Application of lncRNA HIF1A-AS3 gene inhibitor in preparing a drug for treating lung cancer
By using lncRNA HIF1A-AS3 gene inhibitor, the problem of lung cancer cell proliferation and metastasis in hypoxia environments is solved, and lung cancer treatment drugs and diagnostic kits are provided to achieve effective treatment and diagnosis of lung cancer.
Patent Information
- Application Number
- CN202310533983.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-05-12
- Publication Date
- 2025-07-22
- Estimated Expiration
- 2043-05-12
AI Technical Summary
There is a lack of lncRNA in the prior art that can specifically affect the proliferation and metastasis of lung cancer cells in an hypoxic environment, and diagnostic markers for lung cancer have not been fully developed.
The lncRNA HIF1A-AS3 gene inhibitor is used to inhibit the HIF1A-AS3 gene through dsRNA, antisense nucleic acid, small interfering RNA or microRNA, etc., and is used to prepare drugs for treating lung cancer and develop diagnostic kits to detect the expression of HIF1A-AS3 gene.
Under hypoxia, HIF1A-AS3 gene inhibitors can inhibit the proliferation and migration of lung cancer cells, and have the potential to become a diagnostic marker of lung cancer, providing new treatment and diagnostic methods for lung cancer.
Smart Images
Figure CN116602979B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biological medicine technology, and particularly relates to the application of lncRNA HIF1A-AS3 gene inhibitor in the preparation of drugs for treating lung cancer. Background Art
[0002] The occurrence of lung cancer is not only related to smoking, but also stress is an important factor. Recent studies have shown that in addition to being related to abnormally expressed proteins, long non-coding RNA (lncRNA) is also an important driving factor in the development of lung cancer. Most of the lncRNAs found so far have been screened in in vitro cultured cells, and there are great differences in the in vitro and in vivo culture environments, especially the hypoxic state, and there is no convincing functional lncRNA.
[0003] The present invention uses chronically stressed mice as a model, and expects to screen a novel lncRNA that is related to the occurrence and development of lung cancer caused by chronic stress, can specifically affect the proliferation and metastasis ability of lung cancer cells in a hypoxic environment, and can be used for the diagnosis of lung cancer. Summary of the Invention
[0004] In view of this, one of the purposes of the present invention is to provide the application of lncRNA HIF1A-AS3 gene inhibitor in the preparation of drugs for treating lung cancer; the second purpose of the present invention is to provide the application of reagents for detecting the expression of lncRNA HIF1A-AS3 gene in the preparation of lung cancer diagnostic kits; the third purpose of the present invention is to provide the use of lncRNA HIF1A-AS3 gene in screening drugs for treating lung cancer.
[0005] To achieve the above purposes, the present invention provides the following technical solutions:
[0006] 1. The application of lncRNA HIF1A-AS3 gene inhibitor in the preparation of drugs for treating lung cancer.
[0007] Preferably, the nucleotide sequence of the lncRNA HIF1A-AS3 gene is as shown in SEQ ID NO.1.
[0008] Preferably, the lncRNA HIF1A-AS3 gene inhibitor is dsRNA, antisense nucleic acid, small interfering RNA, microRNA that takes the lncRNA HIF1A-AS3 gene or its transcript as the inhibitory target or silencing target, or a construct that can express or form the dsRNA, antisense nucleic acid, small interfering RNA, microRNA.
[0009] Preferably, the nucleotide sequence of the small interfering RNA is:
[0010] shRNA1: GAGCCAAGACAAGGGAATAAATTCAAGAGATTTATTCCCTTGTCTTGGCTCTTTTTT; or
[0011] shRNA2: TCCCAAAGTGCGAGGATTATATTCAAGAGATATAATCCTCGCACTTTGGGATTTTTT; or
[0012] ShRNA3: ATGCATGGTGCTTACTAATAATTCAAGAGATTATTAGTAAGCACCATGCATTTTTTT.
[0013] 2. Use of a reagent for detecting the expression of lncRNA HIF1A-AS3 gene in the preparation of a lung cancer diagnostic kit.
[0014] Preferably in the present invention, the nucleotide sequence of the lncRNA HIF1A-AS3 gene is as shown in SEQ ID NO.1.
[0015] Preferably in the present invention, the kit comprises the primer sets shown in SEQ ID NO.2 and SEQ ID NO.3.
[0016] 3. Use of lncRNA HIF1A-AS3 gene in screening lung cancer therapeutic drugs.
