Applications and drugs of inhibitors of lncRNA LOC646762 expression

Abstract

The present application relates to the field of tumor molecular biology technology, and in particular to the application and medicine of an inhibitor of lncRNA LOC646762 expression. Specifically, it is an application of an inhibitor of lncRNA LOC646762 expression in the preparation of a drug for the prevention and / or treatment of renal cancer. Based on the fact that lncRNA LOC646762 is highly expressed in renal cancer and is associated with the prognosis of patients, further experiments have found that inhibiting the expression of lncRNA LOC646762 can significantly inhibit the metastasis and invasion of renal cell carcinoma in vitro. Therefore, the inhibitor of lncRNA LOC646762 expression can be used to prepare a drug for the prevention and / or treatment of renal cell carcinoma.

Description

Technical Field

[0001] The present application belongs to the technical field of tumor molecular biology, and in particular, relates to the application and medicine of an inhibitor of lncRNA LOC646762 expression. Background Art

[0002] Renal cancer is called renal cell carcinoma (RCC), which is a malignant tumor originating from the renal parenchyma urinary tubular epithelial system. Clear cell renal cell carcinoma (ccRCC) accounts for about 70% to 80% of all renal cancers. It is also one of the few malignant tumors that is not sensitive to radiotherapy, chemotherapy, immunotherapy, etc. Therefore, its treatment is mainly resection, including radical resection and partial resection. However, about one-third of patients with clear cell renal cell carcinoma will still experience metastasis or recurrence after surgery, and the prognosis of metastatic patients is poor. The effectiveness and prognosis of the treatment of clear cell renal cell carcinoma are often affected by the molecular characteristics of the tumor. Therefore, further research and development of safer and more effective biomarkers and therapeutic targets are urgently needed.

[0003] Long non-coding RNA (lncRNA) is longer than 200 nt and was previously thought to have no actual function in cells. However, in fact, less than 2% of protein-coding genes and most non-coding regulatory elements are transcribed into lncRNA. lncRNA plays an important role in a variety of biological processes and can affect biological behaviors such as cell proliferation through epigenetic regulation and intracellular signal transduction pathways. At present, lncRNA has been proven to be a key regulatory molecule for tumor metastasis and has become an important biomarker and clinical treatment target for tumors. However, the functions of most lncRNAs are unclear, so studying the functions and mechanisms of action of lncRNAs is still a hot topic and challenge in the current field of life sciences.

[0004] RNA interference (RNAi) technology is a molecular biological technology that inhibits gene expression. This technology is an RNA interference reaction caused by exogenous double-stranded RNA molecules. The mRNA of the target gene is broken down into small fragments in a RNA sequence-mediated manner, so that the specific gene cannot be translated into protein. With the continuous advancement of gene sequencing and targeted delivery technology in recent years, RNAi technology has been widely used in the treatment of various types of cancer, such as breast cancer, lung cancer, prostate cancer, etc. The successful application of RNAi technology requires a relatively clear understanding of the function of the target gene, but the types of LncRNA related to renal cancer are currently limited. Summary of the invention

[0005] The purpose of this application is to provide an application and a drug of an inhibitor of lncRNA LOC646762 expression, aiming to solve how to better prevent and / or treat renal cancer from the perspective of renal cancer-related LncRNA.

[0006] In order to achieve the above application purpose, the technical solution adopted in this application is as follows:

[0007] In a first aspect, an embodiment of the present application provides a use of an inhibitor of lncRNA LOC646762 expression in the preparation of a drug for preventing and / or treating renal cancer.

[0008] In one embodiment, the gene sequence of lncRNA LOC646762 is shown as SEQ ID No. 1; and / or, renal cancer includes at least one of renal clear cell carcinoma, renal chromophobe cell carcinoma and renal papillary cell carcinoma.

[0009] In one embodiment, the inhibitor comprises at least one of siRNA and shRNA.

[0010] In one embodiment, the sense strand targeting sequence of the siRNA includes at least one of the sequences shown in SEQ ID No. 2-6; and / or

[0011] The shRNA includes at least one of the sequences shown in SEQ ID No.7-8.

[0012] In a second aspect, the embodiments of the present application also provide a drug for preventing and / or treating renal cancer, comprising an inhibitor of lncRNA LOC646762 expression and a pharmaceutically acceptable carrier.

[0013] In one embodiment, the gene sequence of lncRNA LOC646762 is shown as SEQ ID No. 1; and / or, renal cancer includes at least one of renal clear cell carcinoma, renal chromophobe cell carcinoma and renal papillary cell carcinoma.

