A qtl, molecular marker, amplification primer and application related to soybean storage tolerance

By locating QTLs on soybean chromosome 6 and designing SSR molecular markers and amplification primers, the problem of unexplored soybean seed storage tolerance was solved, enabling accurate identification of soybean variety storage tolerance and promoting the soybean breeding process.

CN116606955BActive Publication Date: 2026-02-10SOUTH CHINA BOTANICAL GARDEN CHINESE ACADEMY OF SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310724282.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-06-16
Publication Date
2026-02-10
Estimated Expiration
2043-06-16

AI Technical Summary

Technical Problem

In the existing technology, there is a gap in the research on QTLs related to the storage tolerance of soybean seeds, which leads to slow breeding progress and difficulty in effectively breeding and utilizing soybean varieties with storage tolerance.

Method used

A QTL located in the region 11459396bp-12310027bp on chromosome 6 of soybean, along with its SSR molecular marker and amplification primers, is provided for identifying soybean storage tolerance. The traits are determined by PCR amplification and electrophoretic analysis.

Benefits of technology

This technology enables effective identification of the storage tolerance of soybean varieties, supports soybean breeding, and improves breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116606955B_ABST
    Figure CN116606955B_ABST
Patent Text Reader

Abstract

The application discloses a QTL, a molecular marker, an amplification primer and application related to soybean storage tolerance. The QTL is located in the interval of 11459396bp-12310027bp of the 6th chromosome of soybean. The molecular marker is located in the interval of 11716582bp-11717006bp of the 6th chromosome of soybean. The amplification primer is as follows: the forward primer sequence is 5'-GAACACGGACCAAATAGCTTCTG-3'; and the reverse primer sequence is 5'-TACACCAACGGTATTTATTTTCC-3'. The application mines a QTL, a molecular marker, an amplification primer and application related to soybean storage tolerance, and by using them, the storage tolerance of soybean varieties can be effectively identified, thereby providing technical support for soybean breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of agricultural crops, specifically relating to a QTL, molecular marker, amplification primer, and application related to the storage tolerance of soybeans. Background Technology

[0002] Seed storability largely determines seed viability during storage and is of great significance in agriculture and ecology. Soybean seeds, rich in protein and oil, are an important food crop worldwide; however, the high levels of protein and fatty acids in soybean seeds make them more difficult to store than other food crops. Furthermore, seed storability is a complex quantitative trait, controlled by multiple genes and greatly influenced by the environment. This has intensified research on this trait. Breeding and utilizing soybean varieties with good storage tolerance is one of the most economical and effective measures. The development of molecular marker-assisted selection breeding has provided new avenues for accelerating the breeding process. In recent years, research on the genetic basis of soybean seed storability has yielded several QTLs (quantitative traitlocus) related to seed storability, but a large number of QTLs related to soybean seed storability remain to be discovered. To further improve soybean seed storability, it is crucial to discover and utilize new major-effect loci of soybean seed storability QTLs. Summary of the Invention

[0003] The purpose of this invention is to provide a QTL, molecular marker, amplification primer, and application related to soybean storage tolerance, in order to solve the above-mentioned technical problems.

[0004] In a first aspect, the present invention provides a QTL related to the storage tolerance of soybean, the QTL being located in the interval 11459396bp-12310027bp on soybean chromosome 6.

[0005] In a second aspect, the invention provides an SSR molecular marker for the QTL related to soybean storage tolerance, the molecular marker being located in the 11716582bp-11717006bp region of soybean chromosome 6.

[0006] In a third aspect of the present invention, the amplification primers for the SSR molecular marker are as follows:

[0007] Forward primer sequence 5' -GAACACGGACCAAATAGCTTCTG- 3'

[0008] Reverse primer sequence 5' -TACACCAACGGTATTTATTTTCC- 3'

[0009] A fourth aspect of the present invention provides the application of the QTLs associated with soybean storage tolerance, SSR molecular markers of the QTLs associated with soybean storage tolerance, or the amplification primers thereof in the identification of soybean storage tolerance traits.

