A kind of fungus of the order Acanthophorales and its application in phosphate dissolving and antibacterial

Abstract

A fungus of the order Acanthocephala and its application in phosphate solubilization and antibacterial, belonging to the field of agricultural microbial technology. In order to isolate and screen out fungi whose phosphate solubilization activity has not been reported, and screen out phosphate solubilizing fungi with an optimal growth pH value of alkaline, and provide a theoretical basis and alternative strains for further research on phosphate solubilizing fungi, the present invention isolates a fungus SGSF1234 with high phosphate solubilization activity from the forest litter of Maoer Mountain, and combines the physiological and morphological characteristics of the strain to determine that the strain SGSF1234 is a new species of the family of the order Acanthocephala, and the strain has an antibacterial effect on Xanthomonas oryzae, and the optimal growth pH is alkaline, and it grows best at a pH of 8-9, which provides a theoretical basis and alternative strains for the utilization of phosphate solubilizing microorganisms under alkaline conditions.

Description

Technical Field

[0001] The invention belongs to the technical field of agricultural microorganisms, and in particular relates to a Scutellariae fungus and application thereof in phosphate dissolution and antibacterial. Background Art

[0002] Phosphorus is an indispensable mineral nutrient element in the growth and development of plants, accounting for about 0.2% of the dry weight of plants (Alori ET, Glick BR, Babalola O O. Microbial phosphorus solubilization and its potential for use in sustainable agriculture [J]. Frontiers in Microbiology, 2017, 8: 971.). However, most of the phosphorus in the soil exists in the form of insoluble phosphorus, and only 0.1% of the phosphorus content in the soil can be absorbed and utilized by plants. The phosphorus required for plant growth is not met, which will have a certain limit on the growth of crop yields. The application of chemical phosphorus fertilizer is the most direct, effective and convenient means to supplement the available phosphorus in the soil in agricultural production, but after entering the soil, phosphorus fertilizer will react with Al 3+ , Fe 3+=The combination of phosphorus and other metal ions (Li Ning, Wang Shanshan, Ma Lili, et al. Phosphorus solubilization ability of two efficient phosphate-dissolving bacteria and their effects on maize growth and phosphorus forms in red soil [J]. Journal of Plant Nutrition and Fertilizer, 2021, 27(2): 275–283.), which makes the utilization rate of phosphorus fertilizer by plants very low, which has an adverse effect on plant growth. Especially in alkaline soils, phosphorus is more likely to form insoluble phosphates with calcareous substances such as CaCO3 and Ca(HCO3)2, making it more difficult for plants to use phosphorus (Hopkins B, Ellsworth J. Phosphorus availability with alkaline / calcareous soil [C] Western nutrient management conference. Idaho Falls, ID: University of Idaho, 2005, 6(3–4): 83–93; Mosali J, Desta K, Teal RK, et al. Effect of foliar application of phosphorus on winter wheat grain yield, phosphorus uptake, and use efficiency[J]. Journal of Plant Nutrition, 2006, 29(12): 2147–2163.). If we can find phosphate-dissolving microorganisms that are suitable for surviving under alkaline conditions, it will have certain theoretical and practical significance.

[0003] Studies have found that there is a class of microorganisms that can convert insoluble phosphorus in the soil into soluble phosphorus, including bacteria, fungi and actinomycetes. Relatively speaking, bacteria are reported more in the research on phosphate-dissolving microorganisms, while phosphate-dissolving fungi are reported relatively less (Sharma SB, Sayyed RZ, Trivedi MH, et al. Phosphate solubilizing microbes: sustainable approach for managing phosphorus deficiency inagricultural soils[J]. Springerplus, 2013, 2(1): 587–600; Lin Qimei, Zhao Haiying, Zhao Xiaorong. Characteristics of phosphate rock dissolving by 4 strains of phosphate-dissolving bacteria and fungi[J]. Microbiology Bulletin, 2002, 29(6): 24–28.). Many of the phosphate-dissolving fungi discovered so far belong to the genus Aspergillus ( Aspergillus spp.), Penicillium ( Penicilliumspp.) and Talaromyces ( Talaromyces spp.), some scholars have studied Penicillium oxalicum ( P. oxalicum )、Penicillium funiculosum( P. funiculosum ) and other Penicillium fungi and Talaromyces cordiformis ( T. funiculosus )、Pine blue bacteria( T. pinophilus )、Yellow blue fungus( T. flavus ) and T. T. trachyspermus ) and other Bacillaceae fungi have been studied for their phosphate-solubilizing activity (Wahid O, Mehana T A. Impact of phosphate-solubilizing fungi on the yield and phosphorus-uptake by wheat and faba bean plants[J].Microbiological Research, 2000, 155(3): 221–227; Zeng Qi, Wang Jihua, Sui Haichao, et al. Screening, compounding and embedding immobilization and reuse of phosphate-solubilizing fungi in soybean rhizosphere[J]. Molecular Plant Breeding, 2019, 17(10):3353–3363.), and some scholars have also found that the phosphate-solubilizing fungus Aspergillus awamori ( A. awamori ) can promote the growth of pepper (Lai Jiantian, Yang Ting, Shi Fachao, et al. Identification of the phosphate-solubilizing ability of a strain of Aspergillus awamori in sugarcane leaf compost and its growth-promoting effect on pepper [J]. Acta Microbiologica Sinica, 2021, 61(1): 77–91.). The phosphate-solubilizing activity of fungi such as Penicillium, Aspergillus, and Cyanocotyle is relatively common and active, so there are more reports on phosphate-solubilizing bacteria of these genera, while there are fewer reports on the phosphate-solubilizing activity of fungi of other genera. This study aims to isolate and screen fungi whose phosphate-solubilizing activity has not been reported, and the optimal growth pH of this strain is alkaline, so as to provide a theoretical basis and alternative strains for further research on phosphate-solubilizing fungi. Summary of the invention

