T-2 toxin as a receptor strain, and a knockout box of a negative regulatory element gp2 is constructed by gene-targeted modification, and a gp2 deletion mutant strain (△Fspgp2) of a high-yield T-2 toxin is constructed. In the toxin-producing induced rice culture medium, the T-2 toxin yield of △Fspgp2 is 14.6 times higher than that of the wild-type strain Fsp1, with a yield of 422mg / kg, which can be used for macro-preparation and purification of T-2 toxin.

Description

Technical Field

[0001] The present invention belongs to the field of applied microorganisms, and in particular relates to a method for screening a strain capable of synthesizing T-2 toxin and constructing a high-yield mutant strain and application thereof. Background Art

[0002] Trichothecenes are toxic secondary metabolites produced by toxin-producing fungi. They contaminate a variety of crops, including wheat and corn, threatening food security and human and animal health. Toxicological studies have found that of the over 190 trichothecenes reported to date, T-2 toxin is the most cytotoxic and is classified as a Category 3 carcinogen by the World Health Organization's International Agency for Research on Cancer. Exposure to T-2 toxin can cause a variety of acute and chronic poisonings, induce apoptosis of immune system cells, cause fetal lethality, and trigger leukemia. T-2 toxin also has various derivative metabolites, such as HT-2, T-2-Glu, and HT-2-Glu. T-2 toxin contamination is widespread, with reports of contamination in corn, wheat, oats, and other grains in many countries worldwide, posing a significant threat to human and animal health. Given the high toxicity and severity of T-2 toxin and its derivatives, 13 countries have established limits for T-2 and HT-2 toxin contamination in food and feed (25-1000 μg / kg), with a daily exposure limit of 20 ng / kg body weight per day. Genomic studies have shown that T-2 toxin is primarily produced by Fusarium spp., and some Fusarium species contain complete T-2 toxin synthesis gene clusters in their genomes. TRI16 The integrity of the gene determines whether Fusarium has the ability to biosynthesize T-2 toxin.

[0003] T-2 toxin is very stable in the environment and is difficult to completely remove even under high temperatures or ultraviolet radiation. Therefore, the development of early warning monitoring and pollution blocking technologies is the most effective technical means to reduce toxin pollution. The development and application of precise and rapid mycotoxin monitoring technologies require toxin standard substances to provide a basis for traceability; the development of efficient toxin prevention and control technologies such as the biodegradation of contaminated grains also requires a large amount of pure toxin products. At present, domestic agricultural product quality risk monitoring and R&D institutions mainly rely on foreign imports for toxin standard substances, which have long delivery times and are expensive. The price of 1 mg of T-2 toxin is about 50,000 RMB. T-2 toxin is mainly extracted from the culture of certain toxin-producing Fusarium spp., and the yield is very low.

[0004] Therefore, screening and obtaining high-yield T-2 toxin strain resources through genetic modification, and constructing T-2 toxin large-scale preparation and purification technology based on high-yield toxin strains to achieve the localization of T-2 toxin standard substances are of great significance for the research and development of continuous monitoring and control technologies for the risk of food fungal toxin contamination. Summary of the Invention

[0005] The present application provides a method for constructing a wild strain of Fusarium sporotrichioides with high T-2 toxin production and its mutants and their uses, which can be used for the large-scale preparation and purification of T-2 toxin and realize the localization of pure T-2 toxin. It is of great significance for the research and development of continuous monitoring and control technology for the risk of mycotoxin contamination in grains and has broad application prospects.

[0006] On the one hand, the present application utilizes the toxin-producing fungal strain resource base established by the unit to screen out a strain of Fusarium sporeans with a complete gene cluster for T-2 toxin biosynthesis. F. sporotrichioides strain Fsp1, and the key genes of its toxin-producing gene cluster TRI16 The strain Fsp1 was deposited in the China Center for Type Culture Collection (CCTCC) with the accession number CCTCC NO: M 2023693 and the deposit date was May 6, 2023.

[0007] Morphological characteristics of the wild-type T-2 toxin-producing strain Fsp1 grown on PDA medium for 3 days: red colonies, dense cotton-like hyphae, and a large number of aerial hyphae.

[0008] The key synthetic gene of T-2 toxin was amplified by the identification primers shown in SEQ ID NO: 1-2. TRI16 (C-8 acyltransferase encoding gene, GenBank accession number AY187275), and sequencing and comparison confirmed that strain Fsp1 has the key gene for T-2 toxin biosynthesis TRI16 .

