Nanobody HYNb127 against Severe Acute Respiratory Syndrome Coronavirus 2 and Its Application
By constructing and screening the nanobody HYNb127 targeting the RBD domain of the Omickron variant of Severe Acute Respiratory Syndrome Coronavirus 2, the detection difficulties in the prior art are solved, and an efficient and low-cost detection method is achieved, which is suitable for the detection of the Omickron variant of Severe Acute Respiratory Syndrome Coronavirus 2.
Patent Information
- Application Number
- CN202310011581.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-01-05
- Publication Date
- 2025-08-01
- Estimated Expiration
- 2043-01-05
AI Technical Summary
The prior art is difficult to effectively develop specific antibodies against the RBD domain of the Omickron variant of severe acute respiratory syndrome coronavirus 2, resulting in strong infectiousness, fast transmission speed, strong immune evasion ability, and difficult detection.
A nanoantibody HYNb127 targeting the RBD domain of the Omickron variant of severe acute respiratory syndrome coronavirus 2 was developed, and an antibody library was constructed through phage display technology, and a high-affinity nanoantibody HYNb127 was screened out, and the antibody was expressed and purified by E. coli, and the detection kit was prepared.
It has achieved efficient detection of the Omickron variant of severe acute respiratory syndrome coronavirus 2. The antibodies are highly expressed in E. coli, with simple production, low cost, high yield and strong affinity, and are suitable for detection kits.
Smart Images

Figure CN116589568B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a nanobody HYNb127 against severe acute respiratory syndrome coronavirus 2, an expression plasmid, an expression host, and applications, belonging to the field of biotechnology. Background Art
[0002] Severe acute respiratory syndrome coronavirus 2 (SARS-COV-2) mainly expresses four structural proteins, namely spike protein S, envelope protein E, membrane protein M, and nucleocapsid protein N. Among them, the spike protein S plays a key role in the processes of virus attachment, infection, and transmission. It is the most important surface protein of the virus and has become an important target for neutralizing antibodies and vaccine design. The S protein includes an S1 subunit and an S2 subunit. During the virus infection process, the receptor binding domain (RBD) in the S1 subunit can bind to human angiotensin-converting enzyme 2 (ACE2); then the S2 subunit mediates the fusion of the virus with the host cell membrane. After fusion, the virus releases its genetic material into the host cell to complete the infection process. There are multiple mutations in the S protein of the Omicron variant of severe acute respiratory syndrome coronavirus 2, which affect the virus infection process, resulting in the characteristics of the Omicron variant of severe acute respiratory syndrome coronavirus 2, such as strong infectivity, fast transmission speed, strong immune evasion ability, relatively mild symptoms, strong concealment, and difficulty in detection. Therefore, it is urgent to develop antibodies against the RBD domain of the Omicron variant of severe acute respiratory syndrome coronavirus 2. Summary of the Invention
[0003] The purpose of the present invention is to provide a nanobody HYNb127 against the RBD domain of the Omicron variant of severe acute respiratory syndrome coronavirus 2, which can be used for the detection of the Omicron variant of severe acute respiratory syndrome coronavirus 2.
[0004] The technical solution adopted by the present invention is as follows: A nanobody HYNb127 against the RBD domain of the Omicron variant of severe acute respiratory syndrome coronavirus 2, and the amino acid sequence of the nanobody HYNb127 is shown as SEQ ID No.1.
[0005] Preferably, the coding gene sequence of HYNb127 is shown as SEQ ID No.2.
[0006] The present invention also discloses an expression plasmid of a nanobody, which expresses the above-mentioned nanobody HYNb127.
[0007] Preferably, the plasmid vector is PET-22b.
[0008] The present invention also discloses an expression host for nanobody, which is characterized in that the above-mentioned expression plasmid is transformed into an Escherichia coli host bacterium.
[0009] The present invention also discloses the application of the above-mentioned nanobody in detecting the Omicron variant of Severe Acute Respiratory Syndrome Coronavirus 2.