[0017] The nucleotide sequence of the lncRNA HIF1A-AS3 gene is as shown in SEQ ID NO.1.
[0018] The beneficial effects of the present invention are as follows: The present invention discovers a novel lncRNA HIF1A-AS3 that is closely related to the development of lung cancer. The cellular localization and function of this non-coding RNA have not been reported. HIF1A-AS1 is activated in response to stress, mainly located in the nucleus, and is slightly expressed in the cytoplasm. The expression of HIF1A-AS3 in lung cancer tissues is higher than that in adjacent tissues, and the expression in the serum of lung cancer patients is higher than that in healthy people. The expression of HIF1A-AS1 is positively correlated with the expression of HIF-1ɑ, VEGF, CD206, and CD11b. Overexpression of HIF1A-AS3 in A549 and H1299 cells promotes the expression of HIF-1ɑ and VEGF, and knockdown of HIF1A-AS3 inhibits the expression of HIF-1ɑ and VEGF. Under hypoxic conditions, overexpression of HIF1A-AS3 can promote the proliferation and migration of lung cancer cells. HIF1A-AS3 may play a pro-cancer role and has the potential to become a lung cancer diagnostic marker. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] To make the objectives, technical solutions and beneficial effects of the present invention clearer, the present invention provides the following attached drawings for illustration:
[0020] Figure 1 Experiment on chronic stress promoting the growth of subcutaneous tumors in mouse lung cancer;
[0021] Among them, A is the modeling process; B is the photographing of mouse tumor masses; C is the tumor growth curve; D is the tumor weight; E is the sucrose preference experiment of mice after modeling; F is the open field experiment of mice after modeling;
[0022] Figure 2 HIF1A-AS3 is elevated in tumor tissues after chronic stress;
[0023] Among them, A is the volcano plot of RNA-seq sequencing results; B is the heat map of differential genes in each group; C is the elevated transcriptional level of HIF1A-AS3 in the stress group; D is the localization of HIF1A-AS3 in lung cancer cells mainly in the nucleus; E is the in-situ hybridization that HIF1A-AS3 is mainly localized in the nucleus;
[0024] Figure 3 Chronic stress causes high expression of the HIF-1α / VEGF signaling pathway and M2-type macrophage markers in tumor tissues;
[0025] Among them, A-C are the detection of the expression levels of each gene in tumor tissues by RT-PCR; D-F are the correlation analysis of the expression levels of each gene;
[0026] Figure 4 Map of the pcDNA3.1-P2A-GFP(8M) vector;
[0027] Figure 5 Situation of HIF1A-AS3 knockdown and overexpression;
[0028] Among them, A shows that overexpression of HIF1A-AS3 in A549 cells promotes the expression of HIF-1ɑ and VEGF; B shows that overexpression of HIF1A-AS3 in H1299 cells promotes the expression of HIF-1ɑ and VEGF; C shows that knockdown of HIF1A-AS3 in H1299 cells inhibits the expression of HIF-1ɑ and VEGF; D shows the effect of overexpression or knockdown of HIF1A-AS3 on the expression of HIF-1ɑ under aerobic and hypoxic conditions;
[0029] Figure 6 Overexpression of HIF1A-AS3 promotes the proliferation and migration of lung cancer cells under hypoxic conditions;
[0030] Among them, A is the cell proliferation curve; B is the cell invasion experiment without Matrigel; C is the scratch wound healing experiment;
[0031] Figure 7To knockdown HIF1A-AS3 to inhibit the proliferation and migration of lung cancer cells;
[0032] Among them, A is the cell proliferation curve; B is the cell invasion experiment without Matrigel; C is the scratch healing experiment;
[0033] Figure 8 For the effect of HIF1A-AS3 on macrophage polarization;
[0034] Among them, A is the effect of overexpressing HIF1A-AS3 on the RNA levels of M1 and M2 macrophage markers; B is the effect of overexpressing HIF1A-AS3 on macrophage migration; C is the effect of overexpressing HIF1A-AS3 on the protein levels of M1 and M2 macrophage markers; D is the effect of knocking down HIF1A-AS3 on macrophage migration.
[0035] Figure 9 For the high expression of HIF1A-AS3 in lung cancer tissues and peripheral blood;
[0036] Among them, A is the expression of HIF1A-AS3 in paired lung cancer and adjacent tissues; B is the expression of HIF1A-AS3 in the peripheral blood of lung cancer patients and healthy people; C is the expression level of HIF1A-AS3 in immortalized bronchial epithelial cells and lung cancer cells. Detailed implementation manners
[0037] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the specific embodiments cited are not intended to limit the present invention.