[0014] In one embodiment, the inhibitor comprises at least one of siRNA and shRNA; and / or

[0015] Vectors include viral vectors.

[0016] In one embodiment, the sense strand targeting sequence of the siRNA includes at least one of the sequences shown in SEQ ID No. 2-6; and / or

[0017] The shRNA includes at least one of the sequences shown in SEQ ID No.7-8.

[0018] In a third aspect, an embodiment of the present application provides a use of a quantitative detection reagent for lncRNA LOC646762 in the preparation of a kit for diagnosing and / or prognostic evaluation of renal cancer.

[0019] In one embodiment, the quantitative detection reagent includes primers for amplifying lncRNA LOC646762: SEQ ID No.9 and SEQ ID No.10; and / or,

[0020] Renal cancer includes at least one of renal clear cell carcinoma, renal chromophobe cell carcinoma, and renal papillary cell carcinoma.

[0021] The application provided in the first aspect of the present application is based on the fact that lncRNA LOC646762 is highly expressed in renal cancer and is associated with patient prognosis. Further experiments have found that by inhibiting the expression of lncRNA LOC646762, the metastasis and invasion of renal cell carcinoma in vitro can be significantly inhibited, that is, the inhibitor of lncRNA LOC646762 expression can be effectively used to prevent or treat the metastasis and invasion of renal cell carcinoma, and therefore the inhibitor of lncRNA LOC646762 expression can be used to prepare a drug for preventing and / or treating renal cell carcinoma.

[0022] The drug provided in the second aspect of the present application is based on the inhibitor of lncRNA LOC646762 expression, which can effectively prevent or treat the metastasis and invasion of renal cell carcinoma. Therefore, by using the inhibitor of lncRNA LOC646762 expression in the drug, it can be effectively used to prevent or treat renal cell carcinoma. Such a drug can become a good drug for preventing and / or treating renal cell carcinoma.

[0023] The application provided in the third aspect of the present application is based on the discovery of a renal clear cell carcinoma marker lncRNA LOC646762. Studies have shown that lncRNA LOC646762 is highly expressed in renal clear cell carcinoma and is associated with patient prognosis. Therefore, the quantitative detection reagent of the lncRNA LOC646762 can be used to prepare a kit for diagnosis and / or prognosis evaluation of renal cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0025] Figure 1 This is the expression map of lncRNA LOC646762 in paired samples of renal cancer based on the analysis of TCGA database;

[0026] Figure 2 This is the expression map of lncRNA LOC646762 obtained based on the analysis of the dataset GSE36895;

[0027] Figure 3 This is the survival curve of lncRNA LOC646762 analyzed based on KIRC dataset samples;

[0028] Figure 4 is the expression level diagram of lncRNA LOC646762 in different renal cancer cell lines;

[0029] Figure 5 is a graph showing the inhibition efficiency of siRNA against lncRNA LOC646762 in 786-O cell line;

[0030] Figure 6 is a graph showing the inhibition efficiency of siRNA against lncRNA LOC646762 in Caki-1 cell line;

[0031] Figure 7 This is a graph showing the inhibition efficiency of shRNA against lncRNA LOC646762 in 786-O cell line;

[0032] Figure 8 is a graph showing the inhibition efficiency of shRNA against lncRNA LOC646762 in Caki-1 cell line;

[0033] Fig. 9 The photos are of 786-O cells and Caki-1 cells after interference with lncRNA LOC646762;

[0034] Fig.10 To investigate the changes in the number of migrating 786-O and Caki-1 cells after interfering with lncRNA LOC646762;

[0035] Fig.11 The photos are of 786-O cells and Caki-1 cells after interference with lncRNA LOC646762;

[0036] Fig.12 To investigate the changes in invasion numbers of 786-O and Caki-1 cells after interference with lncRNA LOC646762;

[0037] Fig.13 To knock down the expression of E-cadherin gene at the mRNA level by lncRNA LOC646762;

[0038] Fig.14To knock down the expression of ZEB1 gene at the mRNA level by lncRNA LOC646762;

[0039] Fig.15 To knock down the expression of E-cadherin gene and ZEB1 gene at the protein level by lncRNA LOC646762;

[0040] Fig.16 To knock down the effect of lncRNA LOC646762 on H3K27Ac in the promoter region of the ZEB1 gene. DETAILED DESCRIPTION

[0041] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clearly understood, the present application is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application.