[0010] The present invention also discloses a kit for detecting the Omicron variant of Severe Acute Respiratory Syndrome Coronavirus 2, which contains the above-mentioned nanobody.
[0011] Advantages of the present invention:
[0012] 1. The nanobody of the present invention is a single-domain antibody heavy chain antibody (i.e., nanobody) that can specifically bind to the RBD domain of the Omicron variant of Severe Acute Respiratory Syndrome Coronavirus 2, and can be used for the detection of the Omicron variant of Severe Acute Respiratory Syndrome Coronavirus 2.
[0013] 2. Through the nanobody gene sequence and host cell disclosed by the present invention, the nanobody can be highly expressed in Escherichia coli, and the production process is simple, with low cost and high yield. Description of the Drawings
[0014] Figure 1 : Electrophoresis diagram of the nanobody gene in Example 1, where the first lane from the left is Marker and the second lane is the nanobody gene.
[0015] Figure 2 : PCR electrophoresis result of colony verification in Example 1, where the first lane from the left is Marker and the remaining lanes are 24 randomly selected colonies.
[0016] Figure 3 : SDS-PAGE diagram of the purification of the nanobody in Example 4. In the figure, control is the negative control, HYNb21(O) is the binding of the nanobody HYNb127 to the RBD domain of the SARS-CoV-2 Omicron variant, and HYNb21(W) is the binding of the nanobody HYNb127 to the RBD domain of the original strain of SARS-CoV-2.
[0017] Figure 4 : Sensing diagram of Omicron RBD and HYNb127.
[0018] Figure 4 Each band in represents different loading concentrations, and the loading amounts from bottom to top are 0.25 μg / ml, 0.5 μg / ml, 1 μg / ml, 2 μg / ml, and 4 μg / ml respectively. Detailed Embodiments
[0019] To further elaborate on the technical means and effects adopted by the present invention to achieve the intended invention purpose, the following will, in combination with the accompanying drawings and preferred embodiments, elaborate in detail on the specific implementation manners, structures, features and their effects of the present invention as follows.
[0020] Example 1: Construction of a nanobody library against the RBD domain of the Omicron variant of severe acute respiratory syndrome coronavirus 2
[0021] (1) The concentration of the RBD domain of the Omicron variant of severe acute respiratory syndrome coronavirus 2 (Sino Biological, product number: 40592-V49H7-B) was 500 micrograms per milliliter. Each time of immunization, 1 milligram of the SARS-CoV-2 Omicron variant RBD domain was mixed with Freund's adjuvant in equal volume, and one alpaca was immunized once a week for a total of 4 times. Except for the first time using complete Freund's adjuvant, incomplete Freund's adjuvant was used for the remaining times. During the immunization process, B cells were stimulated to express antigen-specific nanobodies.
[0022] (2) After 4 times of immunization, blood was collected from the vein, and the serum titer was measured by indirect ELISA. 100 ml of alpaca peripheral blood lymphocytes were extracted and total RNA was extracted, referring to the RNA extraction kit provided by QIAGEN.
[0023] (3) According to the instructions of the Super-Script III FIRST STRANDSUPERMIX kit, the extracted RNA was reverse transcribed into cDNA and the VHH chain was amplified by nested PCR. The first round of PCR:
[0024] Table 1 Primer sequences for the first round of PCR
[0025] Forward primer: GTCCTGGCTGCTCTTCTACAAGGC (SEQ ID No.3) Reverse primer: GGTACGTGCTGTTGAACTGTTCC (SEQ ID No.4)
[0026] Amplify the fragment between the heavy chain antibody leader peptide and antibody CH2, anneal at 54 °C, and perform 25 cycles;
[0027] Using the product of the first round of PCR as a template, perform the second round of PCR:
[0028] Table 2 Primer sequences for the second round of PCR
[0029] Forward primer: GATGTGCAGCTGCAGGAGTCTGGRGGAGG (SEQ ID No.5) Reverse primer: GGACTAGTGCGGCCGCTGGAGACGGTGACCTGGGT (SEQ ID No.6)
[0030] Amplify the fragment between the FR1 region of the heavy chain antibody and the long and short hinge regions (long fragment and short fragment), anneal at 60 °C, and perform 17 cycles, and recover the target fragment. The results are as Figure 1 shown. The DNA bands from left to right are: the first is the 100 bP molecular Marker, and the second nanobody gene electrophoresis band is about 500 bp.
