Molecular marker primer for identifying rubber tree yunyan 3042, kit and application thereof
Patent Information
- Application Number
- CN202310663966.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-06-01
- Publication Date
- 2026-10-09
- Estimated Expiration
- 2043-06-01
AI Technical Summary
[0011] The beneficial effects of the technical solution provided in this disclosure are as follows: This invention provides molecular marker primers, kits, and applications for the identification of rubber tree Yunyan 3042. These molecular marker primers distinguish varieties by sequencing results of amplified products, such as differences in one or more bases between different sequences, or substitutions, insertions, deletions, or duplications, thereby enabling the identification of rubber tree Yunyan 3042. It can also distinguish rubber trees IAN873, GT1, Yunyan 774, and Reken 516, and the identification results are not affected by environmental or other human factors, thus accurately identifying rubber tree varieties.
Smart Images
Figure CN116622892B_ABST
Abstract
Description
Technical Field
[0001] This disclosure relates to the fields of molecular biology and genetic breeding, and in particular to a molecular marker primer, kit, and application for the identification of rubber tree Yunyan 3042. Background Technology
[0002] The rubber tree is a typical perennial tropical rainforest tree species, native to Brazil, Venezuela, and Guyana in the Amazon River basin of South America. It was later introduced to my country and is now mainly cultivated in Hainan, Yunnan, and Guangdong provinces. Natural rubber is produced by coagulating and drying the latex that flows from rubber trees during tapping. In recent years, my country's demand for natural rubber has continued to grow, widening the supply-demand gap. According to data from the Industry Information Network, in 2021, my country's natural rubber production was 85.1 tons, while demand was 594.9 tons, resulting in a self-sufficiency rate of only 14.30%.
[0003] In the current international situation, supply security faces numerous challenges, and domestic production needs to play a long-term role as a "ballast stone." Natural rubber possesses unique and excellent properties in fields such as weaponry, aircraft tires, high-explosive shock absorption, and high-altitude detection, indicating a promising future for the natural rubber tree industry.
[0004] Currently, the direct focus of rubber tree variety identification, authorization, and breeding is on traits, and trait testing remains the industry standard for the specificity testing of many plant varieties. However, trait performance is easily affected by environmental and human factors, and accurate identification takes several years. Rubber tree germplasm resources, important breeding materials, and varieties promoted in production suffer from the phenomenon of "different species with the same name" and "different names for the same species," which is detrimental to rubber tree variety breeding, authorization, rapid promotion, and intellectual property protection. In particular, the uncertainty regarding rubber tree varieties in actual production severely restricts the healthy and sustainable development of the rubber industry, and impure or even incorrect rubber tree seedling varieties will seriously affect the economic interests of rubber farmers.
[0005] Public content
[0006] To address the issue of inaccurate identification of the rubber tree Yunyan 3042, this disclosure provides a molecular marker primer, kit, and application for the identification of rubber tree Yunyan 3042. The technical solution is as follows:
[0007] On the one hand, this disclosure provides molecular marker primers for the identification of rubber tree Yunyan 3042, the molecular marker primers including an upstream primer and a downstream primer, the upstream primer being shown as SEQ ID NO: 1 in the sequence listing, and the downstream primer being shown as SEQ ID NO: 2 in the sequence listing.
[0008] On the other hand, this disclosure provides a kit for the identification of rubber tree Yunyan 3042, the kit comprising the above-mentioned molecular marker primers.
[0009] On another aspect, this disclosure provides the application of molecular marker primers for the identification of rubber tree Yunyan 3042, the application including: using molecular marker primers to identify rubber tree Yunyan 3042, the molecular marker primers including upstream primers and downstream primers, the upstream primers being shown as SEQ ID NO: 1 in the sequence listing, and the downstream primers being shown as SEQ ID NO: 2 in the sequence listing.
[0010] Furthermore, the application also includes the ability of the molecular marker primers to distinguish between rubber tree species IAN873, GT1, Yunyan 774, and Reken 516.
