A method for controlling apple woolly aphid based on transporter protein ABCG2 gene

Abstract

The present invention provides a method for controlling the woolly apple aphid based on the transport protein ABCG2 gene, that is, based on RNAi technology, after synthesizing the dsRNA of the woolly apple aphid ABC transport protein gene (ABCG2 gene), dripping it on the abdomen and back of the woolly apple aphid, so that the expression of the ABCG2 gene is significantly reduced, and then the mortality rate of the woolly apple aphid is significantly improved by treating it with imidacloprid. The present invention uses the RNAi method to reduce the expression of the ABCG2 gene, and then uses the woolly apple aphid control agent imidacloprid for treatment, and finally achieves the effect of increasing the mortality rate of the woolly apple aphid. At the same time, the dsRNA synthesized from the ABCG2 gene fragment of the woolly apple aphid is used to control aphids, which has the advantages of species specificity, safety and high efficiency, has good market application prospects and potential economic and ecological benefits in the green control of aphids, and provides a new control method for the green control of aphids.

Description

Technical Field

[0001] The invention belongs to the technical field of fruit tree pest control, and particularly relates to a method for controlling apple woolly aphids based on a transporter protein ABCG2 gene. Background Art

[0002] The woolly apple aphid (Eriosoma lanigerum (Hausmann)) is an important quarantine pest that harms apple plants. The insect usually gathers in groups, with one or several female aphids and their offspring gathering together to suck the tender shoots of the branches of the apple plants, sucking the juice of the tender shoots and buds, causing tumors to form in the damaged cortex. At the same time, during the period of infestation, the woolly apple aphid produces white wax secretions on its body surface to cover the surface of the insect body, protect itself from external invasion, and maintain life activities. After the woolly apple aphid infests, the nutrient transport of the tumorous branches is affected. In addition, the secreted honeydew increases the infection of pathogens, affecting the yield and quality of apples. In severe cases, it causes the death of apple trees.

[0003] At present, chemical measures are mainly used to control the woolly apple aphid, but the use of a large number of chemical pesticides seriously pollutes the environment, destroys the ecosystem, and causes the "3R" problem. Therefore, it is of great significance to explore new biological agricultural control strategies based on modern molecular biology technology for the control of the woolly apple aphid. Summary of the invention

[0004] To solve the above problems, the purpose of the present invention is to provide a method for controlling apple aphids based on the transporter protein ABCG2 gene, that is, based on RNAi technology, after synthesizing the dsRNA of the apple aphid ABC transporter protein gene (ABCG2 gene), drip it on the abdomen and back of the apple aphid, so that the expression level of the ABCG2 gene is significantly reduced, and then the apple aphid mortality rate is significantly increased by treating with imidacloprid.

[0005] The present invention first provides a use of the ABCG2 gene as a target for controlling apple woolly aphids;

[0006] Another aspect of the present invention provides the use of a product capable of reducing the expression level of the ABCG2 gene in apple woolly aphids, wherein the use is for preventing and controlling apple woolly aphids;

[0007] The product, as a specific description of the embodiment, is a dsRNA capable of binding to the mRNA of the ABCG2 gene;

[0008] As a specific description of the embodiment, the dsRNA binds to the following fragment of the ABCG2 gene:

[0009] ATGGAATCACCTGGTATGGCTTTAAGCGATAAGTATGGAGGAGATGGTCCAGCGGCCATTATGGTCAGAGGAGCATACAAGAGGTACAACCCACAAAGTGTCGTTCTTAGAGGCCTAAACATGACAGTACCGAAGGAACTATTTATGGTCTTCTCGGTCCTAGTGGATGTGGTAAAACTACATTACTAAGCTGTATGGTTGGACGGTGTCAACTTGATGCTGGAGATATTCAAGTCAAAGCTAGGACGAAATCAAATATTGGTTATATGCCTCAAGAACTTGCTCTATACAAAGAATTCAGCATTAAAGAAACAATGAATTATTATGGTCGATTATTCGGTATGAGTCATGAACAATAGAAACTAGAACATATGAACTACTAAAGTTTTTAG AACTTCCAAATGAAAAAAACATTGTTAGTCGACTAAGTGGTGGCCAAGAAAGAAGAGTGTCTTTCGCAGTTGCATTACTTCATGACCCCCAACTTCTTATATTAGATGAACCTACTGTTGGAGTAGATCCAGTATTAAGTGCTAGTATTTGGCAACATCTTCTAGACATGACAGCGAATGGAAATAAAACAGTTGTAATTACTACACATTATATTGAAGAAGCCAGACAAGCACACACAATTGGTTTAATGAGAGATGGTTTGTTATTAGCTGAAGAATCTCCGAATCAACTACTCATTAAACATAATTGCTCAACTTTGGAACAAGCTTTCTTAGAGCTAAGTAAAAACCAAACTAGAAGTAGTATTATGGACAGAGAAGATGAAAATTGTAAC