[0038] The lncRNA screened by the present invention is HIF1A-AS3 (HIF1A-antisense RNA3), and its nucleotide sequence is shown in SEQ ID NO.1.
[0039] Example 1. Establishment of a mouse lung cancer model with chronic stress
[0040] Female BALB / c nude mice aged 4-6 weeks were selected. After 7 days of environmental adaptation, the mice were randomly divided into a control group and a stress group. The mice in the stress group were subjected to 2 hours of restraint every day. After 7 days of stress, 5×10 6 lung cancer cells A549 were inoculated under the armpit, and then the restraint was continued for 2 hours every day. The mice in the control group were not given any stress treatment and were subcutaneously inoculated with an equal amount of A549 cells at the same time as the mice in the stress group. The tumor size was measured every two days. After 45 days of tumor inoculation, the sucrose preference test (SPT) and open field test (OFT) were performed to detect the depressive and anxiety behavioral phenotypes of the mice, and then the tumor tissues were surgically dissected and weighed, as shown in Figure 1The results showed that the tumor size and weight in the stress group were significantly increased compared with those in the control group ( Figure 1 , B, C, and D); the mice in the stress group showed depressive and anxiety-like behaviors, with a decrease in sucrose solution intake ( Figure 1 , E), and a decrease in the residence time in the central area of the open field ( Figure 1 , F and G).
[0041] Example 2, RNA high-throughput sequencing
[0042] After establishing a chronic stress lung cancer model, the tumor tissues of mice were taken for transcriptome sequencing. As Figure 2 , A shows, compared with the control group, 2384 genes were up-regulated and 2305 genes were down-regulated in the stress group. The most significantly changed lncRNAs were screened out ( Figure 2 , B), and their expression levels in tumor tissues were detected by RT-PCR.
[0043] Example 3, RT-PCR experiment
[0044] The total RNA of mouse tumor tissues was extracted using a tissue total RNA extraction kit, and the RNA was reverse transcribed into cDNA using a PrimeScript TM RT Master Mix reverse transcription kit. The changes in genes were detected using the specific primers of each gene according to the method described in the instruction manual of the real-time fluorescence quantitative detection kit SYBR Premix Ex Taq TM , and GAPDH was used as an internal reference control for gene detection.
[0045] The primers used were as follows:
[0046] Human-HIF1A-AS3-F: 5’-tgtctttcctctccgtccca-3’ (SEQ ID NO.2);
[0047] Human-HIF1A-AS3-R: 5’-aaggatcgctttagcccagg-3’ (SEQ ID NO.3);
[0048] Human-HIF-1ɑ-F: 5’-gtttactaaaggacaagtcacc-3’ (SEQ ID NO.4);
[0049] Human-HIF-1ɑ-R: 5’-ttctgtttgttgaagggag-3’ (SEQ ID NO.5);
[0050] Human-VEGF-F: 5’-ctacctccaccatgccaagt-3’ (SEQ ID NO.6),
[0051] Human-VEGF-R: 5’-atctgcatggtgatgttgga-3’ (SEQ ID NO.7);
[0052] mouse-CD206-F: 5’-ctctgttcagctattggacgc-3’ (SEQ ID NO.8);
[0053] mouse-CD206-R: 5’-cggaatttctgggattcagcttc-3’ (SEQ ID NO.9);
[0054] mouse-CD11b-F: 5’-atggacgctgatggcaatacc-3’ (SEQ ID NO.10);
[0055] mouse-CD11b-R: 5’-tccccattcacgtctccca-3’ (SEQ ID NO.11);
[0056] Human-GAPDH-F: 5’-agaaggctggggctcatttg-3’ (SEQ ID NO.12);
[0057] Human-GAPDH-R: 5’-agggg ccatccacagtcttc-3’ (SEQ ID NO.13);
[0058] mouse-β-actin-F: 5’-gttggttggagcaaacatc-3’ (SEQ ID NO.14);
[0059] mouse-β-actin-R: 5’-cttatttcatggatacttggaatg-3’ (SEQ ID NO.15).
[0060] As Figure 2 shown by the RT-PCR results in C, compared with the control group, the expression level of HIF1A-AS3 in the stress group was significantly increased. Figure 3 As shown in A, B, and C, compared with the control group, the expression levels of HIF-1ɑ, VEGF, CD206, and CD11b in the stress group were increased. The correlation analysis of the expression levels of each gene is shown in Figure 3 D–F, indicating that chronic stress promotes the expression of HIF-1ɑ and VEGF in tumor tissues and increases the expression levels of the M2 macrophage markers CD206 and CD11b.
