A tobacco fragrance gene, its targeted sgRNA and applications

Abstract

The present invention provides a tobacco fragrance gene, its targeted sgRNA and applications, belonging to the technical field of tobacco breeding. A tobacco fragrance gene includes the NtBADH2a and / or NtBADH2b gene; the nucleotide sequence of the NtBADH2a gene is as shown in SEQ ID NO:1; the nucleotide sequence of the NtBADH2b gene is as shown in SEQ ID NO:2. The application of the tobacco fragrance gene as a target in improving the fragrance of tobacco. In view of the fact that the tobacco fragrance gene affects the content of tobacco fragrance substances through negative regulation, the present invention also provides the application of an sgRNA or gene editing system targeting the tobacco fragrance gene in constructing a tobacco line rich in fragrance substances. It can be seen that the tobacco fragrance gene provided by the present invention provides an effective target for tobacco breeding.

Description

Technical Field

[0001] The present invention belongs to the technical field of tobacco breeding, and particularly relates to a tobacco fragrance gene, its targeted sgRNA, and applications thereof. Background Art

[0002] Tobacco is one of the important cash crops in China. The aroma style of flue-cured tobacco is affected by varieties and ecological factors, and its expression degree is closely related to the chemical components of tobacco leaves. The nitrogen-containing compounds in flue-cured tobacco leaves account for about 30% of the tobacco composition, and their main forms of existence include amines, heterocyclic nitrogen-containing compounds, amino acids, nitriles, amides, imines, amino sugars, nitro compounds, and other nitrogen-containing compounds. [1] Among them, amino acid compounds can produce a large number of important components of tobacco aroma substances such as pyridines and pyrazines through the Maillard reaction. [1,2] At present, compared with high-quality foreign tobacco leaves, the insufficient aroma quality of flue-cured tobacco leaves in China is still one of the main factors affecting the quality of tobacco leaves. Discovering genes related to regulating the content of flavor substances in tobacco is an important means to create new high-quality aromatic tobacco germplasm resources.

[0003] Genome editing technology is to perform deletions, insertions, and base substitutions of bases or DNA fragments in the target genome region, mainly relying on artificial endonucleases (Sequence-Specific Nucleases, SSNs) and a series of functional modules. Following zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), the CRISPR / Cas9 nuclease, as a new generation of gene editing technology, represents a system that is significantly easier to design, highly specific, efficient, and very suitable for high-throughput and multiple gene editing of various cell types and organisms. [3] Le et al. developed a dual-guide RNA CRISPR / Cas9 system to combinatorially edit the tobacco eIF4E1 and eIF4E2 genes, and obtained loss-of-function mutant materials with high-level genetic resistance to PVYO. [4] Tian et al. successively achieved targeted mutations of the tobacco NtFAD2-2 and NtAn1 genes based on the CRISPR / Cas9 gene editing technology, and created high-oleic acid and high-lipid tobacco seed oils. [5,6] It shows that the CRISPR-Cas9 system provides a rapid and efficient method for tobacco seed lipid engineering. Gao et al. used the CRISPR / Cas9 system to knockout tobacco NtCCD8A and NtCCD8B, realized the regulation of the biosynthesis of strigolactones (SLs) in tobacco, and bred improved materials with increased bud branching, reduced plant height, increased number of leaves and nodes, reduced total plant biomass; shorter main roots and more lateral roots. [7]. The above research results indicate that the CRISPR / Cas9 system is an effective tool for targeted mutagenesis of the tobacco genome and can be applied to the genetic improvement of tobacco varieties.

[0004] [1] Xianxin Zhu. Differences in Conventional Chemical Components and Aroma Substances of Tobacco Leaves in Different Aroma-Type Producing Areas [D]. Hunan Agricultural University, 2017, 1-2.