[0010] A fifth aspect of the present invention provides a method for identifying the storage tolerance of soybeans using the aforementioned amplification primers, comprising the following steps:

[0011] S1. Extract genomic DNA from AGS292, K3 soybeans and soybean materials to be identified;

[0012] S2. PCR amplification of genomic DNA from AGS292, K3 soybeans and soybean materials to be identified was performed using amplification primers.

[0013] S3. Perform electrophoretic analysis on the amplification products. If the electrophoretic banding pattern of the amplification product of the soybean material to be identified is consistent with that of the amplification product of AGS292, it is identified as a soybean with low storage tolerance. If the electrophoretic banding pattern of the amplification product of the soybean material to be identified is consistent with that of the amplification product of K3, it is identified as a soybean with high storage tolerance.

[0014] This invention explores a QTL, molecular marker, amplification primer, and its application related to soybean storage tolerance. These can be used to effectively identify the storage tolerance of soybean varieties and provide technical support for soybean breeding. Attached Figure Description

[0015] Figure 1 This is a map of quantitative trait loci (QTLs).

[0016] Figure 2 Polyacrylamide gel electrophoresis images of K3, AGS292, and their hybrid offspring F2. Detailed Implementation

[0017] The present invention will now be described in detail with reference to specific embodiments, but this is not intended to limit the invention.

[0018] Example 1

[0019] I. Experimental Methods:

[0020] 1. Group building

[0021] Using the non-storable soybean variety AGS292 as the female parent and the storable soybean germplasm K3 as the male parent, a hybridization was carried out. Through single-seed propagation, nine generations of continuous self-pollination were conducted to obtain a recombinant inbred line (RIL) population containing 91 lines.

[0022] 2. Phenotypic identification

[0023] Germination experiments were conducted on naturally aged and fresh seeds. Naturally aged seeds were obtained by storing fresh seeds under natural environmental conditions (longitude: 113.367196, latitude: 23.181797) for 4 years. Thirty seeds were randomly selected from each soybean population for germination treatment, and the germination rate was recorded on the seventh day. Three parallel experiments were performed. Phenotypic differences between haplotypes were analyzed using t-tests.

[0024] 3. Positioning of QTL

[0025] Utilizing the previous work by Lu et al. A genetic linkage map was constructed to identify quantitative trait loci (QTLs) associated with soybean seed storage traits. By combining germination data from two consecutive years with the existing linkage map, a major-effect QTL locus, qSS-C2, was identified on chromosome C2, with LOD values ​​of 2.51 and 2.73, respectively, explaining 13.6% and 17.5% of the phenotypic variation. (See [link to relevant documentation]). Figure 1 The germination rates of fresh seeds of soybean varieties AGS292 and K3 were close to 100%, at 95.56% and 97.78%, respectively. After natural aging, the germination rates of AGS292 and K3 showed a significant difference, at 4.4% and 97.78%, respectively.

[0026] This study used 1,131 simple sequence repeat (SSR) tags and performed QTL analysis using QTL Network software. The composite interval mapping (CIM) method was applied, and a LOD threshold was established at a significance level of P < 0.05 after 1000 permutation tests. Using the same software, the multiple region mapping (MQM) method was employed to validate the QTLs identified by CIM. We set a LOD score of 2.5 as the minimum requirement for confirming the significance of QTLs within a specific genomic region.

[0027] II. Experimental Results

[0028] 1. The major QTL locus related to soybean storage tolerance in this invention is qSS-C2, located in the interval 11459396bp-12310027bp on soybean chromosome C2.