[0010] ATTGAAACATATCCTGTACCAGATAGAAAACCATTACCACCATTGAAGCCCGATTCTATTT

[0011] GTTCAAAAATGAGAATTTTAGCACAATTAATGAAAAATTTTTATTGGATGAAAAGAAATAT

[0012] ACCAATTATGTGTTTCCTAATGATATTGCCTGTTGTGCAATGTTATCTATTTTGCACTTGC

[0013] ATTGGTCTGATCCACAAGGGTTAAAATTAGGAGTAGTTAATGAAGAGCTTAAAACTGGAA

[0014] TGTCAAGTTGTAGTAATTATCCTTCGAGTGGGTGTAATTTCAGTGTACCATTAAGTTGTCG

[0015] ATATTTACAAAATTTGAAAGATAAGTTATAAATTGGTAGAGTATAATTCTCTAGACGAA

[0016] GCAAAATACGCTGTTAAAAGAATAAGGTTTGGGGAGTGTTATATATTTTGAAGAAGGTTATT

[0017] CAGAATCATTAGGGGCACGAATCCAGATGCCTGATAATTTGACTGACAGGGTCTTAAATAT

[0018] TAGCGACGTCAATATTTGGCAGGATATGTCCAACCAATATGTGAGTAATCTTCTACGAAGA

[0019] GATATGCTTTCGAGGTATGTTCTTTTCTTACAAAATGTATTCAGAGATTGTGAATGGCCTG

[0020] TTGCATTGGCTGATATACCGATTAAGATGGAAGATGCTATTTACGGAAATAATAACCCAAG

[0021] TTTTGGACATTTTACAGCTCCTGCCATTATATCACTATTTGAGTTCTATCTTCCGATGGTG

[0022] TTCACAGTGGGAGCAATACTTATGGAGAAGATGGGAGGGTTGTTGGAAAGAAGTCTTGTTG

[0023] CAGGTGTGACGGTGACGGAAGTGTTATTATCTCATATTGTAGTCCAATACATCGTTTTGAG

[0024] TATTCAGACAGCTTTGATGATGTTGGTGTTGTTTGTATTCTTCGACAATCCCATGGTGGGG

[0025] AGTCTTGTGTGGTCACTGTCATTGCTTTTTTTGACAGGAACTAGTGGAATGTGTTACGGAT

[0026] TTATGGTAGCAGTATTCTGCAACACAGACACATCAGCAACGTTCATGGGCTTGGGTAGCTT

[0027] CTTCCCCCTAGCCATGCTCAGCGGCATGATATGGCCCCTTGAAGGTATGCATTGGATATTG

[0028] AGATCAGTCGGTTGGATTCTTCCGATTACTTTATCGACTGAGTCATTTAGAGCCTTATCTG

[0029] CAAGGGACTGGTCGATAACACACCCTACGGTTTACAAAGGATTTTTATCTGCGTCCGGATG

[0030] GATTGGCGTGTTTATGTTAGTCACAATAATTGTTGTAAAGAAAAACAACGGTCTACGAAACGTAACAAAATAA(SEQ ID NO:1);

[0031] Furthermore, the sequence of the dsRNA is as follows:

[0032] TCTTCCGATGGTGTTCACAGTGGGAGCAATACTTATGGAGAAGATGGGAGGGTTGTT

[0033] GGAAAGAAGTCTTGTTGCAGGTGTGACGGTGACGGAAGTGTTATTATCTCATATTGTAGTC

[0034] CAATACATCGTTTTGAGTATTCAGACAGCTTTGATGATGTTGGTGTTGTTTGTATTCTTCG

[0035] ACAATCCCATGGTGGGGAGTCTTGTGTGGTCACTGTCATTGCTTTTTTTGACAGGAACTAG

[0036] TGGAATGTGTTACGGATTTATGGTAGCAGTATTCTGCAACACAGACACATCAGCAACGTTC

[0037] ATGGGCTTGGGTAGCTTCTTCCCCCTAGCCATGCTCAGCGGCATGATATGGCCCCTTGAAG

[0038] GTATGCATTGGATATTGAGATCAGTCGGTTGGATTCTTCCGATTACTTTATCGACTGAGTC

[0039] ATTTAGAGCCTTATCTGCAAGGGACTGGTCGATAACACACCCTACGGTTTACAAAGGATTT

[0040] TTATCTGCGTCCGGA(SEQ ID NO:2);

[0041] The sequences of the primer pairs used for preparing the dsRNA are as follows:

[0042] Upstream primer: 5′-taatacgactcactatagggTCTTCCGATGGTGTTCACAG-3′ (SEQ ID NO: 3),

[0043] Downstream primer: 5′-taatacgactcactatagggTCCGGACGCAGATAAAAATC-3′ (SEQ ID NO: 4).

[0044] In another aspect, the present invention provides a method for controlling apple woolly aphids, which is to reduce the expression level of the ABCG2 gene in the aphids during the control of apple woolly aphids;

[0045] The method described herein, wherein a drug capable of controlling aphids is used in the process of controlling the woolly apple aphid, as a specific record of an embodiment, the drug is imidacloprid.

[0046] The present invention uses RNAi method to reduce the expression of ABCG2 gene, and then uses imidacloprid, an apple aphid control agent, for treatment, and finally achieves the effect of significantly increasing the mortality rate of apple aphid. At the same time, the use of dsRNA synthesized from the ABCG2 gene fragment of apple aphid for aphid control has the advantages of species specificity, safety and high efficiency, and has good market application prospects and potential economic and ecological benefits in aphid green control, providing a new control method for aphid green control. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 Schematic diagram of the device for the dsRNA dripping process of the woolly apple aphid.

[0048] Figure 2 The results are shown in the figure below: The relative expression levels of the ABCG2 gene 24h, 48h and 72h after dsRNA was dripped onto the adults of the woolly apple aphid (EF1-α gene was the internal reference gene, dsABC was the experimental group, and dsGFP was the control group).

[0049] Figure 3 This is the result of the effect of imidacloprid treatment on the mortality of woolly apple aphid 48 hours after dsRNA was dripped on the adults of the aphid (dsGFP was the control group and dsElABCG2 was the treatment group). DETAILED DESCRIPTION

[0050] RNA interference (RNAi) refers to the interference of double-stranded RNA (dsRNA) molecules with homologous target mRNA, leading to altered gene expression and subsequent protein production.

[0051] ABC transporters (ATP-binding cassette transporter, ABC transporter) are an important class of transmembrane proteins present in organisms, responsible for the transport of amino acids, sugars, heavy metal ions and conjugates, peptides, lipids, polysaccharides, exogenous substances, etc.

[0052] The present invention designs primers and synthesizes dsRNA according to the sequence of the target ABCG2 transporter gene. E-RNAi is used to design dsRNA-specific upstream primers and downstream primers with a T7 promoter at the 5′ end, and then PCR amplification is performed to obtain a PCR product; the obtained PCR product is then run on an electrophoresis gel for recovery and purification, connected to a vector, and transformed into Escherichia coli. After overnight culture with shaking bacteria, sequencing is performed, and plasmids are extracted from the bacterial solution with the correct sequencing. Using the plasmid as a template, primers with a T7 promoter are added for PCR amplification, and the high-concentration product after gel recovery is used as a template, and the dsRNA is synthesized in vitro with reference to the instructions of the Transcript Aid T7 High Yield Transcription Kit.