[0004] In order to isolate and screen out fungi with phosphate-dissolving activity that has not been reported, and to screen out phosphate-dissolving fungi with an optimal growth pH value that is alkaline, and to provide a theoretical basis and candidate strains for further research on phosphate-dissolving fungi, the present invention provides a strain of the order Scutellariae ( Chaetothyriales sp.) fungus SGSF1234, the specific technical scheme is as follows:

[0005] The first object of the present invention is to provide a kind of Chaetothyrialessp.) fungus SGSF1234, the strain is deposited in the China Center for Type Culture Collection, the deposit number is CCTCC NO: M 20222044, the deposit date is December 23, 2022, and the depository address is Wuhan University, Wuhan, China.

[0006] It is further defined that the optimal growth pH of the Acanthocephala fungus SGSF1234 is 8-9.

[0007] The second object of the present invention is to provide the use of the above-mentioned Scutellaria fungus SGSF1234 in improving the utilization rate of insoluble phosphorus in soil.

[0008] The third object of the present invention is to provide the above-mentioned Acanthocephala fungus SGSF1234 in the prevention and treatment of Xanthomonas oryzae ( Xanthomonas oryzae ) caused by plant diseases.

[0009] The fourth object of the present invention is to provide a phosphate-dissolving bacterial agent containing the above-mentioned Scutellaria fungus SGSF1234.

[0010] The fifth object of the present invention is to provide the use of the above-mentioned phosphate-dissolving bacteria agent in activating the sparingly soluble phosphorus in the soil.

[0011] The sixth object of the present invention is to provide a biological fertilizer containing the above-mentioned Scutellaria fungus SGSF1234.

[0012] The seventh object of the present invention is to provide the use of the above-mentioned biological fertilizer in activating the insoluble phosphorus in the soil.

[0013] The eighth object of the present invention is to provide the use of the above-mentioned biological fertilizer in preventing and controlling plant diseases caused by Xanthomonas oryzae.

[0014] The ninth object of the present invention is to provide an antibacterial agent containing the above-mentioned Acanthocephala fungus SGSF1234, which can inhibit the growth of Xanthomonas oryzae.

[0015] Beneficial effects of the present invention:

[0016] In this study, 10 Ascomycete fungi with ITS similarity ≤ 98.5% were isolated from the forest litter of Maoer Mountain. Three strains with phosphate solubilization activity were screened out using NBRIP solid medium, but the phosphate solubilization ring formed on the solid medium was not obvious, so the NBRIP medium was improved. As a result, two fungi formed obvious phosphate solubilization rings on the improved NBRIP+ medium. The molybdenum antimony colorimetric method was used to determine the effective phosphorus content of the two phosphate solubilizing fungi. The results showed that the strain SGSF1234 had the highest effective phosphorus content and the best phosphate solubilization effect. This experiment finally screened out a fungus SGSF1234 with high phosphate solubilization activity.

[0017] The optimal growth temperature, culture medium and pH value of strain SGSF1234 were measured, and it was found that the strain grew best at 25°C, and the type of culture medium had no obvious effect on it. The strain also had an optimal growth pH that was alkaline, and grew best at a pH of 8-9. This provides a theoretical basis and alternative strains for the utilization of phosphate-dissolving microorganisms under alkaline conditions.

[0018] Two plant pathogenic bacteria, Xanthomonas oryzae ( Xanthomonas oryzae ) and Pseudomonas syringae ( Pseudomonas syringae ) The antibacterial activity of strain SGSF1234 was tested, and the results showed that strain SGSF1234 only had antibacterial effect against Xanthomonas oryzae, but had no antibacterial activity against Pseudomonas syringae.