[0005] [2] Ronghao Wang, Linlin Li, Dong Chen, Baoshun Jia, Meng Li, Xiangdong Shi. Research Progress on the Application of the Maillard Reaction in Tobacco Processing [J]. Science and Technology of Food Industry, 2019, 40(3): 345-350, 356.

[0006] [3] Ann R F, Hsu P D, Wright J, Agarwala V, Scott D A, Zhang F. Genome engineering using the CRISPR-Cas9 system [J]. Nature Protocols, 2013(8), 2281-2308.

[0007] [4] Le N T, Tran H T, Bui T P, et al. Simultaneously induced mutations in eIF4E genes by CRISPR / Cas9 enhance PVY resistance in tobacco [J]. Scientific reports, 2022, 12(1): 1-11.

[0008] [5] Tian Y, Liu X, Fan C, et al. Enhancement of tobacco (Nicotiana tabacum L.) seed lipid content for biodiesel production by CRISPR-Cas9-mediated knockout of NtAn1 [J]. Frontiers in plant science, 2021, 11: 599474.

[0009] [6] Tian Y, Chen K, Li X, et al. Design of high-oleic tobacco (Nicotiana tabacum L.) seed oil by CRISPR-Cas9-mediated knockout of NtFAD2-2[J]. BMC plant biology, 2020, 20(1): 1-12.

[0010] [7] Gao J, Zhang T, Xu B, et al. CRISPR / Cas9-mediated mutagenesis of carotenoid cleavage dioxygenase 8 (CCD8) in tobacco affects shoot and root architecture[J]. International journal of molecular sciences, 2018, 19(4): 1062. Summary of the Invention

[0011] In view of this, the purpose of the present invention is to provide a tobacco fragrance gene, and the double genes NtBADH2a and NtBADH2b in tobacco affect the content of fragrance substances in tobacco leaves in a negative regulation manner.

[0012] The present invention provides an sgRNA targeting a tobacco fragrance gene, which realizes the simultaneous mutation of two genes by specifically targeting and recognizing the same locus of the double genes NtBADH2a and NtBADH2b in tobacco, and has the characteristics of simple operation and high targeting effect.

[0013] The present invention provides a tobacco fragrance gene, including the NtBADH2a and / or NtBADH2b genes;

[0014] The nucleotide sequence of the NtBADH2a gene is shown in SEQ ID NO: 1;

[0015] The nucleotide sequence of the NtBADH2b gene is shown in SEQ ID NO: 2.

[0016] The present invention provides the application of the tobacco fragrance gene as a target in improving tobacco fragrance.

[0017] Preferably, the tobacco fragrance gene affects the content of tobacco fragrance substances through negative regulation.

[0018] Preferably, the tobacco fragrance substances include 2-acetyl-1-pyrroline.

[0019] The present invention provides an sgRNA targeting the tobacco fragrance gene, and the target sequence of the sgRNA is as shown in SEQ ID NO:9.

[0020] Preferably, it is formed by annealing a forward primer and a reverse primer;

[0021] The nucleotide sequence of the forward primer is as shown in SEQ ID NO:10;

[0022] The nucleotide sequence of the reverse primer is as shown in SEQ ID NO:11.

[0023] The present invention provides a gene editing system for knocking out the tobacco fragrance gene, which is pORE-Cas9 / gRNA;

[0024] The gRNA is the sgRNA.

[0025] The present invention provides the application of the sgRNA or the gene editing system in constructing a tobacco line rich in fragrance substances.

[0026] Preferably, in the tobacco line rich in fragrance substances, the NtBADH2a gene has the DNA fragment shown in SEQ ID NO:17; the NtBADH2b gene has the DNA fragment shown in SEQ ID NO:18.

[0027] Preferably, the method for constructing a tobacco line rich in fragrance substances includes the following steps:

[0028] Transforming tobacco with the gene editing system mediated by Agrobacterium, and screening to obtain a gene editing homozygous transgenic line;

[0029] Detecting the content of fragrance substances in the gene editing homozygous line, and selecting plants with higher content;

[0030] Identifying the selected plants as marker-free transgenic lines, and selecting marker-free transgenic materials.