[0053] The synthesized dsRNA was mixed with nanocarriers and surfactants in a ratio of 1:1:0.6 to obtain a dsRNA mixture. The apple seedlings were then placed on a PCR plate, and a 1.5 mL PCR tube was used to clamp the apple seedlings. The apple seedlings were kept at a certain tilt angle, and a small brush was used to sweep away excess wax secretions on the surface of nymphs and adults. The dsRNA mixture was dripped on the abdomen and back of the apple aphid. After dripping, the aphids were placed in an incubator for 3 days to detect the expression of the ABCG2 transporter gene and observe the growth of the apple aphid.

[0054] Preferably, in the above-mentioned method of RNAi against woolly apple aphid, the concentration of dsRNA and nanocarrier droplets is 500 ng / μL, the concentration of surfactant is 0.6% of the total volume, and the nanocarrier and surfactant are provided by the research group of Shen Jie of China Agricultural University. The dsRNA, nanocarrier and surfactant are mixed and placed at 4°C for 30 minutes.

[0055] In order to make the technical solution of the present invention clearer, the specific implementation methods of the present invention are described in detail below with reference to the accompanying drawings and implementation cases:

[0056] Example 1: Screening and cloning of the ABCG2 gene sequence of the woolly apple aphid

[0057] (1) Based on the genome and transcriptome of the woolly apple aphid, the ABC gene sequences of other insect species were used to perform homologous BLAST in the genome of the woolly apple aphid. The ABCG2 gene sequence of the woolly apple aphid was obtained after sequence alignment using the NCBI database. The sequence is shown below:

[0058] ATGGAATCACCTGGTATGGCTTTAAGCGATAAGTATGGAGGAGATGGTCCAGCGGCCATTA

[0059] TGGTCAGAGGAGCATACAAGAGGTACAACCCACAAAGTGTCGTTCTTAGAGGCCTAAACAT

[0060] GACAGTACCCGAAGGAACTATTTATGGTCTTCTCGGTCCTAGTGGATGTGGTAAAACTACA

[0061] TTACTAAGCTGTATGGTTGGACGGTGTCAACTTGATGCTGGAGATATTCAAGTCAAAGCTA

[0062] GGACGAAATCAAATATTGGTTATATGCCTCAAGAACTTGCTCTATACAAAGAATTCAGCAT

[0063] TAAAGAAACAATGAATTATTATGGTCGATTATTCGGTATGAGTCATGAACAAATAGAAACT

[0064] AGAACATATGAACTACTAAAGTTTTTAGAACTTCCAAATGAAAAAAACATTGTTAGTCGAC

[0065] TAAGTGGTGGCCAAGAAAGAAGAGTGTCTTTCGCAGTTGCATTACTTCATGACCCCCAACT

[0066] TCTTATATTAGATGAACCTACTGTTGGAGTAGATCCAGTATTAAGTGCTAGTATTTGGCAA

[0067] CATCTTCTAGACATGACAGCGAATGGAAATAAAACAGTTGTAATTACTACACATTATATTG

[0068] AAGAAGCCAGACAAGCACACACAATTGGTTTAATGAGAGATGGTTTGTTATTAGCTGAAGA

[0069] ATCTCCGAATCAACTACTCATTAAACATAATTGCTCAACTTTGGAACAAGCTTTCTTAGAG

[0070] CTAAGTAAAAACCAAACTAGAAGTAGTATTATGGACAGAGAAGATGAAAATTGTAACATTG

[0071] AAACATATCCTGTACCAGATAGAAAACCATTACCACCATTGAAGCCCGATTCTATTTGTTC

[0072] AAAAATGAGAATTTTAGCACAATTAATGAAAAATTTTTATTGGATGAAAAGAAATATACCA

[0073] ATTATTGTGTTTCCTAATGATATTGCCTGTTGTGCAATGTTATCTATTTTGCACTTGCATTG

[0074] GTCGTGATCCACAAGGGTTAAAATTAGGAGTAGTTAATGAAGAGCTTAAAACTGGAATGTC

[0075] AAGTTGTAGTAATTATCCTTCGAGTGGGTGTAATTTCAGTGTACCATTAAGTTGTCGATAT

[0076] TTACAAAATTTGAAAGATAAGTTATAAATTGGTAGAGTATAATTCTCTAGACGAAGCAA

[0077] AAATACGCTGTTAAAAGAATAAGGTTTGGGGAGTGTTATATTTTGAAGAAGGTTATTCAGA

[0078] ATCATTAGGGGCACGAATCCAGATGCCTGATAATTTGACTGACAGGGTCTTAAATATTAGC

[0079] GACGTCAATATTTGGCAGGATATGTCCAACCAATATGTGGAGTAATCTTCTACGAAGAGATA

[0080] TGCTTTCGAGGTATGTTCTTTTCTTACAAAATGTATTCAGAGATTGTGAATGGCCTGTTGC

[0081] ATTGGCTGATATACCGATTAAGATGGAAGATGCTATTTACGGAAATAATAACCCAAGTTTT

[0082] GGACATTTTACAGCTCCTGCCATTATATCACTATTTGAGTTCTATCTTCCGATGGTGTTCA

[0083] CAGTGGGAGCAATACTTATGGAGAAGATGGGAGGGTTGTTGGAAAGAAGTCTTGTTGCAGG

[0084] TGTGACGGTGACGGAAGTGTTATTATCTCATATTGTAGTCCAATACATCGTTTTGAGTATT

[0085] CAGACAGCTTTGATGATGTTGGTGTTGTTTGTATTCTTCGACAATCCCATGGTGGGGAGTC

[0086] TTGTGTGGTCACTGTCATTGCTTTTTTTGACAGGAACTAGTGGAATGTGTTACGGATTTAT

[0087] GGTAGCAGTATTCTGCAACACAGACACATCAGCAACGTTCATGGGCTTGGGTAGCTTCTTC

[0088] CCCCTAGCCATGCTCAGCGGCATGATATGGCCCCTTGAAGGTATGCATTGGATATTGAGAT

[0089] CAGTCGGTTGGATTCTTCCGATTACTTTATCGACTGAGTCATTTAGAGCCTTATCTGCAAG

[0090] GGACTGGTCGATAACACACCCTACGGTTTACAAAGGATTTTTATCTGCGTCCGGATGGATT

[0091] GGCGTGTTTATGTTAGTCACAATAATTGTTGTAAAGAAAAACAACGGTCTACGAAACGTAA

[0092] CAAAATAA

[0093] (2) Design dsRNA primers based on the ABCG2 transporter gene sequence obtained after alignment. Use the E-RNAi (E-RNAi Webservice (dkfz.de)) website to design dsRNA-specific upstream and downstream primers with a T7 promoter at the 5′ end. The sequences are as follows: dsElABCG2-F: taatacgactcactatagggTCTTCCGATGGTGTTCACAG; dsElABCG2-R: taatacgactcactatagggTCCGGACGCAGATAAAAATC;

[0094] dsGFP-F:taatacgactcactatagggagaCAGTGCTTCAGCCGCTAC;

[0095] dsGFP-R: taatacgactcactatagggagaGTTCACCTTGATGCCGTTC;

[0096] (3) After picking out the adults and nymphs of the cottony apple aphid, place them in a 1.5 mL DNase-free centrifuge tube, extract total RNA using Trizol and reverse transcribe it into first-strand cDNA. Use the synthesized cDNA as a template for PCR amplification. The PCR amplification system is as follows: 2.5 μL of 10×Buffer, 2 μL of dNTPs Mix, 0.5 μL of upstream and downstream primers, 1 μL of template, 0.25 μL of rTaq enzyme, and 18.25 μL of ddH2O. The PCR reaction procedure is as follows: 94°C pre-denaturation for 3 min, 94°C denaturation for 30 s, 55°C annealing for 30 s, 35 cycles, and 72°C extension for 1 min. The amplification system of the GFP gene is as follows: 2.5 μL of 10×Buffer, 2 μL of dNTPs Mix, 1 μL of upstream and downstream primers, 2 μL of template, 0.25 μL of rTaq enzyme, and add water to 25 μL of the system. PCR reaction program: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 55°C for 30 s, 5 cycles, denaturation at 94°C for 30 s, denaturation at 65°C for 30 s, extension at 72°C for 30 s, 35 cycles, and then 72°C for 10 min.