[0042] In the present application, the term "and / or" describes the association relationship of associated objects, indicating that three relationships may exist. For example, A and / or B can represent: A exists alone, A and B exist at the same time, and B exists alone. A and B can be singular or plural. The character " / " generally indicates that the previous and subsequent associated objects are in an "or" relationship. "At least one" refers to one or more, and "many" refers to two or more. "At least one of the following" or similar expressions refers to any combination of these items, including any combination of single or plural items.

[0043] It should be understood that in various embodiments of the present application, the size of the sequence number of each process described above does not mean the order of execution, some or all of the steps can be executed in parallel or in sequence, and the execution order of each process should be determined by its function and inherent logic, and should not constitute any limitation on the implementation process of the embodiment of the present application. The terms used in the embodiments of the present application are only for the purpose of describing specific embodiments, and are not intended to limit the present application. The singular forms of "a", "said" and "the" used in the embodiments of the present application and the appended claims are also intended to include plural forms, unless the context clearly indicates other meanings.

[0044] The terms "first" and "second" are used only for descriptive purposes to distinguish objects such as substances from each other, and should not be understood as indicating or implying relative importance or implicitly indicating the number of indicated technical features. For example, without departing from the scope of the embodiments of the present application, the first XX may also be referred to as the second XX, and similarly, the second XX may also be referred to as the first XX. Thus, the features defined as "first" and "second" may explicitly or implicitly include one or more of the features.

[0045] LncRNA LOC646762 is located on chromosome 7p14.3. For convenience, it is sometimes abbreviated as LOC646762 in the specification or drawings. It is a newly annotated lncRNA with unknown function. TCGA data mining analysis shows that LncRNA LOC646762 is upregulated in renal cell carcinoma and is related to prognosis. Therefore, LncRNA LOC646762 is expected to become a diagnostic and prognostic marker for renal clear cell carcinoma. Quantitative detection reagents related to lncRNA LOC646762 can be used to prepare a kit for diagnosis and / or prognosis evaluation of renal cancer. Further experiments found that by inhibiting the expression of lncRNA LOC646762, the metastasis and invasion of renal cell carcinoma in vitro can be significantly inhibited, that is, the inhibitor of lncRNA LOC646762 expression can be effectively used to prevent or treat the metastasis and invasion of renal cell carcinoma. Therefore, the inhibitor of lncRNA LOC646762 expression can be used to prepare a drug for the prevention and / or treatment of renal cell carcinoma.

[0046] In a first aspect, an embodiment of the present application provides a use of an inhibitor of lncRNA LOC646762 expression in the preparation of a drug for preventing and / or treating renal cancer.

[0047] In one embodiment, the gene sequence of lncRNA LOC646762 (SEQ ID No. 1) is as follows:

[0048] >NR_024278.1Homo sapiens uncharacterized LOC646762(LOC646762),lon gnon-coding RNA:

[0049] CTCGGCTCGGATCTACCTTCCAGTAGCAGCGGAGTGGCCAATGGGACCGGGACCAGAGCCGGGGGC

[0050] CGGAGGCCGCCGCCGCGGGGAGGTTCCCGGCCCAGGTGCCCAGCGCTCACCAGCCCGGCGGCGCC

[0051] GCGGCGGCCCCGCAGCTGTTTCCTCGGGGGGGCGTGGCGTCGGGGGCCTTCGCGGCGCAGTCCTCT

[0052] TTCAGCATCCCGAACAGCAGCAGCGGCCCGTAGGACTCGCAGGACTCGGTGCACAGCAGCCCTGAG

[0053] GATGGCGGCGGCGGCCGGCACCGGCCGGTGGGCTGGAGCCCCGGCGGGCCGCTCCTGGTGATCGGC

[0054] TCCTTACCAGCTCACCTCTCACCGCGCATGTTTGGAGGTGCTGAGAAACATAATGTCTGTTCCCCAA

[0055] GAGCCAGCTAATCATTTTTACTAAGTACGATAATTGGCTGCCCTGATTCAGATAACATATCCTTATTGT

[0056] GACATAGGGGTGACTATTGTCAGAAAACCCTGAAAATGTTTTAAAACAAGAACTAATGGGGCTTGGC

[0057] GATTCTTGCCACGCTTTTCCAGAGCTCGGACCTTGCTATTATTTGCTACTAGACACCCACAAACCCTT

[0058] GCTTGTTAAACTGATCGCCTTCAAGACTCAAGAAAAGCGCCATGCGGCTCCCTCCTAGGGCTCTCCT

[0059] GACCTTTCCTCACCAATGCCGAGAGTGGTCCTGCTGGAGAACGCACACGCCTGCAGTTCGTGCACC

[0060] TTTTCCCGGAGCTGCACCAGGAAATTATGGATCAACTGGAAGCAGCCAAGAAGAAGGGTCTTGGCG

[0061] ATCACATCCAGCTATTCAGCCATCTCAGACTGCGGACCTCCGTGCACCCCCTGGCAGGTTCCCTCCGC

[0062] CTAGGGTCGAAAGCTTCAGAGGCAGCCCCAACTCTTCCACTTCTTCCTCCATCTCTGGCTCCCAGGC

[0063] TTGGGAGGCCCCGCGCCACCGCTTCAACTGGCTGGGGTGGGAAGATTGAAACGGCTCTTGAGACTC

[0064] TGCTTTTGCGCTTACTGCTCGTTTGCCCGACTATTTTCTCATAGTCCCTATTCCAGTCAATTTCTGGCA

[0065] CAGCCCAGCTTGAAACTGCTCTTGAGCCTCCGATTTTGAGCTTACTCCTGGTTTGCCCGACTATTTTC

[0066] TCATAATCCCTGTTCCGGTCAGTTTCCGGCACAGCCCAGCTTGAAACAGCTCTTGAGCCTCCCCTTTT

[0067] GAGCTTACTCCTCCTTTGCCTGACTCTTTTCTCATAGTCCCTGTTCTGGTCAATTTCCGGCGCAGCCC

[0068] GGCTTGAAATGGCTCTTGAGCCTACGCTTTTGAGCTTACTTCTCATTTGCCCGACTATTTTCTCATAGT

[0069] TCCTGTTCCGGTCAATTTCCAGCGCAGCCCAGCTGAGTTGGGCGAGGTCTAGAAAGGCCTGACTCGC

[0070] CTCTTGGCCTCAATGACTTGTACCCGCTGCTTTTGCAGACCTCCCGGTCTTCATGGCAACTGTGAAAT

[0071] GTGGGGTGGGGGGCGTAGGGTTGAAGCCATTCGCGCCGGTAGTCCCTGCATGTCCCCTCATGTGCTC

[0072] CCCAGTGCGCACAGCACCCCAGCCTCCGCGCTTCTGGAAGCAGCCCAGAAGGGTCTTGGCAATCAC

[0073] GTCCAGCTGTAAGCCATTTCGCGGTCTCAGATTGCGGACCTCCGCACGCCCCTCGGCAGGTTCCCTC

[0074] CGCCTAGGGTGGAAAGCTGCAAAGGCAGCCCCAACTCTTCCACCACCTCCTCCATCTCCGGCTCCTG

[0075] GGCTTGGGAGGCCCCGCGCCACTGCTTCGACTGGCTGGGGCGGGAAGGTTGAAATGGCTTTGAGAC

[0076] TCCACTTTTGAGCTTACTCCTCCTTTGCCCGACTATTTTCTCATAGTCCCTATTCCAATCAATTTCTGGT

[0077] GCAGCCCAGCTTGAAATGGCTCTTGAGCCTCCGCTTTTCAGCTGACTCCTCGATTG.

[0078] Among them, the 1st to 366th base sequence corresponds to the first exon pair, and the 367th to 1626th base sequence corresponds to the second exon.

[0079] Specifically, the renal cancer in the drug for preventing and / or treating renal cancer may include at least one of renal clear cell carcinoma, renal chromophobe cell carcinoma and renal papillary cell carcinoma; due to the high proportion of renal clear cell carcinoma and the large market demand, drugs for preventing and / or treating renal clear cell carcinoma can be selected.

[0080] In one embodiment, the inhibitor includes at least one of siRNA and shRNA. siRNA (Smallinterfering RNA) is a small infectious RNA, also known as short interfering RNA (short interfering RNA) or silencing RNA (silencing RNA), which is a double-stranded RNA of about 20 to 25 nucleotides in length, which regulates gene expression in a specific manner. shRNA (short hairpin RNA) is a small hairpin RNA, which is a section of RNA sequence with a tight hairpin loop, and is used to inhibit the expression of specific genes. Therefore, both siRNA and shRNA can effectively inhibit the expression of lncRNA LOC646762.

[0081] In one embodiment, the sense strand targeting sequence of the siRNA includes at least one of the sequences shown in SEQ ID No. 2-6. That is, the present embodiment provides five siRNAs, and the sense strand is the strand with the same sequence as the target region, and the information is as follows:

[0082] siRNA-1: 5'-CUAUCUCUGUAACCAUUAA-3'; the U is replaced by T, which is the interference target sequence (SEQ ID NO. 2) CTATCTCTGTAACCATTAA.