[0019] The strain SGSF1234 was sequenced, and its ITS, LSU, and SSU sequences had similarities ranging from 86.52% to 98.21%. The most similar taxa of these three sequences belonged to the order Scutellariae ( Chaetothyriales sp.) Herpotrichiellaceae sp.), combined with the physiological and morphological characteristics of the strain, it was determined that strain SGSF1234 was a new species of the family Chaetomidae in the order Acanthophorales. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Figure 2 is the colony morphology of strain SGSF1234 on different culture media; Figure 1 A in the table is MEA medium, Figure 1 B in the sample is PCA medium. Figure 1 C in the table is PDA medium, Figure 1 D in the table is YMA medium;

[0021] Figure 2 is the morphological structure diagram of strain SGSF1234; wherein, Figure 2 A, B, and C are conidia and spore-producing structures. Figure 2 The scale bars in each figure are 10 μm;

[0022] Figure 3 This is a diagram showing the phosphorus solubilization effect of strain SGSF1234 on NBRIP+ medium;

[0023] Figure 4 is the standard curve of phosphorus;

[0024] Figure 5 The figure shows the antibacterial activity test results of strain SGSF1234 against Xanthomonas oryzae; Figure 5 The P in the formula indicates fermentation with PD medium. Figure 5The A in the formula indicates fermentation with PDA medium. Figure 5 The N in the fermentation medium is PD+NIC. Figure 5 The R in the formula indicates rice solid medium fermentation. Figure 5 The S in the fermentation medium is SM. Figure 5 The Y in the formula is YES+vermiculite medium fermentation. Figure 5 C in the figure is a dimethyl sulfoxide control. DETAILED DESCRIPTION

[0025] In order to make the purpose, technical scheme and advantages of the present invention more clear, the present invention is further described in detail below in conjunction with specific implementation methods and the accompanying drawings of the specification. The experimental methods used in the following examples are conventional methods unless otherwise specified, and the materials, reagents, methods and instruments used are conventional materials, reagents, methods and instruments in the art unless otherwise specified, and can be obtained by those skilled in the art through commercial channels.

[0026] The litter samples selected in the present invention were collected from Maoershan Forest in Shangzhi City, Harbin City, Heilongjiang Province.

[0027] The plant pathogenic bacteria tested in the present invention are as follows:

[0028] Xanthomonas oryzae Xanthomonas oryzae ), Pseudomonas syringae ( Pseudomonas svringae ).

[0029] The culture medium involved in the present invention is as follows:

[0030] Potato Dextrose Agar (PDA) medium: 200 g / L potato, 20 g / L glucose, 20 g / L agar. No agar is added to make potato dextrose liquid medium (PD).

[0031] Yeast Malt Agar (YMA) medium: malt extract powder 10 g / L, yeast extract powder 2 g / L, agar 20 g / L.

[0032] Plate Count Agar (PCA) medium: 5 g / L tryptone, 2.5 g / L yeast extract powder, 1 g / L glucose, and 15 g / L agar.

[0033] Malt Extract Agar (MEA) medium: malt extract powder 40 g / L, sucrose 20 g / L, agar 20 g / L.

[0034] Luria-Bertani Agar (LBA) medium: 10 g / L tryptone, 5 g / L yeast extract powder, 10 g / L NaCl, 20 g / L agar. LB medium is obtained without agar.

[0035] Yeast Extract Saccharose (YES): yeast extract powder 20 g / L, MgSO4·7H2O 0.5 g / L, sucrose 150 g / L.

[0036] Potato glucose + nicotinamide (PD+NIC) liquid culture medium: potato 200 g / L, glucose 20 g / L, nicotinamide 100 g / L.

[0037] Seed culture medium: peptone 10 g / L, maltose 40 g / L, yeast extract powder 10 g / L, agar 4 g / L.

[0038] Super Malt medium (SM): malt extract powder 50 g / L, yeast extract powder 10 g / L, FeSO4·7H2O 1 mL / L, ZnSO4·7H2O 1 mL / L.

[0039] Rice culture medium: rice 571.43 g / L, glycerol 2 g / L, malt extract powder 2 g / L, sodium 10 g / L, potassium dihydrogen phosphate 1 g / L, magnesium sulfate heptahydrate 1 g / L, ferrous sulfate heptahydrate 0.05 g / L.

[0040] YES medium + vermiculite: vermiculite 2250 g / L, yeast extract powder 20 g / L, magnesium sulfate 0.5 g / L, sucrose 150 g / L, trace 1 mL / L.