[0031] The present invention provides a tobacco fragrance gene, including the NtBADH2a and / or NtBADH2b gene; the nucleotide sequence of the NtBADH2a gene is as shown in SEQ ID NO:1; the nucleotide sequence of the NtBADH2b gene is as shown in SEQ ID NO:2. The present invention firstly proposes a tobacco fragrance gene. In order to verify the biological function of this gene in tobacco, NtBADH2 mutant strains were created using the CRISPR / Cas9 system. The results show that the content of fragrance substances in the mutant strains is significantly higher than that of the wild type. It can be seen that the tobacco fragrance gene of the present invention affects the content of fragrance substances in tobacco in a negative regulatory manner. Therefore, the tobacco fragrance gene provided by the present invention provides an effective target for tobacco breeding. Brief Description of the Drawings

[0032] Figure 1 It is a schematic structural diagram of NtBADH2a and NtBADH2b genes;

[0033] Figure 2 It is the mutation type of T0 generation knockout plants;

[0034] Figure 3 It is a morphological diagram of marker-free transgenic lines. Detailed Implementation Manner

[0035]

[0036] The present invention provides the application of the tobacco fragrance gene as a target in improving the tobacco fragrance.

[0037] In the present invention, the tobacco fragrance gene preferably affects the content of tobacco fragrance substances through negative regulation. Experiments have proved that the use of the pORE-Cas9 / gRNA vector causes frameshift mutations in the NtBADH2a and / or NtBADH2b genes in tobacco, and the content of fragrance substances in the obtained tobacco mutants is extremely significantly increased compared with the wild type. The tobacco fragrance substances preferably include 2-acetyl-1-pyrroline. The present invention has no special limitation on the type of the tobacco, and well-known tobacco varieties in the art can be used. In the embodiment of the present invention, the tobacco variety is Honghuadajinyuan.

[0038] The present invention provides an sgRNA targeting the tobacco fragrance gene, and the target sequence of the sgRNA is as shown in SEQ ID NO:9. The sgRNA is preferably formed by annealing a forward primer and a reverse primer; the nucleotide sequence of the forward primer is as shown in SEQ ID NO:10; the nucleotide sequence of the reverse primer is as shown in SEQ ID NO:11. The annealing temperature is preferably 56°C.

[0039] The present invention provides a gene editing system for knocking out the tobacco fragrance gene, which is pORE-Cas9 / gRNA; the gRNA is the sgRNA in the above solution.

[0040] In the present invention, the preparation method of the gene editing system is preferably to ligate the CRISPR / Cas vector obtained by digesting the gRNA formed by annealing the forward primer and the reverse primer with BsaⅠ, transform the ligation product into DH5α competent cells, and obtain positive clones through plaque identification, and extract plasmids to obtain the gene editing system. The primers for plaque identification include U26-jiance-F and the downstream primer of the sgRNA.

[0041] The present invention provides the application of the sgRNA or the gene editing system in constructing a tobacco line rich in fragrance substances.

[0042] In the present invention, in the tobacco line rich in flavor substances, the NtBADH2a gene preferably has the DNA fragment shown in SEQ ID NO: 17 (CCTAGTGGCAGCTGTTCATCCGA); the NtBADH2b gene has the DNA fragments shown in SEQ ID NO: 18 (CCTAGTGCAGCTGTTCATCGA) and SEQ ID NO: 25 (CCTAGTGGCAGCTGTTCATCGA). In the embodiments of the present invention, the tobacco lines rich in flavor substances preferably include badh2-2, badh2-3, badh2-1, badh2-4, and badh2-8.