[0031] (4) Use the restriction endonucleases (purchased from NEB) PstI and NotI to digest 20 μg of the pComb3 phage display vector (supplied by Biovector) and 10 μg of VHH, and ligate the two fragments with T4 DNA ligase (purchased from TaKaRa).
[0032] (5) Electrotransform the ligation product into electrocompetent cells TG1 to construct a nanobody phage display library for the RBD domain of the SARS-CoV-2 Omicron variant and determine the library capacity, and the library capacity is 1.8×10 8 ; At the same time, detect the insertion rate of the constructed library by colony PCR. The detection result shows that the insertion rate is about 100%. After the library construction is completed, to detect the insertion rate of the library, randomly select 24 clones for colony PCR. Forward primer: TCGAGGTCGACGGTATC (SEQ ID No.7), reverse primer: TGTAAAACGACGGCCAGT (SEQ ID No.8), Figure 2 Show the colony PCR results. The results show that the insertion rate has reached 100%.
[0033] Example 2: Screening process of nanobodies against the RBD domain of SARS-CoV-2 Omicron:
[0034] (1) Couple 200 μg of the RBD domain of the SARS-CoV-2 Omicron variant dissolved in 100 mmol pH 8.2 NaHCO3 to the enzyme-linked immunosorbent assay (ELISA) plate and place it at 4 °C overnight, and set up a negative control at the same time.
[0035] (2) Add 100 μl of 0.1% casein to two wells the next day and incubate at room temperature for 2 hours for blocking.
[0036] (3) After 2 hours, add 100 μl of phage (8×10 11 tfu immune alpaca nanobody phage display gene library) and incubate at room temperature for 1 hour.
[0037] (4) Wash 5 times with PBST (PBS containing 0.05% Tween 20) to wash away unbound phages.
[0038] (5) Dissociate the phages specifically binding to the RBD domain of the SARS-CoV-2 Omicron variant with triethylamine (100 mM), and infect Escherichia coli TG1 in the logarithmic growth phase. Produce and purify the phages for the next round of screening. Repeat the same screening process 3 - 4 times. During the continuous screening process, positive clones will be continuously enriched, thus achieving the purpose of screening specific antibodies against the RBD domain of the SARS-CoV-2 Omicron variant in the antibody library by phage display technology.
[0039] Example 3: Screening of specific single positive clones by phage enzyme-linked immunosorbent assay (ELISA):
[0040] (1) Pick 96 single colonies from the cell culture dishes containing phages after the above 3 - 4 rounds of screening and inoculate them into TB medium (1 L of TB medium contains 2.3 g of potassium dihydrogen phosphate, 12.52 g of dipotassium hydrogen phosphate, 12 g of peptone, 24 g of yeast extract, 4 mL of glycerol) containing 100 μg / mL of ampicillin. After growing to the logarithmic phase, add IPTG with a final concentration of 1 mM and culture overnight at 28°C.
[0041] (2) Obtain the crude antibody by osmosis and transfer the antibody to an ELISA plate coated with the antigen, and place it at room temperature for 1 hour.
[0042] (3) Wash away the unbound antibody with PBST, add a mouse anti-HA tag antibody, and place it at room temperature for 1 hour.
[0043] (4) Wash away the unbound antibody with PBST, add an anti-mouse alkaline phosphatase conjugate, and place it at room temperature for 1 hour.
[0044] (5) Wash away the unbound antibody with PBST, add the alkaline phosphatase chromogenic solution, and read the absorbance value on an ELISA instrument at a wavelength of 405 nm.
[0045] ((6) When the OD value of the sample well is more than 3 times that of the control well, it is judged as a positive clone well.