[0011] The beneficial effects of the technical solution provided in this disclosure are as follows: This invention provides molecular marker primers, kits, and applications for the identification of rubber tree Yunyan 3042. These molecular marker primers distinguish varieties by sequencing results of amplified products, such as differences in one or more bases between different sequences, or substitutions, insertions, deletions, or duplications, thereby enabling the identification of rubber tree Yunyan 3042. It can also distinguish rubber trees IAN873, GT1, Yunyan 774, and Reken 516, and the identification results are not affected by environmental or other human factors, thus accurately identifying rubber tree varieties. Attached Figure Description
[0012] To more clearly illustrate the technical solutions in the embodiments of this disclosure, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of this disclosure. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0013] Figure 1 This is a sequence comparison diagram named a~e provided in Embodiment 3 of this disclosure. Detailed Implementation
[0014] To make the objectives, technical solutions, and advantages of this disclosure clearer, the embodiments of this disclosure will be described in further detail below.
[0015] Example 1
[0016] This disclosure provides molecular marker primers for the identification of rubber tree Yunyan 3042. The primers include an upstream primer and a downstream primer. The upstream primer is shown in SEQ ID NO: 1 of the sequence listing, and the downstream primer is shown in SEQ ID NO: 2 of the sequence listing. Specifically, the sequence of the upstream primer is: ATATGTCAAAATGGCTCAACAGGAG, and the sequence of the downstream primer is: GCTTAGAGCAGGACATACAGAAGTA.
[0017] Example 2
[0018] This disclosure provides a kit for the identification of rubber tree Yunyan 3042, which includes the molecular marker primers provided in Example 1.
[0019] Example 3
[0020] This disclosure provides the application of molecular marker primers for the identification of rubber tree Yunyan 3042, the application of which includes: using the molecular marker primers provided in Example 1 to identify rubber tree Yunyan 3042.
[0021] Furthermore, the application also includes the ability of this molecular marker primer to distinguish between rubber tree species IAN873, GT1, Yunyan 774, and Reken 516.
[0022] Specifically, 42 rubber tree varieties were selected as the test samples, and the variety names are shown in Table 1.
[0023] Table 1 lists the names of the sample varieties to be tested.
[0024] DNA was extracted from the 42 samples to be tested. In practice, the DNA was extracted from the samples using a novel plant genomic DNA extraction kit manufactured by Tiangen Biotech (Beijing) Co., Ltd. Specific procedures were performed according to the instructions for this novel plant genomic DNA extraction kit.
[0025] Forty-two test samples were amplified using the labeled primers provided in Example 1 of this invention. Specifically, the amplification system included: 50 ng of DNA fragments from the test samples, 0.5 μL of 10 mM dNTPs (deoxy-ribonucleoside triphosphate), 0.5 μL of upstream primer, 0.5 μL of downstream primer, 2.5 μL of Tap Buffer, 0.2 μL of Taq enzyme, and ddH2O was added to bring the amplification system to 20 μL. The amplification program included: 95℃ for 3 min; (95℃ for 30 sec, 60℃ for 30 sec) × 30 cycles; 72℃ for 6 min. The amplified products were sequenced using next-generation high-throughput sequencing to obtain sequencing data. The sequencing data were aligned to the rubber tree reference genome (NCBI: PRJNA587314) using Bowtie2 software to obtain the sequencing results for each test sample.
[0026] The sequencing results were analyzed using Microsoft Office Excel software, revealing five different sequence types. These five sequence types were named a, b, c, d, and e, as shown in Table 2.
[0027] Table 2 shows the different sequences obtained from sequencing of 42 samples after amplification using molecular marker primer pairs.
[0028] Five different sequence types were compared using the DNASTAR lasergene 11 software. The comparison results are as follows: Figure 1 As shown, in Figure 1 Among the five different sequences, there are differences at eight base positions. Specifically, the sequence differences include: G / A at the 7th base position, G / T at the 11th base position, A / G at the 33rd base position, C / T at the 44th base position, G / A at the 45th base position, A / T at the 124th base position, A / C at the 137th base position, and G / T / C at the 158th base position.
[0029] Of the 42 samples to be tested provided in this embodiment, the primer pairs provided in this embodiment can effectively distinguish 5 samples to be tested. The different sequence combinations of the 5 samples to be tested are shown in Table 3.
[0030] Table 3 shows the different sequence combinations of the five tested samples that were distinguished.