[0043] In the present invention, the method for constructing a tobacco line rich in flavor substances preferably includes the following steps:

[0044] Transforming the gene editing system into tobacco mediated by Agrobacterium, and screening to obtain gene-edited homozygous transgenic lines;

[0045] Detecting the content of flavor substances in the gene-edited homozygous lines, and selecting plants with higher contents;

[0046] Identifying the selected plants as marker-free transgenic lines, and selecting marker-free transgenic materials.

[0047] In the present invention, the screening method is preferably PCR amplification. The primers used for the PCR amplification include CrispaNtBADH2aF / CrispaNtBADH2aR and CrispaNtBADH2bF / CrispaNtBADH2bR. The reaction program of the PCR amplification is: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s; annealing at 58°C for 15 s; extension at 72°C for 20 s, for 37 cycles; extension at 72°C for 5 min.

[0048] In the present invention, the detection method for the content of flavor substances in the gene-edited homozygous lines is preferably gas chromatography-mass spectrometry and potassium hydroxide soaking method.

[0049] In the present invention, the method for identifying the marker-free transgenic lines preferably adopts PCR amplification method to identify sgRNA, 35S promoter sequence and Nos terminator sequence respectively. The amplification primers for identifying sgRNA are preferably the forward primer with the nucleotide sequence shown in SEQ ID NO:19 and the reverse primer with the nucleotide sequence shown in SEQ ID NO:20. The 35S promoter sequence is preferably the forward primer with the nucleotide sequence shown in SEQ ID NO:21 and the reverse primer with the nucleotide sequence shown in SEQ ID NO:22. The Nos terminator sequence is preferably the forward primer with the nucleotide sequence shown in SEQ ID NO:23 and the reverse primer with the nucleotide sequence shown in SEQ ID NO:24.

[0050] In the embodiments of the present invention, the sweet rhyme, delicate and round feeling, aroma quality, aroma quantity and sensory quality of the tobacco leaves of the new tobacco lines badh2-3-1 and badh2-3-2 after baking are all greatly improved compared with the control K326.

[0051] The following is a detailed description of a tobacco fragrance gene, its targeted sgRNA and applications provided by the present invention in combination with embodiments, but they cannot be construed as limiting the protection scope of the present invention.

[0052] Example 1

[0053] Preparation method of tobacco mutant materials with double gene knockout of NtBADH2a and NtBADH2b

[0054] 1.1 Plant materials

[0055] The tobacco variety Honghuadajinyuan is used for genetic transformation. The tobacco seeds are surface sterilized with 75% ethanol for 5 minutes and washed three times with sterile water. Then, the surface-sterilized seeds are germinated on 1 / 2ms medium containing 2% sucrose and 0.7% agar at 25±1°C. The seedlings are transferred to the soil and grown in a greenhouse at 25±1°C with a photoperiod of 16 hours and darkness of 8 hours.

[0056] 1.2 Target genes

[0057] Using the Ensembl online BLAST tool, the rice OsBADH2 protein sequence was used as the query sequence to perform a BLAST alignment with the tobacco genome data in the Solanaceae Genomic Network (SGN) (http: / / solgenomics.net / organism / Nicotiana_tabacum / genome), and two known coding sequences (mRNA_63486_cds and mRNA_31370_cds) of tobacco BADH2 were obtained. Specific primers for amplifying the full-length coding sequence of BADH2 were designed according to the two nucleotide sequences as follows:

[0058] BADH2a-F: ATGCAGATCCCTAGTCGGCA (SEQ ID NO:5);

[0059] BADH2a-R: TCACAGCTTTGAAGGTGACTTG (SEQ ID NO:6);

[0060] BADH2b-F: ATGGCAATTCCCAATATGCGG (SEQ ID NO:7);

[0061] BADH2a-R: TCACAGCTTTGAAGGTGACTTG (SEQ ID NO:8);

[0062] The leaves cDNA of common tobacco Honghuadajinyuan was used as the template for amplification, and the amplification system is shown in Table 1.