[0083] siRNA-2: 5'-GAAUAUGUGUCAUGCAAUA-3'; the U is replaced by T, which is the interference target sequence (SEQ ID NO. 3) GAATATGTGTCATGCAATA.

[0084] siRNA-3: 5'-ACAGUAGAGUUGGGAUCUATT-3'; the U is replaced by T, which is the interference target sequence (SEQ ID NO. 4) ACAGTAGAGTTGGGATCTATT.

[0085] siRNA-4: 5'-GGUAUUUGCUUGUGAAGAATT-3'; the U is replaced by T, which is the interference target sequence (SEQ ID NO. 5) GGTATTTGCTTGTGAAGAATT.

[0086] siRNA-5: 5'-CAUGACAGCUGGCUUAGUATT-3'; the U is replaced by T, which is the interference target sequence (SEQ ID NO. 6) CATGACAGCTGGCTTAGTATT.

[0087] Specifically, the above siRNA interference sequence can be used to inhibit the expression of lncRNA LOC646762 in ccRCC cell lines, which can be synthesized by Jima Gene (Suzhou, China), and the siRNA is transiently transfected into ccRCC cells using JetPRIME transfection reagent according to the instructions provided by the siRNA synthesis company. Silencing lncRNA LOC646762 can significantly inhibit the cell migration and invasion of renal cell carcinoma cells in vitro.

[0088] In one embodiment, the shRNA includes at least one of the sequences shown in SEQ ID No. 7-8. That is, the present embodiment provides two shRNAs.

[0089] shRNA-1:

[0090] 5'-GCTGGATAGTCAGTTCTTACATTCAAGAGATGT-AAGAACTGACT ATCCAGCTTTTTTC-3' (SEQ ID NO. 7), wherein TTCAAGAGA is a loop structure.

[0091] shRNA-2:

[0092] 5'-GGATTTGAAGAAGGGAGAAGGTTCAAGAGACCTT-CTCCCTTCTT CAAATCCTT-3' (SEQ ID NO. 8), wherein TTCAAGAGA is a loop structure.

[0093] Specifically, the above shRNA sequence can be used to inhibit the expression of lncRNA LOC646762 in RCC cell lines, and through the synthesis of lentivirus, a stable renal clear cell carcinoma cell line that effectively inhibits the expression of lncRNA LOC646762 can be constructed. In addition, inhibiting the expression of lncRNA LOC646762 can significantly upregulate the expression of epithelial cell cadherin (E-cadherin) and significantly downregulate the expression of zinc finger E-box binding protein 1 (ZEB1), thereby inhibiting the cell migration and invasion of renal cell carcinoma cells in vitro.

[0094] The above types of siRNA and shRNA can effectively inhibit the expression of lncRNA LOC646762. It can not only improve the efficacy of tumor treatment, but also reduce the adverse effects on normal cells, so it has broad application prospects in the field of renal cell cancer treatment.

[0095] In a second aspect, the embodiments of the present application also provide a drug for preventing and / or treating renal cancer, comprising an inhibitor of lncRNA LOC646762 expression and a pharmaceutically acceptable carrier.

[0096] Inhibitors based on lncRNA LOC646762 expression can effectively prevent or treat the metastasis and invasion of renal cell carcinoma. Therefore, by using inhibitors of lncRNA LOC646762 expression in drugs, it can be effectively used to prevent or treat renal cell carcinoma. Such drugs can become a good drug for preventing and / or treating renal cell carcinoma.

[0097] Specifically, the gene sequence of lncRNA LOC646762 is shown in SEQ ID No. 1. Renal cancer includes at least one of renal clear cell carcinoma, renal chromophobe cell carcinoma and renal papillary cell carcinoma. The inhibitor includes at least one of siRNA and shRNA; such as selected from the above five siRNAs and two shRNAs.

[0098] Specifically, the above-mentioned drugs include oligonucleotides for treating renal cell carcinoma based on RNA interference, which can inhibit the expression of lncRNA LOC646762 in renal clear carcinoma cells, thereby inhibiting the metastasis and invasion of tumors.

[0099] Furthermore, the above-mentioned vector may include a viral vector. For example, a lentiviral vector loaded with shRNA is transduced into a cell, and shRNA binds to the mRNA of the target gene and induces the Dicer protein to cut the shRNA molecule, thereby forming an RNA-induced silencing complex (RISC) to promote the degradation of mRNA, thereby inhibiting the expression of the target gene. Such RNAi drugs are easier to prepare, and the production and purification processes are more efficient. Moreover, by synthesizing RNAi drugs, the expression of the target gene can be precisely regulated, thereby achieving the effect of precision treatment.