[0009] On the other hand, the present application identified an element regulating the biosynthesis of T-2 toxin in Fusarium sporogons gp2 This gene encodes a heterotrimeric G protein that can negatively regulate the biosynthesis of T-2 toxin. Then, based on the screened Fusarium sporotrichioides Fsp1 with a complete T-2 toxin synthesis gene cluster as the receptor strain, gene-targeted modification was used to construct a negative regulatory element. gp2 The knockout box was used to construct a high-yield T-2 toxin gp2 The deletion mutant strain (△Fspgp2) showed a 14.6-fold increase in T-2 toxin production compared to the wild-type strain Fsp1 in toxin-inducing rice culture medium, reaching a yield of 422 mg / kg.

[0010] Based on this, the present invention proposes the following application:

[0011] The present invention provides a wild strain with high T-2 toxin production, which is classified and named as Fusarium sporotrichioides Fusarium sporotrichioides , the strain number is Fsp1, and the deposit number is CCTCC M 2023693.

[0012] The present invention also provides a mutant strain with high yield of T-2 toxin, which is a wild strain. gp2 Gene deletion mutants.

[0013] Optional, gp2 The nucleotide sequence of the gene is shown in SEQ ID NO:3.

[0014] Optionally, the mutant is: gp2 The gene knockout cassette is transformed into the protoplasts of the wild strain as claimed in claim 1 and the resulting resistant transformants are screened.

[0015] Optionally, the gp2 Gene knockout cassettes include gp2 The upstream fragment of the gene coding region gp2-5', gp2 Downstream fragment of gene coding region gp2-3' and selection marker gene NEO , gp2 The upstream fragment of the gene coding region gp2-5', gp2 The downstream fragments of the gene coding region gp2-3' were connected to the selection marker gene NEO Both sides.

[0016] Optionally, the gp2 The nucleotide sequence of the upstream fragment gp2-5' of the gene coding region is shown in SEQ ID NO: 4; p2 The nucleotide sequence of the downstream fragment gp2-3' of the gene coding region is shown in SEQ ID NO: 5; the screening marker gene NEO The nucleotide sequence is shown in SEQ ID NO: 6.

[0017] The present invention also provides a method for constructing the mutant strain, comprising:

[0018] (1) Identification of regulatory genes gp2 Gene: A regulatory gene whose nucleotide sequence is shown in SEQ ID NO: 3 and can negatively regulate the biosynthesis of T-2 toxin was identified from the wild strain. gp2 Gene;

[0019] (2) Construction gp2 Gene knockout cassette: described gp2 Gene knockout cassettes include gp2 The upstream fragment of the gene coding region gp2-5', gp2 Downstream fragment of gene coding region gp2-3' and selection marker gene NEO , gp2 The upstream fragment of the gene coding region gp2-5', gp2 The downstream fragments of the gene coding region gp2-3' were connected to the selection marker gene NEOBoth sides;

[0020] (3) Transformation and screening: gp2 The gene knockout cassette was transformed into the protoplasm of the wild strain and screened. gp2 The transformants with in situ gene replacement are obtained.

[0021] In step (1):

[0022] First, the key synthetic gene of T-2 toxin was amplified by PCR from 78 strains of 12 Fusarium species preserved in the laboratory. TRI16 Using mass spectrometry, we screened and obtained three strains of Fusarium sporotrichioides that have a complete T-2 toxin synthesis gene cluster and can synthesize T-2 toxin. Fusarium sporotrichioides strains, and the strain with the highest virulence production, Fsp1, was selected, with the accession number being CCTCC M 2023693;

[0023] Comparative genomics and bioinformatics predictions were then used to identify an element that negatively regulates T-2 toxin biosynthesis. gp2 The gene encodes a heterotrimeric G protein, and the nucleotide sequence was identified as shown in SEQ ID NO: 3 gp2 Gene.

[0024] Optionally, primers for amplifying the key toxin-producing gene TRI16 of T-2 toxin are shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0025] In step (2):

[0026] Optional, build gp2 Gene knockout methods include:

[0027] Using double fusion PCR, the gp2 Gene knockout cassettes include gp2 The upstream fragment of the gene coding region gp2-5' and gp2 The downstream fragment of the gene coding region gp2-3' is connected to NEO On both sides of the gene, forming gp2 Gene knockout cassette ΔFspgp2 (gp2-5'-neo- gp2-3').