[0041] NBRIP solid medium: glucose 10 g / L, Ca3(PO4) 25 g / L, MgCl2·6H2O 5 g / L, MgSO4·7H2O 0.25 g / L, KCl 0.2 g / L, NH4(SO4) 20.1 g / L, agar 20 g / L.

[0042] Pikovskaya (PVK) solid medium: glucose 10 g / L, Ca3(PO4) 25 g / L, NaCl 0.2 g / L, MgCl2·6H2O 5 g / L, MgSO4·7H2O 0.1 g / L, KCl 0.2 g / L, yeast extract powder 0.5 g / L, NH4(SO4) 20.5 g / L, MnSO4·H2O 0.002 g / L, FeSO4·7H2O 0.002 g / L, agar 20 g / L.

[0043] NBRIY solid medium: glucose 10 g / L, Ca3(PO4)25 g / L, NaCl 0.2 g / L, MgSO4·7H2O0.1 g / L, KCl 0.2 g / L, NH4(SO4)20.5 ​​g / L, MnSO4·H2O 0.002 g / L, FeSO4·7H2O 0.002 g / L, agar 20 g / L.

[0044] Based on the NBRIP medium, the medium formula was improved to make the phosphate solubilization activity more effective and avoid the screening leakage phenomenon to a certain extent. The specific formula is as follows:

[0045] Improved NBRIP medium (NBRIP+): glucose 25 g / L, Ca3(PO4)22 g / L, MgCl2·6H2O 4 g / L, MgSO4·7H2O 0.25 g / L, KCl 1 g / L, NH4(SO4)21 g / L, agar 20 g / L. No agar is added to make NBRIP+ liquid medium.

[0046] The test reagents involved in the present invention are as follows:

[0047] Molybdenum antimony storage solution: Measure 153 mL of 1.84 g / mL sulfuric acid and slowly pour it into 400 mL of distilled water, stir and cool to obtain sulfuric acid solution, then weigh 10 g of ammonium molybdate and dissolve it in 300 mL of distilled water at 60°C, cool to obtain ammonium molybdate solution, then slowly drop the sulfuric acid solution into the ammonium molybdate solution, and add 100 mL of 5 g / L potassium antimony tartrate solution, finally dilute with water to 1 L, shake well and store in a brown bottle.

[0048] Molybdenum antimony colorimetric reagent: Weigh 1.5 g ascorbic acid and dissolve it in 100 mL of molybdenum antimony storage solution. This solution is valid for 1 day and should be used immediately after preparation.

[0049] 2,4-Dinitrophenol indicator solution (2.5 g / L): Weigh 0.25 g 2,4-dinitrophenol and dissolve it in 100 mL water.

[0050] Phosphorus standard solution (5 mg / L): Weigh 0.439 g potassium dihydrogen phosphate, bake in an oven at 105°C for 2 h, cool, dissolve in 200 mL water, add 5 mL of 1.84 g / mL sulfuric acid, transfer to a 1 L volumetric flask, and dilute to the mark with distilled water to obtain a 100 mg / L phosphorus standard solution. Dilute this solution 20 times to obtain a 5 mg / L phosphorus standard solution. This solution should not be stored for a long time.

[0051] Example 1: Isolation and identification of the fungus SGSF1234

[0052] 1. Isolation and identification of fungi in litter

[0053] The litter samples were crushed into small particles, and a single strain was isolated using the spreading plate method. The strain DNA was extracted and PCR amplified. After sequencing, it was searched in the GenBank database (https: / / www.ncbi.nlm.nih.gov / genbank) to determine the taxonomic status of the strain.

[0054] Ten fungi with ITS sequence similarity ≤ 98.5% were isolated from the forest litter of Maoer Mountain in Shangzhi City, Harbin City, Heilongjiang Province, as shown in Table 1.

[0055] Table 1 Similarity analysis of ITS sequences of litter fungi in Maoer Mountain

[0056]

[0057] Note: “*” data are from NCBI website.

[0058] 2. Taxonomic study of strain SGSF1234

[0059] (1) Morphological analysis of strain SGSF1234

[0060] After the strain SGSF1234 was cultured in a 25℃ constant temperature incubator for 14 days, the morphology was as follows: Figure 1 As shown. On MEA medium, the colony diameter is 0.90±0.01 cm, the middle of the colony is white, and the surface of the colony is wrinkled, shaped like a petal. On PCA medium, the colony diameter is 0.90±0.03 cm, the color is olive green, the surface of the colony is wrinkled, and there are bulges from deep to shallow from the middle to the edge. On PDA medium, the colony diameter is 0.95±0.04 cm, the color is dark green, the surface of the colony is fluffy, and there are obvious irregular wrinkles. On YMA medium, the colony diameter is 0.90±0.06 cm, the color is olive green, and the surface of the colony is wrinkled.

