The use and interference fragments of key genes in regulating oocyte GVBD in vitro

Abstract

This invention belongs to the field of genetics technology and discloses the use and interference fragments of key genes in the in vitro regulation of GVBD in oocytes. Through transcriptome sequencing analysis of oocytes at different developmental stages (GV and GVBD), the transcriptional differences before and after GVBD were determined, differentially expressed genes were screened, and molecular regulatory and signaling pathway networks were constructed. The key factor RAP1B regulating oocyte GVBD was identified. This invention elucidates that Rap1B can regulate porcine oocyte GVBD by mediating the p38MAPK signaling pathway, providing important theoretical reference for enriching and improving the oocyte maturation mechanism. It will play a positive role in improving oocyte maturation quality and promoting the development of animal embryo engineering and even the pig industry.

Description

Technical Field

[0001] The invention belongs to the technical field of genetics, and in particular relates to the use of a key gene in regulating oocyte GVBD in vitro and an interference fragment. Background Art

[0002] Oocyte maturation is a key component of in vitro production of animal embryos. With the continuous advancement of assisted reproductive technology and cloning technology and the rapid development of emerging biotechnology, biological inventions such as animal reproductive development, animal genetic breeding and animal germplasm innovation have increasingly demanded the acquisition of high-quality oocytes in vitro. In recent years, with the deepening of oocyte in vitro maturation inventions, there have been a large number of reports on the invention of oocyte maturation mechanism, which has improved the quality of oocyte maturation in vitro to a certain extent. However, compared with oocytes matured in vivo, there are still large differences in maturation rate and maturation quality.

[0003] Compared with other cells, oocytes have unique and complex differentiation characteristics. The growth and development of mammalian oocytes are closely and interdependently related to the granulosa cells surrounding the oocytes and the somatic cells that wrap the cumulus-oocyte complex (Gilchrist et al., 2008). When taken out of the antral follicle, the oocyte is still completing the final growth and differentiation steps, which is the basis for the subsequent in vitro development of the oocyte, that is, the ability to maintain the fertilization of the oocyte and the subsequent embryonic development. From the perspective of the embryo, the current inventions of oocyte maturation are mainly reflected in maintaining the quality of oocytes, especially the use of related maturation culture factors to reduce the degeneration of cell functions and inhibit cell damage in vitro, and to improve the maturation rate and availability of oocytes through a variety of hormones and growth factors. At present, there are also a large number of inventions including simulating the living environment in mammals, or constructing embryo-like structures and endometrial tissues, and using bioengineering to extend the life of oocytes.

[0004] Germinal vesicle breakdown (GVBD), as a sign of the initiation of oocyte maturation, plays a vital role in correcting the oocyte maturation process and maintaining the consistency of oocyte cytoplasmic maturation and nuclear maturation. The occurrence of GVBD determines oocyte maturation. At present, although there are a large number of discoveries about oocyte maturation mechanisms, there is a lack of discoveries about the molecular mechanism of GVBD and the specific regulatory factors. Therefore, it is necessary to deepen the detailed discovery of the molecular mechanism regulating the occurrence of oocyte GVBD, and then improve the quality of oocyte cytoplasmic maturation and nuclear maturation, lay the foundation for obtaining high-quality mature oocytes in vitro, and provide important theoretical references for the discovery of animal reproduction and development processes.

[0005] Pigs are not only important farm animals in the livestock industry, but also serve as model animals for biomedical experiments.

[0006] Through the above analysis, the problems and defects of the existing technology are as follows: in the existing technology, the time point of GVBD occurrence in pig oocytes cannot be clearly defined, and high-throughput group sequencing of oocytes in GV and GVBD stages in different developmental time periods has not been performed to analyze the differential expression of RNA transcription, p38MAPK phosphorylation and changes in related molecular indicators before and after GVBD in pig oocytes. The molecular regulatory mechanism of GVBD in oocytes cannot be clarified, and an important theoretical reference cannot be provided for clarifying the molecular mechanism of oocyte maturation, which limits the practicality of obtaining high-quality animal oocytes and promoting the development of animal embryo engineering and animal production. Summary of the invention

[0007] In order to overcome the problems existing in the related art, the disclosed embodiments of the present invention provide a use and interference fragment of a key gene for regulating oocyte GVBD in vitro. The present invention uses porcine oocytes as experimental materials, conducts a lot of exploration on oocyte GVBD, and finally clarifies the time point of occurrence of porcine oocyte GVBD, and completes high-throughput group sequencing of oocytes in different developmental time periods GV and GVBD, and explores the differential expression of RNA transcription before and after GVBD in porcine oocytes, p38MAPK phosphorylation and changes in related molecular indicators, and finally reveals the molecular regulatory mechanism of oocyte GVBD, which provides an important theoretical reference for clarifying the molecular mechanism of oocyte maturation, and lays a solid foundation for further obtaining high-quality animal oocytes and promoting the development of animal embryo engineering and the progress of animal production.