[0063] Table 1 Amplification system

[0064]

[0065] The reaction program was: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 1 min 30 s, for 37 cycles; 72°C for 5 min.

[0066] The PCR products were recovered and ligated to the T vector, and then the bacterial liquid was sequenced.

[0067] The results showed that the tobacco BADH2 protein had a high homology with SlBADH2 and was named NtBADH2a and NtBADH2b. The tobacco NtBADH2a gene was located on chromosome 1 of the tobacco genome. The full-length CDS was 1518 bp, with 15 exons, encoding 505 amino acids. The genomic sequence of the NtBADH2a gene was as shown in SEQ ID NO:1 in the sequence listing, and the CDS sequence was as shown in SEQ ID NO:2 in the sequence listing. The NtBADH2b gene was located on chromosome 1 of the tobacco genome. The full-length CDS was 1503 bp, also with 15 exons, and the translated protein contained 500 amino acids. The genomic sequence of the NtBADH2b gene was as shown in SEQ ID NO:3 in the sequence listing, and the CDS sequence was as shown in SEQ ID NO:4 in the sequence listing. The schematic diagrams of the structures of the NtBADH2a gene and the NtBADH2b gene were as Figure 1 shown.

[0068] 1.3. Target design

[0069] To study the biological functions of the NtBADH gene in tobacco, NtBADH2 mutant strains were created using the CRISPR / Cas9 system. Sequence analysis found that the sequences of NtBADH2a and NtBADH2b had a high consistency. The sequence similarity at the nucleotide level was 98.13%, and the sequence similarity at the amino acid level was 98.40%. In addition, these two genes had similar expression patterns. These results indicated that these two genes might have similar functions. Therefore, in the present invention, the NtBADH2a gene and the NtBADH2b gene in tobacco were used as target genes, and the online tool CRISPOR (http: / / crispor.tefor.net / crispor.py) was used to design the common sgRNA target site sequence Target1: CCTAGTCGGCAGCTGTTCATCGA (SEQ ID NO:9) in the NtBADH2a and NtBADH2b genes, which was located at the 25th - 47th nucleotides of SEQ ID NO:1 and the 10th - 32nd nucleotides of SEQ ID NO:3. It was also located on the first exon of both NtBADH2a and NtBADH2b ( Figure 1 ). The CRISPR / Cas9 vector containing this sgRNA could introduce mutations in both of these two genes simultaneously to obtain tobacco mutants with double gene knockout of NtBADH2a and NtBADH2b.

[0070] 14. Construction of CRISPR / Cas9 vector

[0071] The 23-bp target sequence was annealed and complementarily bound using forward and reverse primers (BADH2F: tgacCCTAGTCGGCAGCTGTTCATCGA, SEQ ID NO:10; BADH2R: aaacTCGATGAACAGCTGCCGACTAGG, SEQ ID NO:11), and then ligated into the CRISPR / Cas vector pORE-Cas9 / gRNA digested with BsaⅠ. The ligation product was transformed into DH5α competent cells and cultured at 37 °C for 18 - 20 h. Positive clones were detected by PCR of the bacterial plaques using U26-jiance-F (5’TTAGGTTTACCCGCCAATA 3’, SEQ ID NO:12) and the downstream primer of the target gene sgRNA.

[0072] 15. Obtaining Transgenic Positive Plants

[0073] The constructed CRISPR / Cas9 vector was transformed into tobacco mediated by Agrobacterium. Through kanamycin screening, a total of 63 T0 transgenic lines were obtained.

[0074] To detect the mutation situation at the target site, primer pairs for detection were designed on both sides of the target sites of NtBADH2a and NtBADH2b, and genomic DNA of T0 transgenic positive plants was amplified by PCR. The amplification primers for the NtBADH2a target were: CrispaNtBADH2aF: ATCTGTCCAGTGGACGTGACTA (SEQ ID NO:13); CrispaNtBADH2aR: AAGTTATCAAAACGCTTTAGCAG (SEQ ID NO:14); the amplification primers for the NtBADH2b target were: CrispaNtBADH2bF: GTACACATCTTCACAGACCTATGC (SEQ ID NO:15); CrispaNtBADH2bR: CAATAGATTGCAAGAGATCTTTGA (SEQ ID NO:16). The amplification system is shown in Table 2.