[0029] 2. Based on the aforementioned major-effect QTL loci, SSR molecular markers for QTLs related to soybean storage tolerance were screened. These molecular markers are located at 11716582 bp on soybean chromosome 6. 11717006bp interval, specifically: GAACACGGACCAAATAGCTTCTGTGTCATTCCACTATAAGCTTGCAATGGATTCAGAGGGTAGAGATTAAACAAAGTTAGAGAAAAGGTTCACCTGAGGTCTCTTGGTGTTTTGGTGGTTGGGTCTAGACCTATAAAGTGAGTGTAGTGGCTGAAGAGCCAGATCATAAAAGCATAAAATGGAAGACATAAAGACAGAGTGAAT CAATAGTTCAGAGAGATGAAGCAGAGAAAAACTAATTAGCTATGTGGCAGGTGGCAGGTGGCAGGTGGCAACAGGTCCCTCCTGTGGTTAGACTTGATGTAAAAAAAGATGAGAACTTGAGAGATTGCTCTGTCTTAGCAATTAGATTGAGAGAAAATGAACATAAAGAAGAGACCCCAAAAAACAAAATGGTGGCAGGAAAATAAATACCGTTGGTGTA (SEQ ID NO.1).

[0030] Amplification primers were designed for this SSR marker, and the amplification primers are as follows:

[0031] Forward primer sequence 5' -GAACACGGACCAAATAGCTTCTG- 3'

[0032] The reverse primer sequence is 5'-TACACCAACGGTATTTATTTTCC-3'.

[0033] 3. A method for identifying soybean storage traits using the aforementioned amplification primers, comprising the following steps:

[0034] S1. Extract genomic DNA from AGS292, K3 soybeans and soybean materials to be identified;

[0035] S2. PCR amplification of genomic DNA from AGS292, K3 soybeans and soybean materials to be identified was performed using amplification primers.

[0036] S3. Perform electrophoretic analysis on the amplification products. If the electrophoretic banding pattern of the amplification product of the soybean material to be identified is consistent with that of the amplification product of AGS292, it is identified as a soybean with low storage tolerance. If the electrophoretic banding pattern of the amplification product of the soybean material to be identified is consistent with that of the amplification product of K3, it is identified as a soybean with high storage tolerance.

[0037] Specific results are as follows Figure 2 As shown in Table 1, from Figure 2 As shown in Table 1, the electrophoretic banding pattern of the amplification products of soybean materials with low storage tolerance is consistent with that of the AGS292 amplification product, while the electrophoretic banding pattern of the amplification products of soybean materials with high storage tolerance is consistent with that of the K3 amplification product.

[0038]

Claims

1. An amplification primer for an SSR molecular marker to identify soybean storage tolerance QTLs, characterized in that, The amplification primers are as follows: Forward primer sequence 5' -GAACACGGACCAAATAGCTTCTG- 3' The reverse primer sequence is 5'-TACACCAACGGTATTTATTTTCC-3'.

2. The application of the amplification primers or SSR molecular markers according to claim 1 in the identification of soybean storage tolerance traits, wherein the SSR molecular marker is located in the 11716582bp-11717006bp interval of soybean chromosome 6, and the nucleotide sequence of the 11716582bp-11717006bp interval is shown in SEQ ID NO.

1.

3. A method for identifying the storage tolerance of soybeans, characterized in that, Includes the following steps: S1. Extract genomic DNA from AGS292, K3 soybeans and soybean materials to be identified; S2. PCR amplification of genomic DNA of AGS292, K3 soybeans and soybean materials to be identified was performed using the amplification primers described in claim 1. S3. Perform electrophoretic analysis on the amplification products. If the electrophoretic banding pattern of the amplification product of the soybean material to be identified is consistent with that of the amplification product of AGS292, it is identified as a soybean with low storage tolerance. If the electrophoretic banding pattern of the amplification product of the soybean material to be identified is consistent with that of the amplification product of K3, it is identified as a soybean with high storage tolerance.

Citation Information

Patent Citations

  • QTL related to low temperature resistance of soybean sprouting period, molecular marker, amplification primer and application

    CN114540536A

  • Molecular marker related to aging resistance of soybeans as well as amplification primer and application of molecular marker

    CN115725771A