[0061] Figure 2 The morphological structure of strain SGSF1234 is shown. The hyphae are regular and septate, with a width of about 1.90 μm. The asexual spores produced are conidia, with a round top and a triangular bottom, and a size of about (1.73-1.90) × (2.53-3.1) μm. There are small round holes on the hyphae wall, and the spores drill out of the round holes. They are regularly and densely arranged on both sides of the hyphae, and the spores are abundant.

[0062] (2) Analysis of the taxonomic status of strain SGSF1234

[0063] Different primers were used to amplify different regions of the DNA fragment of strain SGSF1234, wherein primers ITS1 / ITS4 were used to amplify ITS, and the obtained sequence fragment was shown in SEQ ID NO.1, primers LR0R / LR5 were used to amplify LSU, and the obtained sequence fragment was shown in SEQ ID NO.2, primers NS1 / NS4 were used to amplify SSU, and the obtained sequence fragment was shown in SEQ ID NO.3, primers Bt2a / Bt2b were used to amplify TUB, and the obtained sequence fragment was shown in SEQ ID NO.4, and primers RPB1-Af / RPB1-Cr were used to amplify RPB1, and the obtained sequence fragment was shown in SEQ ID NO.5. The specific information of the primers involved in the above amplification is shown in Table 2.

[0064] SEQ ID NO.1:

[0065] GGAAGGATCATTAAAGAGTAAGGGTCTTCTAGGCCCGATCTCCCAACCCTTTGTTTAATTGACCTCATGTTGCTTCGGCGGACCCGTCTCTGTCACAGGAGACCGCCGGAGGACCGTTAAACCGTCCTCTGGCCCGCGTCCGTCGATGGCCC ATATCAAACTCTTCATAAAATGTGTCTATGTCTGAGTAATAAACAAAAATTATAAGCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCAGTGAGTCAT CGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTATCACCCCTCAAGCCCCCGGCTTGGTGTTGGACGGTTTGGCGTGCCTTCTTTGTTGAAGCACACCCCTCCCAAAGATAATGACGGCGG CTGTTGGATCCCCGGTACACTGAGCTTTTACGAGCACGTACTGGAAACTAAGGAGCCACAGACGCCGGTCTACGTCTCTTTTTCGAAAGAGACACCCCTTTATTTCTAAGGTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCAT

[0066] SEQ ID NO.2:

[0067] ACCAGATGATTCGATTAGTCTTTCGCCCCTATACCCAAATTTGACGATCGATTTGCACGTCAGAACCGCTGCGAGCCTCCACCAGAGTTTCCTCTGGCTTCACCCTATTCAGGCATAGTTCATCATCTTTCGGGTCCCAACAGCTATGCTCTTACTCAAATCCATCCGAAGACATCAGGATCGGTCGATAGTGCAGCCGAAGCTTCCTACCTCCGTTCACTTTCATTCCGCGTTCCGGGTTTGACACCCAAACACTCGCATAGATGTTAGACTCCTTGGTCCGTGTTTCAAGACGGGTCGCTGACAACCATTACGCCAACATCCGAGCCGAAGCGCGTTCCTCGGTCCCGGGAGGTCGCATGACACCCTGGGCTATAAGTCTACGCCCGAAGGGTAGATACATTCCCAAGGTCTTTAACCGACCCCCAGAACCGATGTTGGCCTGGACACGGCGGAGTAACCCAACCAAAAGGAAGGGGGAACCGCCGCGCTCAAGTCTGGTTGTAAGCGCTTCCCTTTCAACAATTTCACATACTGTTTAACTCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCAATATTTAGCTTTAGATGAAATTTACCACCCATTTTGAGCTGCATTCCCAAACAACTCGACTCGTCGAAGGAGTTTCACATGAGCCCTACACCGATCCAAGACGGGATTCTCACCCTCTTTGACATTCTGTTCCAAGAAATTTAAACCGGTGCGGTACCCGAAACATCCTCTACAAATTACAACTCGGACCCCTAACGGAGCCAGATTTCAAATTTGAGCTGTTGCCGCTTCACTCGCCGTTACTAAGGCAATCCCTGTTGGTTTCTTTTCCTCCGCTT

[0068] SEQ ID NO.3:

[0069]

[0070] SEQ ID NO.4:

[0071] TGCTGCTTTCTGGTATGGACGAACACCCTTATCAACGCGACCCTACGATGTGCAATATGTCTGACGAATCCTCATAGGCAAATTATCTCTGGCGAGCACGGTTTGGACGGCTCAGGAGTGTAAGGACAATCTCACATTGGATTCAATTGGACCACAAGCTCATCCTTATTAGGTACAATGGCACCTCTGATCTCCAACTCGAACGCATGAATGTCTACTTCAATGAGGTAACTCATCACTTATATCTGCCAGAATCGAACACACGCTTACTTATCTCAAACAGGCTTCTGGAAACAAATATGTCCCTCGAGCCGTCCTCGTCGACTTGGAGCCTGGTACCATGGACGCCGTCCGAGCTGGTCCATTCGGACAGTTGTTCCGTCCTGATAACTTCGTTTTCGGCCAGAGCGGTGCTGGTAAGATTCTATGGTCTCTCCCTTTCTGAAGTGGACAAGTCAATAACCAGATTGCAGGAAACAACTGGGCCAAGGGT

[0072] SEQ ID NO.5:

[0073] TTGAGTGTCCCGGTCATTTTGGTGTTAAAAAGCGGGCTGCCCCCGTGTATCATTATGGTTTCATGTCCAAGGTCAAGAAGATTCTTGGAGACCGTTTGCCACAACTGTGGTAAAATCAAAGCGCTCGATGTGCGTTCCCATGCCAGCTTACAATCATTCAAACCAGTCACTAATAACCAAAA CAGGCCAGGAATTCCAACAGGCAATCAAGATTCGCGATCGCAAACGACGCTTCGACGCTCAGCCTTTGAAGGGTCCTCCTCAACCCAAGCATGGCGGGTGTGGCAATGCGCAACCGGATATCAGACGCACCGGTCTTTCATTGTGGGCATCGTGGAAGCCACGCAAAGGCGAAGATGACG AAGATACAACCCCGGAGAAGAAGCGAATCTTCCCTCCAAGATGCGTTGAACACATTCAGAACGTTGAGCGATGAGACATTGGAAATGATGGGATTGAGTCTCGACTATGCTAGACCTGAGTGGATGATCCTGACCGCACTTCCTGTGCCCCCTCCACCAGTTCGCCCTTCCATCAGCGTTGA CGGTAGTGGACAGGGTTCGCGTGGTGAAGACGACTTGACGTTCAAGCTGGGTGACATTATTAGAGCCAACCAAGCTGTTTTACGTACCGAAGTCGATGGCACCCCGGATCACATCAAGGTGGATCTTTGCGATCTCCATCAATACCACACTGCCACCTACATGGACAACAAAATCGCGGGA

[0074] Table 2 Primer information

[0075]

[0076] Note: R=A / G; Y=C / T; D=A / G / T; N=A / C / G / T.

[0077] Table 3 shows the most similar strains and similarities of the five sequences of strain SGSF1234. The most similar strains of the five sequences, ITS, LSU, SSU, TUB and RPB1, are fungi of four different genera, but all belong to the family of Chaetomium of the order Acanthophorales ( Herpotrichiellaceaesp.), and the similarity was 73.99% to 98.21%, which was relatively low. In addition, SGSF1234 had significantly different spore-producing structures and outstanding physiological characteristics (optimal growth pH was 8-9) compared with the four genera of the family Chaetomium in Table 3. Therefore, strain SGSF1234 was identified as a new species of the family Chaetomium in the order Acanthophorales that had not been described. Strain SGSF1234 was deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: M 20222044, the deposit date was December 30, 2022, and the deposit address was Wuhan University, Wuhan, China.

[0078] Table 3 Similarity of different sequences of strain SGSF1234

[0079]

[0080] Note: “*” data are from NCBI website.

[0081] Example 2: Phosphate solubilizing activity of strain SGSF1234

[0082] 1. Preliminary screening of phosphate dissolving activity

[0083] The phosphate solubilization circle method was used to preliminarily screen the phosphate solubilization activity of the target strain. The strain to be tested was inoculated onto NBRIP, NBRIY and PVK solid culture media using a sterile cork puncher and cultured in a 25°C incubator for 10 days to observe whether a transparent circle appeared on the culture medium.

[0084] The phosphate solubilization activity of the 10 fungi in Table 1 was preliminarily tested using NBRIP, NBRIY and PVK solid culture media. Among them, strains SGSF989, SGSF1209 and SGSF1234 showed certain phosphate solubilization activity on NBRIP solid culture media, but it was not easy to observe. In order to avoid missing the screening, the NBRIP culture media was improved, and its carbon, nitrogen, and inorganic phosphorus contents were optimized (increasing carbon and nitrogen content, reducing inorganic phosphorus content). It can be seen that on the improved NBRIP+ culture media, the phosphate solubilization activity was more obvious, and strains SGSF1209 and SGSF1234 showed obvious phosphate solubilization circles on the NBRIP-modified culture media (NBRIP+) (see Tables 4 and Figure 3 ), while strain SGSF989 had no difference from before improvement.

[0085] Table 4 Preliminary screening results of phosphate dissolving activity

[0086]

[0087] Note: “+” indicates that there is a dissolution ring, but it is not obvious; “++” indicates that there is an obvious dissolution ring; “-” indicates that there is no dissolution ring.