[0097] (4) Take the above products and run electrophoresis in 1% agarose gel to detect the size of the target band. The bands with the same size are recovered and purified. The purified product is connected to the pEasy-T1 vector and transformed into the competent E. coli DH5α, and cultured on a shaking table for 6 hours. Then take 250μL of bacterial solution and evenly spread it on the LB solid culture medium containing Amp, invert it and culture it in a 37℃ incubator overnight. Take 1mL of bacterial solution for PCR test, and send the correct bacterial solution to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequenced sequence is compared by DNAMAN to obtain a DNA fragment with a length of 499bp. The DNA sequence is as follows:

[0098] TCTTCCGATGGTGTTCACAGTGGGAGCAATACTTATGGAGAAGATGGGAGGGTTGTT

[0099] GGAAAGAAGTCTTGTTGCAGGTGTGACGGTGACGGAAGTGTTATTATCTCATATTGTAGTC

[0100] CAATACATCGTTTTGAGTATTCAGACAGCTTTGATGATGTTGGTGTTGTTTGTATTCTTCG

[0101] ACAATCCCATGGTGGGGAGTCTTGTGTGGTCACTGTCATTGCTTTTTTTGACAGGAACTAG

[0102] TGGAATGTGTTACGGATTTATGGTAGCAGTATTCTGCAACACAGACACATCAGCAACGTTC

[0103] ATGGGCTTGGGTAGCTTCTTCCCCCTAGCCATGCTCAGCGGCATGATATGGCCCCTTGAAG

[0104] GTATGCATTGGATATTGAGATCAGTCGGTTGGATTCTTCCGATTACTTTATCGACTGAGTC

[0105] ATTTAGAGCCTTATCTGCAAGGGACTGGTCGATAACACACCCTACGGTTTACAAAGGATTT

[0106] TTATCTGCGTCCGGA

[0107] (5) The correctly sequenced bacterial solution was shaken overnight to extract the plasmid, and the extracted plasmid was used as a template, and primers with T7 promoter were added to perform PCR amplification. The reaction system and conditions were as shown in (3) above. Then, gel recovery was performed to increase the DNA concentration.

[0108] Example 2: Synthesis of dsRNA of the ABCG2 gene of the woolly apple aphid and preparation of the mixed solution

[0109] The dsRNA was synthesized using the Transcript Aid T7 High Yield Transcription Kit. The total mixed system was 20 μL: 5× Transcript Aid Reaction Buffer 4.0 μL, ATP / CTP / GTP / UTP 8.0 μL, template cDNA 1 μg, Transcript Aid Enzymix 2.0 μL. Mix well, centrifuge; incubate at 37°C overnight; white floccules can be seen in the reaction;

[0110] dsRNA purification: add 2uL DNaseⅠ to the mixture, incubate at 37℃ for 15min, then add 2uL EDTA, incubate at 65℃ for 10min; transfer to a 1.5mL centrifuge tube, add 115uL DEPC-treated H2O and 3M sodium Acetute Solution and mix well; add 150uL 1:1 water-saturated phenol / chloroform (75uL each), then add 300uL chloroform, shake to mix, 12000g, 4℃, centrifuge for 10min; transfer the supernatant to a new 1.5mL centrifuge tube, add 350uL anhydrous ethanol, mix, and place at -20℃ for 2h; centrifuge the 1.5mL centrifuge tube at 12000g, 4℃ for 10min, pour out the supernatant, and keep the precipitate; add 500uL frozen 75% ethanol to the precipitate, 7500g, centrifuge at 4℃ for 5min, pour out the supernatant, absorb as much as possible, and dry the precipitate for 10min; add 50uL RNase-FreeH2O, measure the concentration, and run electrophoresis detection.