[0028] Optionally, the gp2 The nucleotide sequence of the upstream fragment gp2-5' of the gene coding region is shown in SEQ ID NO: 4; p2 The nucleotide sequence of the downstream fragment gp2-3' of the gene coding region is shown in SEQ ID NO: 5; the screening marker gene NEO The nucleotide sequence is shown in SEQ ID NO: 6.

[0029] Optionally, the gp2 The primers for amplifying the upstream fragment gp2-5' of the gene coding region are shown in SEQ ID NO: 7 and SEQ ID NO: 8.

[0030] Optionally, the p2 The primers for amplifying the downstream fragment gp2-3' of the gene coding region are shown in SEQ ID NO: 9 and SEQ ID NO: 10.

[0031] Optional, selection marker gene NEO The amplification primers are shown in SEQ ID NO: 11 and SEQ ID NO: 12.

[0032] Alternatively, primers SEQ ID NO: 13 and SEQ ID NO: 14 are designed to amplify gp2 Gene knockout cassette (gp2-5'-neo- gp2-3').

[0033] In step (3):

[0034] Optionally, the gp2 The gene knockout cassette was transformed into the protoplasts of the wild strain by polyethylene glycol (PEG)-mediated fungal protoplast transformation.

[0035] Furthermore, after transformation, G418 sulfate is added to screen resistant transformants, the genomic DNA of the transformants is extracted, and PCR identification is performed to obtain in situ replacement transformants of the target gene. After toxin production verification, the high-yield T-2 toxin mutant strain is obtained.

[0036] Alternatively, the primer sequences for PCR identification are shown in SEQ ID NO: 15 and SEQ ID NO: 16.

[0037] The present application also provides the use of wild strains or mutant strains in the preparation of T-2 toxin.

[0038] The present invention also provides a method for macro-scale preparation of T-2 toxin, comprising:

[0039] (1) Activating the wild strain according to claim 1 or the mutant strain according to claim 2 on a potato culture medium plate (PDA);

[0040] (2) Take the activated bacterial block and inoculate it into rice culture medium, culture it in the dark at 25-30°C for 20-25 days;

[0041] (3) The rice culture was collected and dried, and the T-2 toxin was extracted after grinding.

[0042] Further preferably, the method for macro-production of T-2 toxin comprises:

[0043] (1) Activating the wild strain according to claim 1 or the mutant strain according to claim 2 on a potato culture medium plate (PDA) and culturing at 25°C under light for 3 days;

[0044] (2) Take a 5 mm bacterial block and inoculate it into rice culture medium, and culture it in the dark at 28°C for 20-25 days;

[0045] (3) After the culture was dried and ground, it was extracted with a 50% acetonitrile aqueous solution containing 1% formic acid, and the T-2 toxin was purified using high performance liquid countercurrent chromatography to prepare a pure solution.

[0046] A gene encoding a heterotrimeric G protein gp2 , whose nucleotide sequence is shown in SEQ ID NO: 3.

[0047] A sort of gp2 Gene knockout cassettes, including gp2 The upstream fragment of the gene coding region gp2-5', gp2 Downstream fragment of gene coding region gp2-3' and selection marker gene NEO , gp2 The upstream fragment of the gene coding region gp2-5', gp2 The downstream fragments of the gene coding region gp2-3' were connected to the selection marker gene NEO Both sides.

[0048] Optionally, the gp2 The nucleotide sequence of the upstream fragment gp2-5' of the gene coding region is shown in SEQ ID NO:4.

[0049] Optionally, the p2 The nucleotide sequence of the downstream fragment gp2-3' of the gene coding region is shown in SEQ ID NO: 5.

[0050] Optionally, the screening marker gene NEO The nucleotide sequence is shown in SEQ ID NO: 6.

[0051] described gp2 Methods for constructing gene knockout cassettes include:

[0052] Double fusion PCR was used to connect the upstream fragment (gp2-5') and the downstream fragment (gp2-3') of the gene coding region to NEO On both sides of the gene, forming gp2 Gene knockout cassette (gp2-5'-neo- gp2-3').

[0053] A heterotrimeric G protein encoding gene gp2 or gp2 Gene knockout cassette negatively regulates Fusarium sporogonyFusarium sporotrichioides Use in the production of T-2 toxin.