[0088] 2. Determination of available phosphorus content

[0089] Drawing of phosphorus standard curve: Pipette 0 mL, 1 mL, 2 mL, 3 mL, 4 mL, 5 mL, and 6 mL of phosphorus standard solution (5 mg / L) into a 100 mL conical flask, add distilled water to 30 mL, add 2 drops of 2,4-dinitrophenol indicator, shake well, add NaOH solution (4 mol / L) dropwise until the solution turns slightly yellow, then add H2SO4 solution (1 mol / L) dropwise until the yellow just fades, then add 5 mL of molybdenum antimony anticolorimetric agent, dilute to 50 mL mark with distilled water, and obtain 0 mg / L, 0.1 mg / L, 0.2 mg / L, 0.3 mg / L, 0.4 mg / L, 0.6 mg / L phosphorus standard series solutions, and color at room temperature of 25°C for 2 h. Determine the absorbance value of the solution after color development on a spectrophotometer with a detection wavelength of 700 nm. Draw a phosphorus standard curve with phosphorus concentration as the horizontal axis and absorbance as the vertical axis (see Figure 4 ).

[0090] The standard curve equation is y=0.5464x-0.0029 (R 2 =0.9988, x represents the phosphorus concentration in the solution, and y represents the absorbance value).

[0091] Molybdenum antimony colorimetric method: Use a sterile cork puncher to take the bacterial cakes of two target strains (SGSF1209 and SGSF1234) and inoculate them into the seed culture medium. Culture them in a constant temperature shake flask at 25°C and 180 r / min for 6 days. After 6 days, aspirate 200 μL of the seed culture solution into NBRIP+ liquid culture medium. Culture them in a constant temperature shake flask at 25°C and 180 r / min for 7 days. After 7 days, aspirate 10 mL of NBRIP+ liquid culture medium fermentation solution and centrifuge it at 12000 rpm for 10 min. Pipette 5 mL of supernatant into a 100 mL conical flask, add distilled water to 30 mL, add 2 drops of 2,4-dinitrophenol indicator, shake well and add 1 drop of H2SO4 (1 mol / L). At this time, the yellow color of the solution just fades and becomes colorless and transparent. Then add 5 mL of molybdenum antimony anti-color developer and make the volume to 50 mL. Color at room temperature of 25℃ for 2 h. Take the culture medium without bacterial solution as blank control and do the same treatment. Measure the absorbance value of the solution after color development on a spectrophotometer with a detection wavelength of 700 nm. Calculate the effective phosphorus content of each strain according to the standard curve equation.

[0092] The NBRIP+ liquid culture medium fermentation broth of strains SGSF1209 and SGSF1234 with obvious phosphorus solubilization rings was colored and the absorbance was measured. The corresponding effective phosphorus content was calculated according to the phosphorus standard curve. The results are shown in Table 5. In the improved NBRIP liquid culture medium (NBRIP+), strain SGSF1234 had the highest effective phosphorus content and the best phosphorus solubilization effect.

[0093] Table 5 Available phosphorus content of target fungal fermentation broth

[0094] Strain No. The closest taxon Available phosphorus content (mg / L) SGSF1209 Nigrograna locuta-pollinis 132.60±3.99 b SGSF1234 Capronia parasitica 159.44±10.04 a

[0095] Example 3: Antibacterial activity of strain SGSF1234

[0096] In the screening of phosphate solubilization activity, it was found that strain SGSF1234 had the highest phosphate solubilization rate and the best phosphate solubilization effect. The antibacterial activity was tested on it. The specific test method is as follows:

[0097] Six culture media were selected for small-scale fermentation of strain SGSF1234. The liquid culture media were PD medium, PD+nicotinamide (NIC) medium, and SM medium, and the culture was carried out in a constant temperature shake flask for 14 days. The solid culture media were rice medium, YES+vermiculite medium, and PDA medium, and the culture was carried out at room temperature for 21 days. The fermented culture medium was poured into an equal volume of ethyl acetate, and the crude extract was recovered after extraction for 24 hours. The crude extract was dissolved in dimethyl sulfoxide (DMSO) and used to test the antibacterial activity of the target fungus.