[0075] Table 2 Amplification System

[0076]

[0077] The reaction program was: pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 15 s, annealing at 58 °C for 15 s, extension at 72 °C for 20 s, for 37 cycles; extension at 72 °C for 5 min. The PCR products were subjected to 1% agarose gel electrophoresis, gel cutting and recovery, and then Sanger sequencing. Plants with base mutations or double peaks near the target site in the sequencing peak map were T0 mutant plants.

[0078] 1.6. Analysis of the mutation types of the target gene target sequences of T0 generation positive plants

[0079] The DNAMAN software was used to analyze the sequencing peak map ab1 file, and the mutation types and mutant genotypes of the target sites of the mutant plants could be obtained. Among the 63 T0 transgenic plants, 60 were identified as mutants, with a proportion of 95.24%. In 52 T0 transgenic positive plants, both NtBADH2a and NtBADH2b were mutated.

[0080] Further analysis found that among the 52 mutant plants, 8 T0 transgenic plants had homozygous mutations in both NtBADH2a and NtBADH2b (badh2-1, badh2-2, badh2-3, badh2-4, badh2-5, badh2-6, badh2-7, and badh2-8). The target regions of NtBADH2a and NtBADH2b in the remaining mutants all had bi-allelic or heterozygous mutations, and the mutation types mainly included base deletions and insertions at different mutation sites ( Figure 2 ), which in turn led to frameshift mutations in NtBADH2a and NtBADH2b.

[0081] Five mutant lines (badh2-2, badh2-3, badh2-5, badh2-6, and badh2-7) had a base deletion at the gRNA target sites of both the NtBADH2a and NtBADH2b genes. The badh2-1 and badh2-4 mutant lines had a base deletion at the gRNA target site of the NtBADH2a gene and two base deletions at the gRNA target site of the NtBADH2b gene; the badh2-8 mutant line had a base insertion at the gRNA target site of the NtBADH2a gene and a base deletion at the gRNA target site of the NtBADH2b gene ( Figure 2 ).

[0082] Example 2

[0083] Determination of the content of the flavor substance 2-AP in tobacco mutant materials

[0084] 2-Acetyl-1-pyrroline (2-AP) is a potent volatile compound that is widely present in nature and is a key flavor-related compound in various cereal products and vegetable-derived products. 2AP is biosynthesized in various crops such as rice and soybeans and has been found in plants such as Pandanus amaryllifolius leaves, spinach, taro corms, bread flowers (Strobilanthes and Tricyrtis cell suspension cultures), soybeans, mung beans, sorghum, cucumbers, barley, oats, and perfume coconuts. However, there are no reports on the synthesis and function of 2AP in the economic crop tobacco.

[0085] 1. Determination of 2-AP Content by Gas Chromatography-Mass Spectrometry

[0086] Pretreatment steps: Weigh 0.5 g of plant leaf powder into a 5 mL crimp-top vial, add 2 mL of extraction reagent, crimp and seal it, and place it in a water bath at 80 °C for extraction for 3 h; after taking it out and cooling to room temperature, centrifuge for 5 min, transfer the supernatant to an injection vial with a 200 μL inner cannula, and let it stand for 0.5 h for measurement.

[0087] Preparation of quality control samples: Take appropriate amounts of each sample powder to be measured and mix them evenly. Weigh 0.5 g of plant leaf powder from the mixed sample respectively and perform according to the above pretreatment steps.