[0054] Compared with the prior art, the present invention has achieved at least one of the following beneficial technical effects:

[0055] (1) Screening and obtaining the wild-type T-2 toxin-producing strain Fsp1 from natural sources in my country;

[0056] (2) The wild-type strain Fsp1 has a toxicity of 28.9 mg / kg, which is significantly higher than that of other T-2 toxin-producing Fusarium species.

[0057] (3) Using bioinformatics and alignment, we predicted and identified a negative regulatory element for T-2 toxin synthesis from the wild-type strain Fsp1. gp2 ;

[0058] (4) Construction using genetic modification gp2 The gene knockout cassette was transformed into the Fsp1 strain, and the in situ replacement knockout mutant △Fspgp2 was obtained by screening;

[0059] (5) A method for mass production of T-2 toxin was established, with a yield of 422 mg / kg rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1 Key genes for T-2 toxin synthesis TRI16 Electrophoresis diagram of PCR identification.

[0061] Figure 2 Figure 2 shows the colony morphology of the Fsp1 strain and the △Fspgp2 knockout mutant.

[0062] Figure 3 Negative regulatory gene for T-2 toxin biosynthesis gp2 Schematic diagram of the knockout vector construction method.

[0063] Figure 4 This is the electrophoresis diagram of PCR identification of △Fspgp2 transformants.

[0064] Figure 5 The graph shows the T-2 toxin production results of the wild-type strain Fsp1 and the knockout mutant strain △Fspgp2. DETAILED DESCRIPTION

[0065] The following will be combined with the drawings in the embodiments of this application to clearly and completely describe the technical solutions in the embodiments of this application. Obviously, the embodiments described are only part of the embodiments of this application, not all of the embodiments. Based on the embodiments in this application, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of this application.

[0066] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this application pertains. The terms used herein in the specification of this application are for the purpose of describing specific embodiments only and are not intended to limit this application.

[0067] The technical problems to be solved by the present invention mainly include: (1) screening a toxin-producing microbial strain resource with a complete T-2 toxin biosynthesis gene cluster; (2) using bioinformatics prediction to identify the regulatory genes of T-2 toxin biosynthesis; (3) using gene homologous recombination to construct targeted knockout mutants of regulatory genes and establish a large-scale preparation technology of T-2 toxin.

[0068] The technical solution of the present invention to solve the above technical problems mainly includes the following aspects:

[0069] (1) Screening of wild strains producing T-2 toxin: Obtaining Fusarium sporotrichioides through screening of key toxin-producing genes and mass spectrometry chemical analysis Fusarium sporotrichioides Strain Fsp1 (CCTCC M 2023693). This study measured the T-2 toxin production of 78 strains from 12 Fusarium species and screened out three Fusarium strains capable of synthesizing T-2 toxin, of which strain Fsp1 had the highest toxin production (28.9 mg / kg).

[0070] (2) Identification of negative regulatory genes of T-2 toxin gp2 And construct targeted knockout mutants: using comparative genomics analysis and bioinformatics prediction, identify the negative regulatory element of T-2 toxin biosynthesis, encoding a heterotrimeric G protein, which is predicted to negatively regulate the biosynthesis of T-2 toxin.

[0071] By double fusion PCR method, gp2 Gene knockout cassette gp2 The 5' sequence and 3' sequence of the gene are connected to the selection marker gene NEO The left and right wings of gp2 The gene knockout cassette was transformed into the wild-type strain Fsp1, and resistant transformants were screened. After purification of single spores of the transformants, fresh mycelium was collected on PDA medium, and genomic DNA was extracted using a kit. PCR was used to identify and screen the knockout mutant ΔFspgp2 that had undergone in situ gene replacement.

[0072] (3) Establishment of a large-scale production technology for T-2 toxin: △Fspgp2 was inoculated into a rice toxin-producing culture medium and cultured in the dark at 28°C for 21 days. The culture was dried and ground into powder for extraction, purification, and content detection. The T-2 toxin was extracted using a 50% acetonitrile aqueous solution containing 1% formic acid and purified using a QuEchERS solid-phase extraction column. The T-2 toxin content was then determined using high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS / MS).