[0098] The antibacterial activity of plant pathogenic bacteria was tested by the punching agent diffusion method. An appropriate amount of bacteria was inoculated into LB liquid culture medium, and cultured in a constant temperature shaker at 25°C and 180 r / min. After 12-24 hours, 1 mL of bacterial solution was pipetted and added to the sterilized LBA culture medium at 50°C. The culture medium was gently shaken until the bacterial solution and the culture medium were evenly mixed, and then poured into a sterilized culture dish. The culture medium was placed in a clean bench without turning on the ultraviolet light for 30 minutes until the culture medium solidified. Seven round holes were evenly punched on the culture medium using a sterile puncher, and 10 μL of 6 kinds of crude extracts dissolved in DMSO reagent were pipetted into the 6 round holes of the culture medium with a pipette. The remaining 1 round hole was added with an equal amount of DMSO reagent as a control. Every 12 hours, the culture medium was observed to see if an inhibition zone was produced.

[0099] Two plant pathogenic bacteria, Xanthomonas oryzae and Pseudomonas syringae, were selected to test the antibacterial activity of strain SGSF1234. The antibacterial activity test results of strain SGSF1234 are shown in Figure 5 ,like Figure 5 As shown, strain SGSF1234 has antibacterial activity against the plant pathogenic bacteria, Xanthomonas oryzae.

[0100] Example 4: Determination of the optimal growth environment for strain SGSF1234

[0101] (1) Effects of different temperatures and culture media on the growth of strain SGSF1234

[0102] PDA, PCA, YMA and MEA culture media were selected to test the effects of different culture media on the growth of strain SGSF1234. The bacterial cakes of strain SGSF1234 were taken using a sterile punch and placed in the center of PDA, PCA, YMA and MEA culture media (one bacterial cake was placed on each culture medium), and cultured in constant temperature incubators at 15°C, 20°C, 25°C and 30°C, respectively. Each culture medium at each temperature was repeated 3 times, and the strain growth diameter was measured after 14 days. The experimental results are shown in Table 6. As shown in Table 6, when strain SGSF1234 was cultured at 15°C, 20°C and 25°C for 14 days, the growth condition on PDA medium was the best, and the growth condition on MEA medium was the best at 30°C. In general, the type of culture medium has little effect on the growth of strain SGSF1234. Temperature is an important factor affecting the growth of the strain, and too high or too low temperature is not conducive to the growth of the strain. 25°C is the most suitable temperature for the growth of the strain.

[0103] Table 6 Growth diameter of strain SGSF1234 under different temperatures and culture media

[0104]

[0105] Note: The diameter of the strain growth has been deducted from the size of the bacterial cake of 0.6 cm.

[0106] (2) Effects of different pH values ​​on strain growth

[0107] With 25℃ as the standard temperature and PDA medium as the test medium, 1 mol / L HCl and 1 mol / L NaOH were used to adjust the pH value of the medium, and PDA medium with pH values ​​of 6.0, 7.0, 8.0, 9.0, and 10.0 was prepared with the help of pH test paper. A bacterial cake of strain SGSF1234 was taken with a sterile puncher and placed in the center of the PDA medium. Each pH value was repeated 3 times. After sealing, the medium was placed in a 25℃ constant temperature incubator for 14 days, and the growth diameter on the 14th day was recorded. The experimental results are shown in Table 7. As shown in Table 7, strain SGSF1234 grew best on the medium with pH values ​​of 8.0 and 9.0, with a growth diameter of about 0.96±0.06 cm, and the growth diameter of the strain decreased from pH 8 to both sides.

[0108] Table 7 Growth diameter of strain SGSF1234 at different pH values

[0109] pH Growth diameter (cm) 6.0 0.79±0.01 b 7.0 0.85±0.13 ab 8.0 0.96±0.06 a 9.0 0.93±0.04 a 10.0 0.86±0.01 ab

[0110] Note: The diameter of the strain growth has been subtracted from the size of the bacterial cake of 0.6 cm.

[0111] Although the present invention has been disclosed as above in the form of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A Chaetothyriales sp. fungus SGSF1234, characterized in that: The deposit number of the Scutellariae fungus SGSF1234 is CCTCC NO: M 20222044.

2. Use of the Scutellariae fungus SGSF1234 according to claim 1 in improving the utilization rate of insoluble phosphorus in soil.

3. Use of the Scutellariae fungus SGSF1234 according to claim 1 in preventing and controlling plant diseases caused by Xanthomonas oryzae.

4. A phosphate-dissolving bacterial agent containing the Scutellariae fungus SGSF1234 according to claim 1.

5. Use of the phosphate-dissolving bacteria agent according to claim 4 in activating sparingly soluble phosphorus in soil.

6. A biological fertilizer containing the Scutellariae fungus SGSF1234 according to claim 1.

7. Use of the biological fertilizer according to claim 6 in activating insoluble phosphorus in soil.

8. Use of the biological fertilizer according to claim 6 in preventing and controlling plant diseases caused by Xanthomonas oryzae.

9. An antibacterial agent containing the Scutellariae fungus SGSF1234 according to claim 1, characterized in that: The antibacterial agent can inhibit the growth of Xanthomonas oryzae.

Images