[0100] In a third aspect, the embodiments of the present application also provide a use of a quantitative detection reagent for lncRNA LOC646762 in the preparation of a kit for diagnosing and / or prognostic evaluation of renal cancer.

[0101] Specifically, the quantitative detection reagent includes primers for amplifying lncRNA LOC646762: SEQ ID No.9 and SEQ ID No.10.

[0102] Bioinformatics analysis revealed that lncRNA LOC646762 is highly expressed in renal clear cell carcinoma and is associated with patient prognosis, and is a renal clear cell carcinoma marker. Therefore, the quantitative detection reagent of lncRNA LOC646762 can be used to prepare a kit for diagnosis and / or prognosis evaluation of renal cancer.

[0103] The following describes the invention in conjunction with specific embodiments.

[0104] Example 1 Detection of lncRNA LOC646762 expression in renal cancer

[0105] 1. Bioinformatics analysis of lncRNA LOC646762 expression in renal cancer

[0106] The gene expression data of renal cancer were downloaded from the TCGA (The Cancer Genome Atlas) database, and the expression of lncRNA LOC646762 was analyzed. Because tumor tissue samples and normal tissue samples were unbalanced, a paired sample t-test was performed on renal cancer samples. The results are as follows: Figure 1As shown in the figure, the abbreviation KICH in the database represents renal chromophobe cell carcinoma, KIRC represents renal clear cell carcinoma, and KIRP represents renal papillary cell carcinoma. The expression level is expressed in TPM (Transcripts Per Million), which is the number of transcripts per million. The analysis showed that the expression level of lncRNA LOC646762 was significantly upregulated in paired renal cancer samples, especially renal clear cell carcinoma and renal chromophobe cell carcinoma. Subsequently, the dataset GSE36895 in the GEO (Gene Expression Omnibus) database was collected to verify the expression level of lncRNA LOC646762 in renal clear cell carcinoma. The results are shown in the figure. Figure 2 As shown in Figure 2, compared with adjacent adjacent tissues, the expression level of lncRNA LOC646762 in renal clear cell carcinoma was significantly upregulated. In order to verify whether lncRNA LOC646762 affects the prognosis of renal clear cell carcinoma, we performed survival analysis on the KIRC dataset samples. The results are shown in Figure 2. Figure 3 As shown, patients with high expression of lncRNA LOC646762 had a poor prognosis and survival ability.

[0107] 2. Detection of lncRNA LOC646762 expression in renal clear cell carcinoma cell lines

[0108] 2.1 RNA extraction

[0109] Cells (i.e., renal clear cell carcinoma cell line) were revived in advance and passaged to obtain cells in the logarithmic growth phase. Cell samples were digested with trypsin and the cells were counted before inoculation. The cells were plated at 2×10 5 The cells were inoculated into a 6-well plate at a density of 1 mL and observed to ensure good cell growth. After the cells were fully grown, they were washed twice with PBS solution, 1 mL of Trizol solution was added, and the cells were collected and allowed to stand for 10 minutes after being blown evenly. 200 microliters of chloroform were added to each centrifuge tube, the lid was covered and mixed thoroughly, and after standing for 15 minutes, a 4°C centrifuge was used to run at 12,000 rpm for 15-20 minutes. The supernatant was aspirated and discarded with a pipette, 1 mL of 75% ethanol solution (3 / 4 anhydrous ethanol, 1 / 4 DEPC water) was added, mixed up and down, and run at 12,000 rpm in a 4°C centrifuge for 5 minutes. After removing the supernatant, it was centrifuged again at 12,000 rpm for 3 minutes, and the excess liquid was aspirated with a 10ul micropipette. The precipitate was left to dry at room temperature, 40ul of DEPC water was added, and it was blown and mixed evenly. After obtaining the RNA solution, the total RNA solubility was measured by the riboprotein assay. First, rinse the detection head with DEPC water, then take 1ul of RNA solution to measure the concentration and purity. The A260 / 280 of the total RNA sample is in the range of 1.8-2.0.