[0008] The technical scheme is as follows: a use of a key gene to regulate oocyte GVBD in vitro, the key gene is Rap1B. The DNA is as shown in SEQ ID NO: 9, and is cloned and synthesized from oocytes.

[0009] In one embodiment, the key gene Rap1B regulates GVBD application of oocytes in vitro by mediating the MEKK6 / p38 MAPK liaison signaling pathway.

[0010] In one embodiment, the method for screening key genes for the use of the key genes in regulating oocyte GVBD in vitro comprises:

[0011] By performing transcriptome sequencing analysis on oocytes at different developmental time periods, GV and GVBD stages, we determined the transcriptional differences before and after GVBD in oocytes, screened out differentially expressed genes, constructed molecular regulatory networks and signal pathway networks, and screened out the key factor RAP1B that regulates GVBD in oocytes.

[0012] In one embodiment, differentially expressed genes including MAPKAPK3, CCSAP, BAZ2A, KDM6B, RAP1B, AK6, CDT1, KLF2, ADGRA3, CEP57, CCSAP20, and WRNIP1 were screened out, and the gene sequence was queried according to the NCBI website. Primers were designed using Primer5 primer design software, and GV stage oocytes were set as the control group and GVBD stage oocytes were set as the experimental group. The two groups of oocytes were tested by qRT-PCR, and then the expression of the mRNA level of the Rap1B gene at different time points during oocyte development was detected, the localization of Rap1B in oocytes at different stages, and the Rap1B signal transduction pathway pattern was predicted by high-throughput sequencing. Through the prediction of high-throughput sequencing results, it was determined that Rap1B plays a role in transducing signals as a MEK6 / p38MAPK liaison upstream signal molecule during the GVBD process.

[0013] In one embodiment, the in vitro overexpression vector constructed using the key gene in the use, the DNA is as SEQ ID NO: 10.

[0014] In one embodiment, the method for constructing the overexpression vector comprises:

[0015] Step 1, Rap1B primer design and amplification, according to the gene sequence of pig Rap1B provided by NCBI website and the sequences on both sides of the SpeI restriction site in P-EASY-T3, the cloning primer sequences are designed, and the cloning primer sequences include SEQ ID NO: 1 and SEQ ID NO: 2;

[0016] Step 2, agarose gel electrophoresis and gel recovery;

[0017] Step 3, connection and transformation of pEASY-T3 vector and Rap1B; the DNA sequence of pEASY-T3 vector is SEQ ID NO: 11;

[0018] Step 4, bacterial liquid PCR detection and sequencing;

[0019] Step 5, linearize Rap1B, use a plasmid extraction kit and a gel recovery kit to obtain the pEASY-T3 vector plasmid inserted with Rap1B, use the restriction endonuclease SpeI-HF, and set up the reaction system on ice;

[0020] The DNA sequence of the pEASY-T3 vector plasmid is SEQ ID NO: 12:

[0021] Step 6, obtaining overexpressed Rap1B mRNA, using mMESSAGE T7 ULTRA transcription kit, reverse transcribe the pEASY-T3 vector plasmid DNA inserted with Rap1B, and perform Poly (A) tail modification to obtain overexpressed Rap1B mRNA.

[0022] In one embodiment, in step 1, the cloning reaction conditions are: 95°C, 10s; 60°C, 15s; 72°C, 20s; 40 cycles, stored at 4°C; the reaction system includes: TaqDNA polymerase (2×) 10μL, PrimerF / R (10μM) 1.6μL, cDNA 2μL, ddH2O 6.4μL.

[0023] In one embodiment, in step 3, ligation: the PCR amplification product recovered from the gel is mixed with pEASY-T3CloningVector and reacted at room temperature for 10 minutes. After the reaction is completed, the centrifuge tube is placed on ice. The reaction system includes: PCRProduct 0.5-4μL, pEASY-T3CloningVector 1μL;

[0024] The transformation includes: adding the ligation product to 50 μL Trans1-T1 competent cells, mixing, ice bathing for 30 minutes, placing in 42°C hot water, heat shock for 30 seconds, and placing on ice for 2 minutes; then adding the competent cells to 250 μL LB culture medium, culturing at 200 rpm and 37°C for 1 hour to revive the bacteria; centrifuging the bacterial solution, discarding the supernatant, taking 100uL of the concentrated bacterial solution, and applying it to an LB solid culture plate containing 50ug / mL ampicillin, inverting at 37°C, and culturing in the dark for 16-20 hours.