[0088] Gas chromatography parameters: The chromatographic column is HP-5MS (30 m × 0.25 mm × 0.25 μm). The column temperature programming is to hold at 50 °C for 2 min, then increase to 120 °C at a rate of 10 °C / min and hold for 0 min; then increase to 250 °C at a rate of 30 °C / min and hold for 3 min. The inlet temperature is 170 °C; the carrier gas is high-purity (purity > 99.999%) helium; constant pressure splitless injection, and the injection volume is 1 μL.

[0089] Mass spectrometry parameters: Electron impact (EI) ion source, the ion source temperature is 230 °C; the ionization energy is 70 eV; the connection line temperature is 280 °C; the quadrupole temperature is 150 °C; MRM scanning mode, and the scanning range is m / z 35 - 500.

[0090] To detect the content of the flavor substance 2-AP in gene-edited lines, five T0-generation gene-edited homozygous lines badh2-1, badh2-2, badh2-3, badh2-4, and badh2-8 at the vigorous growth stage were selected and determined by a GC-QQQ gas chromatography-triple quadrupole mass spectrometer. The detection results of 2-AP content (see Table 3) showed that the 2-AP content of all gene-edited lines was extremely significantly (P < 0.01) higher than that of the wild-type control variety (WT). Among them, the average 2-AP content of badh2-3 was the highest, reaching 1.47 μg / g; the average content of badh2-2 was 0.94 μg / g, and the average 2-AP contents of badh2-1 and badh2-4 were 0.62 μg / g and 0.59 μg / g respectively. The average 2-AP content of badh2-8 was the lowest at 0.40 μg / g, while the average 2-AP content of the wild-type control was only 0.04 μg / g. Therefore, by using gene editing technology to mutate Badh2 in tobacco, fragrant materials with improved flavor traits can be obtained.

[0091] Table 3 Detection Results of 2-AP Content

[0092]

[0093]

[0094] 2.2 Potassium hydroxide soaking method

[0095] Refer to the method of Sood et al. (see Sood B C, Siddiq E A. A rapid technique for scent determination in rice[India][J]. Indian Journal of Genetics & Plant Breeding, 1975, 38(2): 268-275.) to qualitatively identify 2AP. The specific method is as follows:

[0096] Weigh 0.5 g of fresh leaves of the gene-edited homozygous lines badh2-1, badh2-2, badh2-3, badh2-4, and badh2-8 of tobacco T1 generation at the vigorous growth stage, cut them into pieces and place them in a petri dish containing 10 mL of 1.7% potassium hydroxide solution, cover the lid for 10 min, open the lid, and smell the odor.

[0097] The results showed that compared with the wild-type control, the gene-edited plants badh2-1, badh2-2, badh2-3, badh2-4, and badh2-8 had an obvious glutinous rice fragrance odor.

[0098] Example 3

[0099] Identification of a marker-free transgenic tobacco line

[0100] To obtain a gene-edited line without transgenic components, the gene-edited homozygous line badh2-3 with the highest 2-AP content was selected for further analysis. There was a one-base deletion in the gRNA target sites of the NtBADH2a and NtBADH2b genes in badh2-3, resulting in a frameshift mutation.

[0101] 48 plants of the badh2-3 line were planted, and the genomic DNA of individual plants was extracted. High-throughput KASP primers were designed using the gRNA sequence, 35S promoter sequence, and Nos terminator sequence respectively to detect and analyze their situations in the T1 generation lines. The primer information is as follows:

[0102] KfgS-F: AAAATAAGGCTAGTCCGTTATCAA (SEQ ID NO: 19);

[0103] KfgS-R: CGGTGCCACTTTTTCAAGTT (SEQ ID NO: 20);

[0104] 35s-5F: CGACAGTGGTCCCAAAGA (SEQ ID NO:21);

[0105] 35s-5R: AAGACGTGGTTGGAACGTCTTC (SEQ ID NO:22);

[0106] TNOS-F: CGTTCAAACATTTGGCAATAA (SEQ ID NO:23);

[0107] TNOS-R: TGATAATCATCGCAAGACCG (SEQ ID NO:24).