[0110] 2.2 RNA reverse transcription

[0111] The two-step method was used: the concentration of the extracted total RNA was determined, and the total amount of reverse transcribed RNA was controlled to be 500ng. According to the solubility of the total RNA sample solution, the volume required for 500ng RNA was calculated, and ddH2O water was used to make up to 6ul. The sample was placed in a PCR instrument, kept at 65℃ for 5min to denature the RNA, placed on ice for 2min, 2μL 5×DTT buffer was added and mixed, placed in a PCR instrument, the temperature was set to 37℃ for 5min, and then 2μL 5×RT buffer was added to make the total reaction volume 10μL, and the following reaction was set: 37℃15min, 65℃15min, 4℃10min, and finally complementary DNA (cDNA) was generated for subsequent experiments.

[0112] 2.3RT-qPCR

[0113] NCBI was used to design the primer sequences. The primer sequences are shown in Table 1:

[0114] Table 1 RT-qPCR detection primers

[0115]

[0116] First, the primers were centrifuged at 12000rpm for 5min, and ddH2O was added according to the required dosage in the primer instructions provided by the primer synthesis company, so that the working concentration of the primers was 10μM for subsequent real-time fluorescence quantitative PCR detection. GAPDH was used as an internal reference, and at least three replicates were set for each group of samples, added to eight tubes and centrifuged to remove bubbles, and then tested on the machine. The experiment was repeated three times to ensure the reliability of the experiment, organize the data, and calculate whether the results were significant. The relative expression of RNA was calculated using comparative Ct, GAPDH was used for control of gene expression standardization, and the expression level of RNA was calculated as the amount of target RNA relative to the GAPDH control to normalize the initial input of total RNA.

[0117] The expression of lncRNA LOC646762 in three renal clear cell carcinoma cell lines, 786-O, Caki-1, and A498, was detected and compared with that in normal adult renal tubular epithelial cells, HK2. Figure 4As shown, compared with adult renal tubular epithelial cells HK2, lncRNA LOC646762 was significantly upregulated in 786-O, Caki-1, and A498. Among them, the expression level of lncRNA LOC646762 in 786-O cells was 2.5 times that of HK2 cells, and the expression level of lncRNA LOC646762 in Caki-1 cells was 2 times that of HK2 cells, indicating that the expression level of lncRNA LOC646762 in 786-O and Caki-1 was significantly higher than that in HK2 cells.

[0118] Example 2 Knockdown of LncRNA LOC646762 expression

[0119] 1. siRNA interference

[0120] According to the experimental results above, 786-O and Caki-1 cell lines were selected and divided into control group and experimental group. Using standard siRNA interference technology, the siRNA interference sequence was transferred into the experimental group cells by JetPRIME transfection reagent, and the corresponding control sequence (siRNA-NC) was transferred into the control group cells. The expression level of lncRNA LOC646762 was tested by RT-qPCR technology to confirm the effectiveness of siRNA. After transient transfection of 786-O cells, the mRNA expression level of lncRNA LOC646762 was detected. The results are as follows Figure 5 As shown in the figure, the qPCR results showed that the interference efficiency of the five interference groups (siRNA-1, siRNA-2, siRNA-3, siRNA-4, and siRNA-5) was greater than 50% compared with the control group, and the difference was significant. After transient transfection of Caki-1 cells, the expression level of lncRNA LOC646762 mRNA was detected. The results are shown in Figure 6 As shown, the interference efficiency of the two interference groups (siRNA-1, siRNA-2) was greater than 50% compared with the control group, and the difference was significant. siRNA-1 and siRNA-2 with better inhibition efficiency were selected from the above siRNAs for subsequent functional experimental verification.

[0121] 2. shRNA interference

[0122] In order to construct a cell line that can stably knock down lncRNA LOC646762 and sustainably propagate, the renal clear cell carcinoma cell line was transfected with a lentivirus carrying a small hairpin RNA (shRNA). The 786-O and Caki-1 cell lines were divided into a control group and an experimental group. The shRNA lentiviral vector LV2 (Μ6 / Puro) was purchased from Jima Gene, which contains a puromycin screening gene and can be used for the screening of stable transfected cells. After 2-3 days of transfection of 786-O and Caki-1 cells with shRNA, the cells were screened with 3μg / mL puromycin for 3-4 days, and then total RNA was extracted with Trizol and the expression level of lncRNA LOC646762 was detected. The results are shown in Figure 7 and Figure 8 As shown, in 786-O and Caki-1, the expression level of lncRNA LOC646762 in the transfection group was significantly decreased compared with the control group (shRNA-NC), and the knockdown efficiency was 75% (P<0.01), indicating that the transfection effect was good.