[0025] In step 4, PCR detection: add the obtained colonies to LB liquid culture medium containing Amp, and culture at 37°C, 180rpm shaking for 12-16h; use the obtained bacterial liquid as a template to perform primer PCR amplification to identify the inserted fragment; the reaction system includes: TaqDNA polymerase (2×) 10μL, PrimerF / R (10μM) 2μL;

[0026] Reaction conditions: 95°C, 10s; 60°C, 15s; 72°C, 20s; 40 cycles, stored at 4°C; then agarose gel electrophoresis was performed to detect PCR products and positive clones;

[0027] In step 5, setting up a reaction system on ice includes:

[0028] Reaction components: pEASY-T3 vector plasmid DNA 1 μg, 10xNEB buffer 5 μL, Restriction Enzyme, 1 μL, Nuclease-free water 50 μ; reaction conditions: 37°C, 15 min; 80°C, 20 min; then agarose gel electrophoresis was performed to detect the PCR product.

[0029] Another object of the present invention is to provide an in vitro interference fragment constructed using the key gene in the use.

[0030] In one embodiment, three different interference fragments are designed according to the Rap1B gene, corresponding to the starting points 15, 100, and 383, respectively, namely RAP1B-15, RAP1B-100, and RAP1B-383; the interference sequence of RAP1B-15 is SEQ ID NO: 5 and SEQ ID NO: 6, the interference sequence of RAP1B-100 is SEQ ID NO: 7 and SEQ ID NO: 8, and the interference sequence of RAP1B-383 is SEQ ID NO: 3 and SEQ ID NO: 4.

[0031] Combined with all the above technical solutions, the advantages and positive effects of the present invention are as follows: the pig industry is an expenditure industry of my country's animal husbandry, and the effective maturation of oocytes is the guarantee of pig reproduction. Oocyte maturation is the basis for the development of animal embryo engineering, and oocyte germinal vesicle breakdown (GVBD) is the starting mark of oocyte nuclear maturation. However, at present, how oocyte GVBD is started, what molecular changes are involved, and how these molecules regulate the start of oocyte nuclear maturation, these are still not clear answers. In order to clarify the molecular mechanism of the initiation of oocyte maturation, the present invention uses porcine oocytes as the object, detects the nuclear state of oocytes at different maturation time points, and clarifies the time point of oocyte GVBD; three different ways of culture are set, 0h, 19h and adding signal pathway inhibitors to 19h, and 0h in vitro culture is used as the control to analyze the incidence of oocyte GVBD, spindle morphology, lamin phosphorylation, p38MAPKmRNA and protein expression levels under different culture methods, and analyze the regulatory molecules responding to oocyte GVBD; GV and GVBD stage oocytes are used as materials for high-throughput sequencing analysis to screen out the key gene Rap1B that regulates the occurrence of GVBD; by constructing a Rap1B in vitro transcription vector and synthesizing interfering siRNA, overexpression and interference are respectively performed by microinjection, and the expression patterns of MKK6, p38 and their phosphorylated proteins are analyzed to reveal the molecular mechanism of Rap1B regulating oocyte GVBD, and the results are as follows:

[0032] 1. 83.33% of oocytes were in the GV stage at 0-16h of in vitro maturation culture, and the spindles were not obviously assembled. Hochest33342 staining results showed that the chromatin was distributed in a circular or diffuse shape; 16.66% had chromosome condensation; at 19h of culture, the oocyte nucleus condensed, and immunofluorescence staining results showed that the spindles were obviously assembled, showing filamentous distribution in the nucleus, and the GVBD incidence reached 63.46%, indicating that the oocytes entered the GVBD stage; qRT-PCR, protein immunoblotting Analysis and immunofluorescence staining results showed that p38 was phosphorylated and activated in the p38MAPK signaling pathway during GVBD. Phosphorylated p38MAPK was located in the cytoplasm before GVBD and migrated to the perinuclear area during GVBD. After adding the p38MAPK specific inhibitor SB203580, p38MAPK phosphorylation was inhibited, p38MAPK mRNA expression level was significantly downregulated (p < 0.05), GVBD rate was significantly decreased (p < 0.05), and GVBD was inhibited. These results indicate that p38MAPK phosphorylation regulates the occurrence of oocyte GVBD.