[0061] Example 4, RNA nucleocytoplasmic separation
[0062] Using a cytoplasmic and nuclear RNA extraction kit, the cytoplasm and nucleus of mouse lung cancer cells were separated, and RNA was extracted separately. The nuclear and cytoplasmic RNAs were reverse transcribed into cDNA, and the expression levels of lncRNA in the cytoplasm and nucleus were detected by RT-PCR, with GAPDH and U6 used as internal reference controls for cytoplasmic and nuclear gene detection, respectively. As Figure 2 , the results showed that HIF1A-AS3 was mainly distributed in the nucleus and a small amount was distributed in the cytoplasm, indicating that HIF1A-AS3 mainly functions in the nucleus.
[0063] Example 5, in situ hybridization experiment
[0064] Lung cancer cells were cultured on cover slips treated with polylysine, and then the cells were fixed with 4% paraformaldehyde and washed with distilled water; treated with H2O2 methanol solution at room temperature for 30 min and washed with distilled water; digested with freshly diluted pepsin in 3% citric acid at 37 °C or room temperature for 5 - 120 s to expose nucleic acid fragments; fixed with 1% paraformaldehyde at room temperature for 10 min; added 20 μL of pre-hybridization solution to each slide, placed in an incubator at 38 - 42 °C for 2 - 4 h, and the excess liquid was aspirated; added 20 μL of hybridization solution to each slide, hybridized overnight at 38 - 42 °C in an incubator; washed after hybridization, added blocking solution, blocked at 37 °C for 30 min; added biotinylated mouse anti-digoxigenin, placed at 37 °C for 60 min or at room temperature for 120 min, and washed with PBS; added SABC, at 37 °C for 20 min or at room temperature for 30 min, and washed with PBS; added biotinylated peroxidase, at 37 °C for 20 min or at room temperature for 30 min, and washed with PBS; stained with DAPI and washed with PBS; developed with DAB; counterstained with hematoxylin; dehydrated with alcohol, cleared with xylene, and sealed. As Figure 2 , the results showed that HIF1A-AS3 was mainly located in the nucleus.
[0065] Example 6, cell culture conditions (normal and hypoxic)
[0066] A549 and H1299 cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum in an incubator at 37 °C and 5% CO2. The full-length HIF1A-AS3 sequence was cloned into the pcDNA3.1-P2A-GFP(8M) vector through the AsisI / MluI restriction enzyme sites (this vector was synthesized by Vigene Biotechnology Co., Ltd., and the vector plasmid map is as Figure 4Construct the HIF1A-AS3 overexpression plasmid as shown. Clone the three shRNA sequences of HIF1A-AS3 into the pLent-U6-shRNA-CMV-copGFP-P2A-puro vector through BamHI and MluI to construct the knockdown plasmid of HIF1A-AS3.
[0067] The three shRNA sequences are as follows:
[0068] shRNA1: GAGCCAAGACAAGGGAATAAATTCAAGAGATTTATTCCCTTGTCTTGGCTCTTTTTTT (SEQ ID NO.16)
[0069] shRNA2: TCCCAAAGTGCGAGGATTATATTCAAGAGATATAATCCTCGCACTTTGGGATTTTTT (SEQ ID NO.17)
[0070] shRNA3: ATGCATGGTGCTTACTAATAATTCAAGAGATTATTAGTAAGCACCATGCATTTTTTT (SEQ ID NO.18)
[0071] Forty-eight hours after cell transfection with the knockdown or overexpression plasmid, the cells were placed in RPMI-1640 medium containing 2.5% fetal bovine serum and cultured for 6 h, and then the medium was replaced with RPMI-1640 medium containing 100 μmol / L CoCl2 and 10% fetal bovine serum to establish a hypoxia model. After continuous culture for 24 h, subsequent experiments were carried out.
[0072] As Figure 5 shown, A and B indicate that overexpression of HIF1A-AS3 promotes the expression of HIF-1ɑ and VEGF in A549 and H1299 cells, and C indicates that knockdown of HIF1A-AS3 in H1299 cells inhibits the expression of HIF-1ɑ and VEGF.