[0046] (7) Transfer the bacteria in the positive clone well to LB liquid medium containing 100 μg / mL of ampicillin for plasmid extraction and sequencing.
[0047] The gene sequences of each clone were analyzed using the sequence alignment software Vector NTI. Clones with the same CDR1, CDR2, and CDR3 sequences were regarded as the same clone, while those with different sequences were regarded as different clones. One nanobody HYNb127 was screened out. The amino acid sequence of HYNb127 is shown in SEQ ID NO: 1, and the nucleic acid sequence is shown in SEQ ID NO: 2.
[0048] Example 4: Expression and purification of nanobody in the host bacterium Escherichia coli:
[0049] The nanobody (VHH) obtained from the previous sequencing analysis was subcloned into the expression vector PET-22b, and the correctly sequenced recombinant plasmid was transformed into the expression host bacterium DE3. It was spread on a plate of LB solid medium containing 100 μg / mL ampicillin and incubated overnight at 37°C; (2) A single colony was selected and inoculated into 15 mL of LB culture medium containing 100 μg / mL ampicillin and cultured overnight on a shaker at 37°C; (3) 1 mL of the overnight culture was inoculated into 1 L of LB medium and cultured on a shaker at 37°C. When the OD value reached 0.6 - 1, IPTG was added and cultured overnight on a shaker at 28°C; (4) The next day, the bacteria were harvested by centrifugation; (5) The cells were lysed to obtain a crude antibody extract; (6) The antibody protein was purified by nickel column ion affinity chromatography. To obtain a high-purity antibody, the imidazole gradient elution method was used, and finally, a protein with a purity of over 90% could be prepared. The purified SDS-PAGE is shown in Figure 3 .
[0050] Example 5: Detection of the affinity between nanobody and the RBD domain of severe acute respiratory syndrome coronavirus 2 Omicron variant
[0051] In this detection, a Biacore T200 instrument was used. The SPR method was adopted to immobilize the antigen Omicron RBD on the SA chip, and the nanobody HYNb127 was used as the analyte for the experiment to detect the affinity between the antibody and the antigen. Approximately 155 RU of Omicron RBD was immobilized and bound to the nanobody HYNb127. The antigen-antibody binding sensorgram and affinity result data of HYNb127 are shown in Figure 4 , and the summary table of the detected affinity data between the antigen and the antibody is shown in Table 3.
[0052] Table 3 Summary of SPR affinity detection results
[0053] Ligand Analyte Association rate constant ka (1 / Ms) Dissociation rate constant kd (1 / s) Affinity KD (M) Chi² (RU²) U-value Omicron RBD HYNb127 3.003E+5 8.129E-4 2.707E-9 0.241 15
[0054] The above are only the preferred embodiments of the present invention, and do not impose any form of limitation on the present invention. Although the present invention has been disclosed above with the preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some changes or modifications to equivalent embodiments with equivalent changes within the scope of the technical solution of the present invention. However, as long as it does not depart from the content of the technical solution of the present invention, any brief modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention still fall within the scope of the technical solution of the present invention.
Claims
1. A nanobody HYNb127 against severe acute respiratory syndrome coronavirus 2, characterized in that: The amino acid sequence of the nanobody HYNb127 is shown in SEQ ID No.
1.
2. An expression plasmid for a nanobody, characterized in that Express the nanobody HYNb127 described in claim 1.
3. The expression plasmid according to claim 2, characterized in that The plasmid vector is PET-22b.
4. An expression host for a nanobody, characterized in that It is obtained by transforming the expression plasmid described in claim 3 into an Escherichia coli host bacterium.
5. A kit for detecting the Omicron variant of severe acute respiratory syndrome coronavirus 2, characterized in that: It contains the nanobody described in claim 1.
Citation Information
Patent Citations
Nano antibody based on novel coronavirus S protein S1 subunit and application of nano antibody
CN112062839A
Composition for detection of neutralizing antibody against SARS-cov2 variants, dectection method and kit comprising thereof
KR1020220124646A