[0033] 2. To reveal the molecular mechanism of oocyte GVBD, single-cell high-throughput sequencing was performed on oocytes at GV and GVBD stages. The results showed that the sample group had good repeatability, with the lowest correlation coefficient being 0.995; there were different levels of clustering between groups, with 30 genes significantly upregulated and 52 genes significantly downregulated; qRT-PCR analysis of 6 genes significantly upregulated or downregulated revealed that the expression levels of MAPKAPK5, BAZ2A, KDM6B, Rap1B, and WRNIP1 increased with the increase of oocyte GVBD. The expression of CASP, AK6, KLF2, ADGRA3 and CEP57 was significantly decreased as the oocyte developed to the GVBD stage, among which the expression of Rap1B gene was most significantly upregulated (P<0.05). The results of immunofluorescence staining showed that Rap1B was scattered in the cytoplasm during the GV stage of oocytes, and Rap1B condensed to the nucleus as the oocyte entered the GVBD stage. The above results indicate that Rap1B is a potential key gene regulating the occurrence of GVBD.

[0034] 3. Obtain oocyte cDNA by reverse transcription PCR, amplify the Rap1B sequence, insert it into the linearized vector pEASY-T3, construct the Rap1B in vitro transcription plasmid, and use mMESSAGEmMACHINE TMThe Rap1B RNA was obtained by T7ULTRA transcription kit, poly(A) tailing, and purification was performed to obtain Rap1B mRNA; Rap1B siRNA interference sequence was designed and screened according to the Rap1B gene sequence provided by NCBI; it was determined that microinjection at 6 hours of oocyte maturation culture did not affect the incidence of GVBD (61%); microinjection of Rap1B siRNA interference fragments and mRNA, gene level detection showed that Rap1B gene expression in 19h oocytes was significantly downregulated and overexpressed, respectively, and WB results The results showed that Rap1B protein expression was significantly upregulated in the 19h overexpression group; further analysis results showed that MEKK6 phosphorylation was significantly upregulated, p38 phosphorylation was significantly increased, the phosphorylation level of nuclear lamin LaminA / C was increased, and GVBD was significantly promoted, upregulated to 71.7% in the overexpression group; the results of the low-disturbance group showed that the phosphorylation level of MEKK6 decreased, p38 phosphorylation was inhibited, the activation of nuclear lamin LaminA / C was not obvious, the chromatin was ring-shaped or diffusely distributed in the cytoplasm, and the occurrence of GVBD was inhibited, downregulated to 26.6%.

[0035] The present invention clarifies that Rap1B can regulate the occurrence of GVBD in porcine oocytes by mediating the p38MAPK signaling pathway, provides an important theoretical reference for enriching and improving the oocyte maturation mechanism, and will play a positive role in improving the quality of oocyte maturation and promoting the development of animal embryo engineering and even the pig industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the present disclosure and, together with the description, serve to explain the principles of the present disclosure.

[0037] Figure 1 is a flow chart of a method for screening key genes provided by an embodiment of the present invention;

[0038] Figure 2 The heat map of correlation analysis between samples provided by an embodiment of the present invention;

[0039] Figure 3 is a hierarchical cluster analysis diagram among samples provided by an embodiment of the present invention;

[0040] Figure 4 It is a Venn diagram analysis diagram between samples and between groups provided by an embodiment of the present invention;

[0041] Figure 5 is a diagram of significantly differentially expressed genes (DGE) provided in an embodiment of the present invention;

[0042] Figure 6 The embodiment of the present invention provides a heat map of the expression of each group of DEGs;

[0043] Figure 7 This is a diagram of differential gene expression patterns of pig oocytes at different developmental stages provided by an embodiment of the present invention;

[0044] Figure 8 1 is a diagram showing the expression pattern of Rap1B mRNA at different developmental stages provided by an embodiment of the present invention;

[0045] Fig. 9 is an immunofluorescence staining diagram of Rap1B at different developmental stages provided by an embodiment of the present invention;

[0046] Fig.10 is a schematic diagram of the Rap1B signal transduction pathway provided by an embodiment of the present invention;

[0047] Fig.11 The figure is a diagram showing the construction of the overexpression vector provided in the embodiment of the present invention and the agarose gel electrophoresis result in the in vitro transcription, showing that the size of the band is consistent with the size of the target band;

[0048] Fig.12 In the construction of the overexpression vector provided in the embodiment of the present invention and in vitro transcription, the target band is recovered and purified by gel electrophoresis, and the purification effect meets the experimental requirements;