[0073] Example 7, Western Blot
[0074] H1299 cells were transfected with HIF1A-AS3 overexpression or shRNA knockdown plasmids. After 48 h, 100 μmol / L CoCl2 was added to simulate hypoxia for 24 h. The cells were collected and lysed rapidly on ice with RIPA lysis buffer to extract total proteins. The protein concentration was quantified using a BCA protein quantification kit. The protein samples were separated by SDS-PAGE gel electrophoresis, and the proteins were transferred to a PVDF membrane by wet transfer. The PVDF membrane was blocked with 5% non-fat milk at room temperature for 1 h. The corresponding primary antibodies were added and incubated overnight at 4 °C. After washing with TBST buffer, the secondary antibody was added and incubated at room temperature for 1 h. The membrane was washed with TBST, developed with ECL, and the gray value was analyzed.
[0075] The results are as Figure 5 , shown in D. Under aerobic conditions, the protein expression level of HIF-1ɑ was low; under hypoxic conditions, overexpression of HIF1A-AS3 promoted the protein expression of HIF-1ɑ, and knockdown of HIF1A-AS3 inhibited the protein expression of HIF-1ɑ. It shows that under hypoxic conditions, HIF1A-AS3 can regulate the expression of HIF-1α.
[0076] Example 8, CCK8 assay
[0077] H1299 cells in the logarithmic growth phase were seeded into 96-well plates, with 5000 cells per well. Each sample was set with 3 replicate wells, and 3 blank control wells were also set. At 0, 12, 24, 48, 72, and 96 h of culture, 10 μL of CCK-8 solution was added to each well. The culture plate was incubated in an incubator for 1 - 4 h, and the optical density (OD) value at 450 nm was measured using a SpectraMax M5 microplate reader. The cell proliferation rate was calculated as follows: (OD value of the experimental group - OD value of the blank group) / (OD value of the control group - OD value of the blank group) × 100%.
[0078] As Figure 6 , shown in A, the results showed that under aerobic conditions, there was no significant difference in the cell proliferation ability between the HIF1A-AS3 overexpression group and the control group; under hypoxic conditions, compared with the control group, the cell proliferation ability of the HIF1A-AS3 overexpression group was significantly increased. It shows that under hypoxic conditions, overexpression of HIF1A-AS3 promotes cell proliferation.
[0079] As Figure 7 , shown in A, the results showed that under aerobic conditions, there was no significant difference in the cell proliferation ability between the HIF1A-AS3 knockdown group and the control group; under hypoxic conditions, compared with the control group, the cell proliferation ability of the HIF1A-AS3 knockdown group was significantly decreased. It shows that under hypoxic conditions, knockdown of HIF1A-AS3 inhibits cell proliferation. ( Figure 6 , the figure in A is too small to see clearly and is split into several large figures)
[0080] Example 9: Cell perforation experiment
[0081] Take H1299 cells in the logarithmic growth phase and adjust the cell concentration to 1×10 5 cells / mL using serum-free DMEM medium. Take 150 μL of the cell suspension and add it to the upper chamber of the Transwell. Add 700 μL of DMEM medium or conditioned medium containing 20% fetal bovine serum to the lower chamber. After culturing for 24 h, take out the chamber, fix it with methanol for 20 min, wash it with PBS, add 0.1% crystal violet and stain for 20 min, wash the floating color with PBS, and observe and take pictures under the microscope. Randomly read 3 fields of view in each chamber to count the number of cells.
[0082] As Figure 6 shown in
[0083] As Figure 7 shown in
[0084] Example 10: Cell scratch wound healing experiment
[0085] Take H1299 cells in the logarithmic growth phase and inoculate them into a 6-well plate, with 5×10 5 cells per well. After culturing overnight, use a 200 μL pipette tip to make a "well" scratch perpendicular to the cell culture plate, gently wash it 3 times with PBS, add serum-free medium and continue culturing. Observe and take pictures under the microscope at 0 h and 48 h respectively, and use Image J software to calculate the scratch area and the scratch wound healing rate.
[0086] As Figure 6 shown in
[0087] As Figure 7, The C results showed that under aerobic conditions, compared with the control group, knocking down HIF1A-AS3 had no significant effect on the cell scratch healing ability; under hypoxic conditions, compared with the control group, knocking down HIF1A-AS3 significantly inhibited the cell scratch healing rate. This indicates that under hypoxic conditions, knocking down HIF1A-AS3 inhibits the cell scratch healing ability.