[0073] The following is described with specific examples:

[0074] The culture medium types or formulations used in the following examples are as follows:

[0075] PDA medium (BD Biosciences, catalog number 213400), rice (long-grain indica rice) medium (20 g long-grain rice, added to a 150 ml conical flask, 6 ml deionized water, allowed to stand for 4 h, sterilized at 121°C for 60 min, removed and shaken, and sterilized again at 121°C for 60 min), hypertonic recovery medium RM (1 g hydrolyzed casein, 0.5 g yeast extract, 274 g sucrose, dilute to 1 L with deionized water, pH = 7.0, sterilized at 115°C for 30 min), QuEchERS solid-phase extraction cartridge (CNW dSPE cleanup Tube, SBEQ-CA8805-H), genomic DNA extraction kit (AxyPrep TM Multisource Genomic DNA MiniprepKit).

[0076] Example 1: Screening of wild strains producing T-2 toxin

[0077] Seventy-eight strains of Fusarium from 12 different species were activated on PDA medium and cultured at 25°C for three days. Five bacterial plugs approximately 5 mm in diameter were then inoculated into 30 g of rice culture medium and cultured in the dark at 28°C for 21 days. Five grams of the dried, ground culture was purified using a 50% acetonitrile-water solution (containing 1% formic acid) and a QuEchERS solid-phase extraction column. After reconstitution, the T-2 toxin content was determined using high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS / MS).

[0078] HPLC-MS / MS conditions were:

[0079] Chromatographic conditions: Column: Agilent XDB C18, 3.5 μm, 2.1×150 mm, flow rate: 0.4 ml / min; injection volume: 3 μl; column temperature: 40°C; gradient elution conditions: aqueous phase A: 0.1% formic acid in water (HPLC grade formic acid), organic phase B: pure methanol (HPLC grade); 0-0.5 min: 10% B; 0.5-2.0 min: 50% B; 2.0-4.0 min: 60% B; 4.0-5.00 min: 95% B; 5.0-8.0 min: 95%; 8.0-8.1 min: 10% B; 8.1-10 min: 10% B; Mass spectrometry conditions: ionization mode: electrospray ionization source (ESI+); scanning mode: multiple reaction monitoring (MRM); ionization source temperature: 600°C; nebulizer gas: 55 psi; auxiliary gas: 60 psi; curtain gas: 30 psi; spray voltage: 5500 V (ESI+); collision cell ejection voltage: 50 V (ESI+);

[0080] The detection mass spectrometry parameters were as follows: retention time 6.15 min; parent ion (m / z) 484.10; product ion (m / z) 215.2; declustering voltage (V) 50; collision energy (eV) 29 / 31.

[0081] The results of mass spectrometry chemical analysis showed that the 8 strains of Fusarium sporotrichioides Fusarium sporotrichioides T-2 toxin was detectable in the culture, with a yield of 13.5-28.9 mg / kg rice. The results are shown in Table 1.

[0082] Table 1 T-2 toxin production by different Fusarium species

[0083]

[0084] Among the eight strains of Fusarium sporotrichioides, strain Fsp1 had the highest T-2 toxin production of 28.9 mg / kg.

[0085] The colony morphology of Fsp1 strain on PDA medium is as follows Figure 1 As shown, the colonies are white or pink with smooth edges and a large number of aerial hyphae.

[0086] The genomic DNA was extracted using the AxyPrep TM Multisource Genomic DNA Miniprep Kit) to extract Fusarium sporogons Fusarium sporotrichioides The mycelial genomic DNA was isolated and the primer pair shown in SEQ ID NO: 1 and SEQ ID NO: 2 was used to identify whether the strain genome contained a complete T-2 toxin synthesis gene. TRI16The PCR reaction system: in a 50 μl reaction system, contains 50 ng template DNA, 25 μl of 2 × Ex, and 1 μl of each primer (10 μM); PCR reaction program: 94°C for 5 minutes; 94°C for 30 seconds, 53°C for 30 seconds, 72°C for 60 seconds, for a total of 32 cycles; 72°C for 10 minutes; after the PCR reaction is completed, the products are subjected to 1% agarose gel electrophoresis.

[0087] SEQ ID NO:1GCCCTTTCTAGATGCCTGAG

[0088] SEQ ID NO:2 TTGGTTGCCTCCGTCTTGG

[0089] PCR identification results Figure 1 As shown, T-2 toxin-producing Fusarium sporogons Fusarium sporotrichioides Can be expanded to TRI16 Gene fragment.

[0090] Fusarium sporogony Fusarium sporotrichioides The strain (strain number Fsp1) was deposited in the China Center for Type Culture Collection (CCTCC) with the accession number CCTCC M 2023693.