[0123] Example 3 lncRNA LOC646762 on metastasis and invasion of renal clear cell carcinoma

[0124] Exploring the signaling pathways that lncRNA LOC646762 may be involved in: According to the expression level of lncRNA LOC646762, 607 renal clear cell carcinoma samples in the TCGA database were divided into high-risk and low-risk groups. The GSEA results showed that the cell tight junction pathway was significantly enriched in the low-risk group, suggesting that the downregulation of lncRNA LOC646762 may lead to enhanced cell-to-cell adhesion. In addition, the GO enrichment analysis results of normal renal cells showed that cell junction and cell adhesion-related pathways were significantly enriched in the differentially expressed gene groups, so lncRNA LOC646762 may play a positive regulatory role in cell adhesion.

[0125] In order to further analyze the effect of lncRNA LOC646762 on the migration and invasion ability of renal clear cell carcinoma cells, the Transwell migration and invasion assay was used to analyze the changes in the metastasis and invasion ability of renal clear cell carcinoma cell lines after inhibiting the expression of lncRNA LOC646762. Fig. 9 and Fig.10 As shown in Figure 2, the invasion ability of renal clear cell carcinoma cell line was inhibited after the expression of lncRNA LOC646762 was inhibited. Fig.11 and Fig.12As shown. It can be seen that after siRNA interference, the number of migration and invasion of 786-O and Caki-1 cells was significantly reduced, and the results were significantly different (P<0.01). Therefore, interfering with the expression of lncRNA LOC646762 has an inhibitory effect on the metastasis and invasion ability of renal clear cell carcinoma.

[0126] Example 4 Experiment on the effect of lncRNA LOC646762 on the EMT process of renal clear cell carcinoma

[0127] In order to explore the effect of knocking down lncRNA LOC646762 on the EMT (Epithelial-mesenchymal transition) process in renal clear cell carcinoma, shRNA-1 with better inhibition efficiency among the above shRNAs was selected, and the expression levels of markers in the EMT process were checked by RT-qPCR. The primers for amplification of E-cadherin and ZEB1 are shown in Table 1. The results are shown in Figure 13-15 As shown in the figure, it was found that after knocking down lncRNA LOC646762, the expression of E-cadherin in Caki-1 cells and 786-O cells increased significantly, and the expression of ZEB1 decreased significantly. The Western blot results were consistent with RT-qPCR. Six ChIP primers for the ZEB1 promoter region were designed using NCBI, and the sequences are shown in Table 2. A chromosome immunoprecipitation (ChIP) experiment was designed to explore whether the change in the expression of lncRNA LOC646762 could affect the H3K27 acetylation level in the ZEB1 promoter region. IgG antibody was used as the negative control of the experiment. The results of the ChIP experiment are shown in the figure. Fig.16 As shown in the results, inhibition of lncRNA LOC646762 expression can affect the enrichment level of H3K27 acetylation in the ZEB1 promoter region, thereby regulating the expression of ZEB1.

[0128] Table 2 ChIP primer sequences

[0129]

[0130]

[0131] In summary, the present application embodiment study shows that lncRNA LOC646762 is highly expressed in renal clear cell carcinoma and is associated with patient prognosis. The siRNA and shRNA sequences that inhibit the expression of lncRNA LOC646762 can be used to inhibit the expression of lncRNA LOC646762, which can be effectively used to prevent or treat renal clear cell carcinoma. The siRNA sequence can significantly inhibit the expression of lncRNA LOC646762 in renal clear cell carcinoma, and inhibit the migration and invasion of renal clear cell carcinoma. The shRNA sequence can significantly upregulate E-cadherin expression and inhibit ZEB1 expression at the mRNA and protein levels, thereby affecting the EMT process and metastasis invasion of renal clear cell carcinoma.

[0132] The above description is only a preferred embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present application should be included in the protection scope of the present application.

Claims

1. Use of an inhibitor of lncRNA LOC646762 expression in the preparation of a drug for preventing and / or treating renal cancer; the inhibitor comprises shRNA, the shRNA is at least one of the sequences shown in SEQ ID No. 7-8, and the renal cancer is renal clear cell carcinoma.

2. The use according to claim 1, characterized in that The gene sequence of the lncRNA LOC646762 is shown in SEQ ID No.

1.

3. Use of a quantitative detection reagent for lncRNA LOC646762 in the preparation of a kit for diagnosing and / or prognostic evaluation of renal cancer, wherein the renal cancer is renal clear cell carcinoma.

4. The use according to claim 3, characterized in that The quantitative detection reagent includes primers for amplifying lncRNA LOC646762: SEQ ID No. 9 and SEQ ID No. 10.

Images