[0111] Preparation of dsRNA mixture: The synthesized dsRNA was diluted to 500 ng / μL, and the same concentration of nanocarrier material and 0.6% volume of surfactant were added. The nanocarrier and surfactant were provided by Professor Shen Jie of China Agricultural University. The dsRNA, nanocarrier and surfactant were mixed and placed at 4°C for 30 minutes before dripping.

[0112] Example 3: RNAi experiment of ABCG2 gene of woolly apple aphid

[0113] (1) dsRNA fragments of ABCG2 gene

[0114] The experimental insects were collected from apple orchards in Yantai City, Shandong Province in April 2020, inoculated on 2-year-old apple seedlings, and when the aphids were successfully colonized and reproduced to a certain number, they were transferred to 3-month-old apple seedlings for experiments. The apple seedlings were placed against the PCR plate, and a disposable plastic cup was clamped with a 1.5mL PCR tube to keep the apple seedlings at a certain tilt angle. Then, a small brush was used to sweep away the excess wax secretions on the surface of nymphs and adults, and 0.4μL of dsRNA mixture was dripped on the back of apple aphids, and dsGFP mixture was dripped as a negative control. Each treatment had 30 adults, and the results were repeated 3 times. After dripping, they were placed in an incubator with a temperature of 25±1℃, a photoperiod of 12L:12D, and a relative humidity of 50±10% for 3 days to detect the expression of the ABCG2 transporter gene and observe the growth of apple aphids.

[0115] (2) Detection of silencing efficiency of ABCG2 gene

[0116] After 24h, 48h, and 72h of dripping dsElABCG2 and dsGFP, 10 surviving apple aphids were selected for each treatment, with 3 biological replicates. Total RNA was extracted and reversed to first-strand cDNA. EF1-α was used as the internal reference gene, and the transcription level of ABCG2 gene after RNAi was detected by qPCR. The results showed that compared with the control at 24h, the expression level of ABCG2 gene decreased by 43%, at 48h, the expression level of ABCG2 gene decreased significantly by 79%, and at 72h, the expression level decreased by 65% ​​( Figure 2 ). The qPCR primers are as follows:

[0117] qABCG2-F:GCCAGACAAGCACACACAAT

[0118] qABCG2-R:GGGCTTCAATGGTGGTAATG

[0119] EF1-α-F:TGTTGCAGCTGGTACTGGAG

[0120] EF1-α-R: CAGAGATTGGCACAAAAGCA

[0121] (3) Treatment with imidacloprid after RNAi increased the mortality of cottony apple aphids

[0122] The ABCG2 gene silencing effect was the best when the dsRNA was treated for 48h, so the lethal concentration (0.935mg / L) of imidacloprid was used to treat the apple aphid 48h after RNAi. The bioassay results showed that the mortality rate of the apple aphid in the dsGFP group was 58%, and the mortality rate of the apple aphid in the dsElABCG2 group was 87%, which increased the mortality rate of the apple aphid (p<0.05), indicating that the silencing of the expression of the ElABCG2 gene can increase the mortality rate of the apple aphid caused by imidacloprid ( Figure 3 ). Through the above-mentioned dsRNA drip operation method and device, the expression of ABCG2 gene was significantly inhibited, and the mortality rate of apple aphid was significantly increased, which provided a scientific basis for ABC gene as a target gene for preventing and controlling apple aphid.

[0123] The embodiments of the present invention are described in detail above, but the present invention is not limited to the described embodiments. Any modifications, equivalent substitutions and improvements made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for controlling apple aphids, characterized in that: The method is to reduce the expression of ABCG2 gene in the aphid during the process of controlling the woolly apple aphid, and use a drug that can control aphids; the reduction of the expression of ABCG2 gene in the aphid is to reduce the expression of ABCG2 gene by RNAi method, wherein the sequence of dsRNA used is SEQID NO: 2; the drug for controlling aphids is imidacloprid.

2. The method according to claim 1, characterized in that The sequences of the primer pair used to prepare the dsRNA are SEQ ID NO: 3 and SEQ ID NO: 4.

Images