[0091] The wild-type strain Fsp1 screened in the present invention has a toxin production capacity of 28.9 mg / kg. The literature (Blesa, J; Meca, G; Rubert, J; Soriano, JM; Ritieni, A; Maes, J; Glucose influence on the production of T-2 toxin by Fusarium sporotrichioides, Toxicon, 2010, 55(6):1157-1161.) reported a strain of Fusarium sporotrichioides that produces T-2 toxin, and the yield under optimal culture conditions was only 1.45 mg / kg.

[0092] Example 2: Identification of T-2 toxin negative regulatory genes gp2 and construct targeted knockout mutants

[0093] Identification of negative regulatory elements of T-2 toxin biosynthesis using bioinformatics prediction gp2 , NCBI accession number is JAHKNS010000002 REGION: 1929860..1931280. gp2The gene encodes a heterotrimeric G protein, the gene sequence is shown in SEQ ID NO: 3, and the nucleotide sequences of the upstream and downstream flanking fragments gp2-5' and gp2-3' of the gene are shown in SEQ ID NO: 4-5.

[0094] >SEQ ID NO:3

[0095] ATGTAA

[0096] >SEQ ID NO:4

[0097]

[0098] >SEQ ID NO:5

[0099]

[0100] >SEQ ID NO:6

[0101]

[0102] Build gp2 The resistance screening marker used for the gene knockout mutant is the G418 sulfate resistance gene NEO (sequence shown in SEQ ID NO: 6), designed for construction gp2 The primers for gene knockout mutants are shown in SEQ ID NO: 7-14. gp2 The gene knockout cassette includes three rounds of PCR reactions.

[0103] First round PCR: Genomic DNA extraction kit (AxyPrep TM The genomic DNA of Fsp1 strain was extracted using Multisource Genomic DNA Miniprep Kit. The genomic DNA was used as the amplification template and primer pairs SEQ ID NO: 7-8 and SEQ ID NO: 9-10 were used to amplify the genomic DNA. gp2 The upstream fragment (gp2-5') and downstream fragment (gp2-3') of the gene coding region; using the pYF11-neo plasmid as a template, the primer pair SEQ ID NO: 11-12 was used to amplify the resistance selection marker gene NEO The PCR reaction system included 50 ng of template DNA, 25 μl of 2 × Ex, and 1 μl of each primer (10 μM) in a 50 μl reaction system. The PCR reaction procedure was as follows: 94°C for 5 minutes, 32 cycles of 94°C for 30 seconds, 53°C for 30 seconds, and 72°C for 60 seconds, and 72°C for 10 minutes. The PCR reaction products were subjected to 1% agarose gel electrophoresis, and the amplified products were purified and recovered.

[0104] Second-round PCR: Ligate the gp2-5', gp2-3', and NEO fragments in a 25 μl system containing 200 ng NEO fragment, 100 ng gp2-5' fragment, 100 ng gp2-3' fragment, and 2 × PrimeSTAR GXL DNA PolymeraseMix. PCR reaction program: 94°C for 3 minutes; 15 cycles of 94°C for 30 seconds, 54°C for 100 seconds, and 72°C for 240 seconds; and 72°C for 10 minutes.

[0105] Third-round PCR: Using the ligation reaction solution from the second-round PCR as a template, the knockout cassette gp2-5'-neo-gp2-3' was amplified using primer pair SEQ ID NO: 13-14. The 50 μl PCR reaction system contained 50 ng template DNA, 25 μl 2×PremixEx Taq Mix, and 1 μl of each primer (10 μM). The PCR reaction procedure was as follows: 94°C for 5 minutes, followed by 32 cycles of 94°C for 30 seconds, 53°C for 30 seconds, and 72°C for 180 seconds, and 72°C for 10 minutes. The PCR product was purified and recovered by gel tapping to obtain the knockout cassette gp2-5'-neo-gp2-3'.