[0088] Example 11. Effect of HIF1A-AS3 on macrophage polarization
[0089] After H1299 cells were transfected with the HIF1A-AS3 overexpression plasmid or the shRNA knockdown plasmid for 48 h, they were treated with 100 μmol / L CoCl2 for 24 h. The cell culture medium was centrifuged to obtain the supernatant, which was the hypoxic conditioned medium. 700 μL of the conditioned medium was added to the lower chamber of the Transwell. After the macrophages were diluted with serum-free medium, 150 μL of the macrophage suspension was added to the upper chamber of the Transwell and cultured in an incubator for 24 h. The chambers were taken out, fixed with methanol for 20 min, washed with PBS, stained with 0.1% crystal violet for 20 min, washed with PBS to remove the floating color, and observed and photographed under a microscope. The cell numbers were counted by randomly reading 3 fields of view in each chamber.
[0090] As Figure 8 , The B results showed that under aerobic conditions, the conditioned medium overexpressing HIF1A-AS3 had no effect on the migration ability of macrophages; under hypoxic conditions, the conditioned medium overexpressing HIF1A-AS3 significantly promoted the migration ability of macrophages. The D results showed that under aerobic conditions, the conditioned medium knocking down HIF1A-AS3 had no effect on the migration ability of macrophages; under hypoxic conditions, the conditioned medium knocking down HIF1A-AS3 significantly reduced the migration ability of macrophages. This indicates that after knocking down HIF1A-AS3, the cytokines produced by lung cancer cells that induce macrophage migration decrease, resulting in a weakened macrophage migration ability.
[0091] As Figure 8 , The A results showed that under aerobic conditions, the conditioned medium overexpressing HIF1A-AS3 had no significant effect on the RNA levels of macrophage markers of M1 (CD86, iNOS) and M2 (CD206, Arg1) types; under hypoxic conditions, the conditioned medium overexpressing HIF1A-AS3 promoted the expression of RNA of macrophage markers of M2 (CD206, Arg1) type and inhibited the expression of RNA of macrophage markers of M1 (CD86, iNOS) type. This indicates that under hypoxic conditions, the conditioned medium overexpressing HIF1A-AS3 can induce macrophages to polarize into the M2 type.
[0092] As Figure 8, The C results showed that under aerobic conditions, the conditioned medium overexpressing HIF1A-AS3 had no significant effect on the protein levels of macrophage markers of M1 (CD86, iNOS) and M2 (CD206, Arg1) types; under hypoxic conditions, the conditioned medium overexpressing HIF1A-AS3 promoted the expression of macrophage marker proteins of M2 (CD206, Arg1) type and inhibited the expression of macrophage marker proteins of M1 (CD86, iNOS) type. It was shown that under hypoxic conditions, the conditioned medium overexpressing HIF1A-AS3 could induce macrophage polarization into M2 type.
[0093] Example 12, Database Analysis
[0094] Through bioinformatics analysis of the GENT1 database (http: / / gent2.appex.kr / gent2 / ), as Figure 9 , shown in A and B, HIF1A-AS3 was highly expressed in lung cancer tissues and the blood of cancer patients. As Figure 9 , shown in C, it was confirmed by RT-PCR that HIF1A-AS3 was highly expressed in lung cancer cell lines. It was shown that HIF1A-AS3 might play a carcinogenic role and had the potential to become a diagnostic marker for lung cancer.
[0095] The above-described embodiments are merely preferred embodiments given to fully illustrate the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or transformations made by those skilled in the art on the basis of the present invention are all within the protection scope of the present invention. The protection scope of the present invention shall be subject to the claims.
Claims
1. Use of an lncRNA HIF1A-AS3 gene inhibitor in the preparation of a medicament for treating lung cancer, characterized in that: The nucleotide sequence of the lncRNA HIF1A-AS3 gene is shown in SEQ ID NO.1, and the inhibitor of the lncRNA HIF1A-AS3 gene is one or more of the shRNAs with the following three nucleotide sequences: shRNA1: GAGCCAAGACAAGGGAATAAATTCAAGAGATTTATTCCCTTGTCTTGGCTCTTTTTT; shRNA2: TCCCAAAGTGCGAGGATTATATTCAAGAGATATAATCCTCGCACTTTGGGATTTTTT; shRNA3: ATGCATGGTGCTTACTAATAATTCAAGAGATTATTAGTAAGCACCATGCATTTTTTT.
2. Use of a reagent for detecting the expression of the lncRNA HIF1A-AS3 gene in the preparation of a lung cancer diagnostic kit, characterized in that: The nucleotide sequence of the lncRNA HIF1A-AS3 gene is shown in SEQ ID NO.1, and the reagent for detecting the expression of the lncRNA HIF1A-AS3 gene is the primer set shown in SEQ ID NO.2 and SEQ ID NO.3.