[0031] As shown in Table 3, the five samples to be tested have different sequence combinations. It can be seen that the primers provided in Embodiment 1 of the present invention can amplify the sequence of Yunyan 3042, and the sequence combination is bce. It can also distinguish rubber trees IAN873, GT1, Yunyan 774 and Reken 516 according to the different sequence combinations.
[0032] Accuracy analysis of molecular marker primer identification for rubber trees
[0033] Accuracy analysis was performed using three reproducibility experiments. In this embodiment, three independent experiments were conducted using different personnel, different batches of reagents, and different laboratories to simulate the identification of different batches of rubber trees. The high reproducibility rate means that the identification results of different laboratories can be accurately compared with each other.
[0034] Reproducibility experiments were conducted on five rubber tree samples: Yunyan 3042, IAN873, GT1, Yunyan 774, and Reken 516. Each sample was tested three times, and the sequence combination of the results was recorded each time. The specific results are shown in Table 4.
[0035] Table 4 shows the results of the three repeated experiments.
[0036] As shown in Table 4, the sequence combinations were identical in all three replicate experiments. Therefore, the accuracy of the molecular marker primers provided in this embodiment of the invention is 100%. It is evident that the variety identification conclusions from different laboratories or different batches within the same laboratory in this embodiment of the invention exhibit high consistency, thus eliminating the need for parallel experiments to reduce experimental errors. This greatly facilitates the identification of rubber tree varieties.
[0037] This invention provides molecular marker primers, kits, and applications for the identification of rubber tree Yunyan 3042. The sequencing results of the markers are used to distinguish varieties, such as differences in one or more bases between different sequences, substitutions, insertions, deletions, or duplications, thereby enabling the identification of Yunyan 3042. Yunyan 3042 is an excellent triploid rubber tree. It can also distinguish rubber trees IAN873, GT1, Yunyan 774, and Reken 516. Furthermore, the identification results are unaffected by environmental or other human factors, thus accurately identifying rubber tree varieties.
[0038] The above description is merely an optional embodiment of this disclosure and is not intended to limit this disclosure. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this disclosure should be included within the protection scope of this disclosure.
Claims
1. A molecular marker primer for identifying rubber tree Yunyan 3042, characterized in that, The molecular marker primers include an upstream primer and a downstream primer, the upstream primer being shown as SEQ ID NO: 1 in the sequence listing, and the downstream primer being shown as SEQ ID NO: 2 in the sequence listing.
2. A reagent kit for identifying rubber tree Yunyan 3042, characterized in that, The kit includes the molecular marker primers as described in claim 1.
3. The application of a molecular marker primer for the identification of rubber tree Yunyan 3042, characterized in that, The application includes: using molecular marker primers to identify rubber tree Yunyan 3042, wherein the molecular marker primers include an upstream primer and a downstream primer, wherein the upstream primer is shown as SEQ ID NO: 1 in the sequence listing and the downstream primer is shown as SEQ ID NO: 2 in the sequence listing, to obtain the amplified product; The amplified product was subjected to next-generation high-throughput sequencing to obtain sequencing data; The sequencing data was aligned to the rubber tree reference genome NCBI: PRJNA587314 to obtain the sequencing results of the sample to be tested; Analysis of the sequencing results yielded five different sequence types, as shown in SEQ ID NO: 3 to SEQ ID NO: 7 in the sequence listing. When the sequence type is as shown in SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 7 in the sequence list, the sample to be tested is identified as rubber tree Yunyan 3042.
4. The application according to claim 3, characterized in that, The application further includes: using the molecular marker primers to distinguish between rubber tree species IAN873, GT1, Yunyan 774, and Reken 516; identifying the test sample as IAN873 when the sequence type is as shown in SEQ ID NO: 3 and SEQ ID NO: 7 in the sequence listing; identifying the test sample as GT1 when the sequence type is as shown in SEQ ID NO: 4 and SEQ ID NO: 5 in the sequence listing; identifying the test sample as 774 when the sequence type is as shown in SEQ ID NO: 6 and SEQ ID NO: 7 in the sequence listing; and identifying the test sample as Reken 516 when the sequence type is as shown in SEQ ID NO: 6 and SEQ ID NO: 7 in the sequence listing.