[0106] SEQ ID NO:7GAAGTGGACAAAAAGGGTCG

[0107] SEQ ID NO:8 CCAAAATAGCATTGATGTGTTGACCTCCGACAGGAGAGATTAAACGAG

[0108] SEQ ID NO9: CTATCGCCTTCTTGACGAGTTCTTCTGACGTTCACGACCATGAAACTATT

[0109] SEQ ID NO:10AACTCCATACGCCTTTTCAAT

[0110] SEQ ID NO:11GGAGGTCAACACATCAATGCT

[0111] SEQ ID NO:12TCAGAAGAACTCGTCAAGAAG

[0112] SEQ ID NO:13CACTGTAAATGGATGGAGGG

[0113] SEQ ID NO:14TCCTTTGTTTCATTCGGGG

[0114] SEQ ID NO:15TCAATCCATCTACCATCCTC

[0115] SEQ ID NO:16GGCTGAAGAAAGTCGTCGGT

[0116] Example 3: ​ Construction and screening of knockout mutants

[0117] The knockout cassette gp2-5'-neo-gp2-3' was transformed into the wild-type strain Fsp1 using a polyethylene glycol (PEG)-mediated fungal protoplast transformation method, wherein the transformation method comprises the following steps:

[0118] Conidia collection: The wild-type strain Fsp1 was cultured in a conidial induction medium of mung bean soup for 4 days at 25°C, shaker at 180 rpm, and light. The conidia were filtered through sterile gauze, and the filtrate was concentrated by centrifugation (8000 rpm, 10 min) and the number of conidia was quantified. 5 Inoculate 50 ml of PDB (potato dextrose broth) culture medium with 10 spores and culture at 25°C, 180 rpm for 12 h to produce germlings.

[0119] Protoplast transformation: Collect the germlings by filtration through sterile gauze. Prepare the enzymatic solution using sterile 0.7 M NaCl solution (10 ml of 0.7 M NaCl solution containing 200 mg of Drislase and 100 mg of Yatalase) and filter through a 0.4 μm bacterial filter. Add approximately 100 mg of mycelial germlings to the enzyme solution. The enzyme reaction conditions are 30°C and a shaker at 100 rpm. After enzymatic hydrolysis for approximately 4 h, wash and concentrate the protoplasts with 0.7 M NaCl solution and STC solution, respectively. Subsequently, a transformation experiment was carried out. 1 ml of STC solution, 250 μl of SPTC solution, 10 μl of sodium heparin solution (10 mg / ml), and 50 μl of the purified DNA fragment of the knockout frame gp2-5'-neo- gp2-3' were added to the protoplast suspension. The mixture was mixed and placed on ice for 30 min. 150 μl of SPTC was added dropwise and the mixture was placed in the dark at room temperature for 20 min. 10 ml of RM liquid was slowly added and the mixture was incubated in the dark at 25°C and 100 rpm. After mycelium was formed, it was mixed with PDA medium containing 100 μg / mL G418 sulfate at approximately 45°C. After mixing, the mixture was poured onto a plate. After single colonies grew, they were activated one by one with a sterile toothpick and transferred to a PDA plate containing 100 μg / mL G418 sulfate for purification.

[0120] Transformant identification: Extract genomic DNA from transformants and screen using transformant identification primers (primer sequences are shown in SEQ ID NOs: 15-16). ​In situ replacement deletion mutants of the gene were generated. The PCR system was as follows: a 25 μl reaction system containing 50 ng template DNA, 25 μl of 2 × Ex, and 1 μl of each primer (10 μM). The PCR reaction program was: 94°C for 5 minutes; 94°C for 30 seconds, 53°C for 30 seconds, and 72°C for 90 seconds, for a total of 32 cycles; and 72°C for 10 minutes. Positive controls (second-round PCR reaction linker R2 and genomic DNA of the wild-type strain Fsp1) and negative controls were set up. PCR reaction products were subjected to 1.0% agarose gel electrophoresis, and the results were visualized and recorded using a gel imaging system. Using R2 as the positive template, an 1868-bp fragment was amplified, while using the genomic DNA of the wild-type Fsp1 strain as the positive template, a 1519-bp fragment was amplified. Gel imaging results showed that transformants numbered A4, A7, A8, A9, A10, and A11 amplified bands of the same size as the R2 positive control. ​ In situ replacement mutants of genes ( ​ ), the mutant △Fspgp2-A4 colony morphology was selected as ​ shown.

[0121] Example 4: Large-scale preparation technology of T-2 toxin based on ΔFspgp2-A4

[0122] 5 mm mycelial plugs of Fsp1 and △Fspgp2-A4 were inoculated into sterilized rice culture medium and cultured in a dark incubator at 28°C for 21 days. The culture was then collected, dried, ground into powder, and T-2 toxin was extracted.