[0108] Amplification system: 5 μl diluted DNA (2 ng / μl), 5 μl KASP Master Mix, 0.1 μl Primer mix. Reaction procedure: Pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing and extension at 61°C for 60 s, 10 cycles, with the annealing and extension temperature decreasing by 0.8°C in each cycle; denaturation at 94°C for 20 s, annealing and extension at 57°C for 60 s, 30 cycles, and storage at 12°C. After the reaction, the fluorescence data of the KASP reaction products were read using the Arraytape scanning system, and the fluorescence scanning results were automatically converted into graphs.

[0109] The results showed that among the 48 T1 generation individual plants of badh2-3, a total of 10 plants were detected without gRNA, 35S promoter, and Nos terminator ( Figure 3 ). The sequencing results showed that their mutation characteristics were consistent with those of the T0 generation. Therefore, gene-edited lines without transgenic components could be isolated from the T1 generation lines, and the mutation characteristics of these lines at the target sites were consistent with those of their T0 generation, and this mutation of gene editing could be stably inherited to the next generation. According to the field performance, 2 individual plants were selected from the T1 generation lines for propagation, named badh2-3-1 and badh2-3-2 respectively.

[0110] Example 4

[0111] Sensory evaluation of the new strain of tobacco with the fragrance of glutinous rice

[0112] The created marker-free transgenic materials badh2-3-1 and badh2-3-2 were sown in the Jimo base in Shandong. Each material was planted in 3 plots with a row spacing of 120 cm and a plant spacing of 50 cm. The cultivation measures were carried out according to the local standardized production technical plan for flue-cured tobacco. The middle leaves were harvested at the mature stage for baking, and according to the flue-cured tobacco grading standard, the middle, orange-colored grade (C3F) leaves were selected for sensory evaluation.

[0113] The sensory evaluation results are shown in Table 4. The cured tobacco leaves of the new lines badh2-3-1 and badh2-3-2 have a glutinous rice sweet fragrance, while the cured tobacco leaves of the control Honghuadajinyuan do not have a glutinous rice fragrance.

[0114] Table 4 Sensory quality identification of new tobacco lines

[0115]

[0116] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. Use of an sgRNA targeting a tobacco fragrance gene in constructing a tobacco line rich in fragrance substances, wherein the target sequence of the sgRNA is as shown in SEQ ID NO: 9; The tobacco fragrance gene is NtBADH2a and / or NtBADH2b gene; The said NtBADH2a The nucleotide sequence of the gene is as shown in SEQ ID NO: 1; The said NtBADH2b The nucleotide sequence of the gene is shown in SEQ ID NO: 2; The sgRNA is formed by annealing a forward primer and a reverse primer; The nucleotide sequence of the forward primer is as shown in SEQ ID NO: 10; The nucleotide sequence of the reverse primer is as shown in SEQ ID NO:

11.

2. Use of a gene editing system for knocking out a tobacco fragrance gene in constructing a tobacco line rich in fragrance substances, wherein the gene editing system is pORE-Cas9 / gRNA; The gRNA is the sgRNA described in claim 1.

3. According to the use described in claim 1 or 2, characterized in that In the tobacco line rich in flavor substances NtBADH2a The gene has the DNA fragment shown in SEQ ID NO: 17; NtBADH2b The gene has the DNA fragment shown in SEQ ID NO:

18.

4. According to the use described in claim 2, characterized in that The method for constructing a tobacco line rich in fragrance substances includes the following steps: Transforming tobacco with the gene editing system mediated by Agrobacterium, and screening to obtain a gene-edited homozygous transgenic line; Detecting the content of fragrance substances in the gene-edited homozygous line, and selecting plants with higher content; Identifying the marker-free transgenic line of the selected plants, and selecting marker-free transgenic materials.

Images