[0123] The extraction, purification and determination methods of T-2 toxin in Example 1 were used. The test results showed that compared with the wild-type strain Fsp1, the mutant ΔFspgp2-A4 strain produced 421.98 mg / kg of T-2 toxin in rice culture medium, a significant increase of 14.6 times ( ​ ).

[0124] T-2 toxin was extracted and purified from the culture of the ΔFspgp2-A4 mutant strain using column chromatography, thin layer chromatography and countercurrent chromatography.

[0125] The above-described embodiments merely represent several implementation methods of the present application. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art could make various modifications and improvements without departing from the spirit of the present application, all of which fall within the scope of protection of the present application. Therefore, the scope of protection of the present patent application shall be determined by the appended claims.

Claims

1. A wild strain that produces high levels of T-2 toxin, characterized in that: The classification name is Fusarium sporotrichioides, the strain number is Fsp1, and the preservation number is CCTCC NO: M2023693.

2. A mutant strain that produces high levels of T-2 toxin, characterized in that: It is a gp2 gene deletion mutant of the wild strain as claimed in claim 1; the nucleotide sequence of the gp2 gene is shown in SEQ ID NO:

3.

3. The mutant strain according to claim 2, characterized in that The mutant strain is: a resistant transformant obtained by transforming the gp2 gene knockout frame into the protoplasts of the wild strain as claimed in claim 1 and then screening; The gp2 gene knockout frame includes the upstream fragment gp2-5' of the gp2 gene coding region, the downstream fragment gp2-3' of the gp2 gene coding region and the selection marker gene NEO, and the upstream fragment gp2-5' of the gp2 gene coding region and the downstream fragment gp2-3' of the gp2 gene coding region are respectively connected to both sides of the selection marker gene NEO.

4. The mutant strain according to claim 3, characterized in that The nucleotide sequence of the upstream fragment gp2-5' of the gp2 gene coding region is shown in SEQ ID NO: 4; the nucleotide sequence of the downstream fragment gp2-3' of the p2 gene coding region is shown in SEQ ID NO: 5; and the nucleotide sequence of the selection marker gene NEO is shown in SEQ ID NO:

6.

5. The method for constructing a mutant strain according to claim 2, characterized in that: include: (1) Identifying the regulatory gene gp2 gene: Identifying the regulatory gene gp2 gene having a nucleotide sequence as shown in SEQ ID NO: 3 that can negatively regulate the biosynthesis of T-2 toxin from the wild strain as described in claim 1; (2) constructing a gp2 gene knockout cassette: the gp2 gene knockout cassette comprises an upstream fragment gp2-5' of the gp2 gene coding region, a downstream fragment gp2-3' of the gp2 gene coding region and a selection marker gene NEO, wherein the upstream fragment gp2-5' of the gp2 gene coding region and the downstream fragment gp2-3' of the gp2 gene coding region are respectively connected to both sides of the selection marker gene NEO; (3) Transformation and screening: The gp2 gene knockout cassette is transformed into the wild strain as described in claim 1, and transformants with gp2 gene in situ replacement are screened to obtain the obtained product.

6. The construction method according to claim 5, characterized in that: The nucleotide sequence of the upstream fragment gp2-5' of the gp2 gene coding region is shown in SEQ ID NO: 4; the nucleotide sequence of the downstream fragment gp2-3' of the p2 gene coding region is shown in SEQ ID NO: 5; and the nucleotide sequence of the selection marker gene NEO is shown in SEQ ID NO:

6.

7. The construction method according to claim 5, characterized in that: The method for constructing the gp2 gene knockout cassette includes: Using double fusion PCR, the upstream fragment gp2-5' of the gp2 gene coding region and the downstream fragment gp2-3' of the gp2 gene coding region are connected to both sides of the NEO gene to form a gp2 gene knockout frame; The gp2 gene knockout cassette is transformed into the protoplasts of the wild strain by a polyethylene glycol (PEG)-mediated fungal protoplast transformation method.

8. Use of the wild strain according to claim 1 or the mutant strain according to claim 2 in the preparation of T-2 toxin.

9. A method for preparing T-2 toxin in large quantities, characterized in that: include: (1) activating the wild strain according to claim 1 or the mutant strain according to claim 2 on a potato culture medium plate PDA; (2) taking the activated bacterial block and inoculating it into a rice culture medium, culturing it in the dark at 25-30°C for 20-25 days; (3) The rice culture is collected and dried, ground into powder and the T-2 toxin is extracted.

Images