[0049] Fig.13 The overexpression vector provided in the embodiment of the present invention is constructed and the bacterial solution with the same band size as the Rap1B fragment in the in vitro transcription is sequenced. The plasmid is extracted from the bacterial solution with the correct sequencing and a verification diagram is performed;

[0050] Fig.14 It is a diagram of cutting and verifying a circular plasmid using a restriction endonuclease in the construction of an overexpression vector provided in an embodiment of the present invention and in vitro transcription;

[0051] Fig.15 It is the electrophoresis diagram of Rap1B-pEASY-T3 in the construction of the overexpression vector and in vitro transcription provided by the embodiment of the present invention;

[0052] Fig.16 This is a fluorescence effect diagram after microinjection provided by an embodiment of the present invention;

[0053] Fig.17 This is a diagram showing the effect of injection of different siRNA fragments on Rap1B gene expression provided by an embodiment of the present invention;

[0054] Fig.18 1 is a diagram showing the expression pattern of Rap1B mRNA in oocytes after knockdown and overexpression provided by an embodiment of the present invention;

[0055] Fig.19 This is a diagram showing the effect of Rap1B protein expression after interference and overexpression provided in an embodiment of the present invention;

[0056] Fig. 20 is a histogram of Rap1B protein expression after interference and overexpression provided in an embodiment of the present invention;

[0057] Fig.21 The spindle morphology and positioning diagram in oocytes after knockdown and overexpression provided by the embodiments of the present invention;

[0058] Fig. 22 It is an immunofluorescence staining diagram of p-LaminA / C in oocytes after knockdown and overexpression provided by the embodiments of the present invention;

[0059] Fig.23 It is an immunofluorescence staining diagram of p-p38 in oocytes after knockdown and overexpression provided by the embodiments of the present invention;

[0060] Fig.24 This is a Western blot detection diagram of related proteins in oocytes after knockdown and overexpression provided by an embodiment of the present invention;

[0061] Fig.25 It is a p-p38MAPK protein map provided by an embodiment of the present invention;

[0062] Fig.26 is a p-MEKK6 protein map provided by an embodiment of the present invention;

[0063] Fig. 27 It is a p38MAPK protein map provided by an embodiment of the present invention;

[0064] Fig.28 This is a map of the MEKK6 protein provided in an embodiment of the present invention. DETAILED DESCRIPTION

[0065] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific embodiments of the present invention are described in detail below in conjunction with the accompanying drawings. In the following description, many specific details are set forth to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present invention, so the present invention is not limited by the specific implementation disclosed below.

[0066] GVBD, as a sign of the beginning of oocyte maturation, determines oocyte maturation. At present, there are few discoveries about the molecular mechanism of oocyte GVBD and the specific regulatory factors. Therefore, it is necessary to deepen the molecular mechanism of regulating oocyte GVBD, and then improve oocyte cytoplasmic maturation and nuclear maturation. The discovery of GVBD regulatory mechanism can lay the foundation for obtaining high-quality mature oocytes in vitro, and can also provide important theoretical references for the discovery of animal reproduction and development processes.

[0067] Pigs are not only important economic animals in the animal husbandry industry, but also model animals for biomedical experiments. The present invention uses pig oocytes as experimental materials, conducts extensive exploration of pig oocyte GVBD, and ultimately clarifies the time point of pig oocyte GVBD. At the same time, high-throughput group sequencing of oocytes in the GV and GVBD stages at different developmental time points is completed, and the phosphorylation of the p38MAPK signaling pathway and changes in related molecular indicators before and after pig oocyte GVBD are explored, ultimately revealing the molecular regulatory mechanism of oocyte GVBD, providing an important theoretical reference for clarifying the maturation and development of oocytes, laying the foundation for further obtaining high-quality animal oocytes and animal embryos, and laying a solid foundation for promoting the development of animal embryo engineering and the progress of animal production.

[0068] The embodiment of the present invention provides a use of a key gene in regulating oocyte GVBD in vitro, wherein the key gene is Rap1B. It is cloned and synthesized from oocytes. The DNA sequence is SEQ ID NO: 9atgcgtgagtataagctagtcgttcttggctcaggaggcgttggaaaatctgctctgaccgtacaatttgttcaaggaattttt gttgaaaaatatgatcctacgatagaagattcttatagaaagcaagttgaagtagatgcgcaacagtgtatgcttgaaatcttggatactgcaggaacggaacaatttacagcaatgagggacttgtacatgaaaaatggacaaggctttgcattagtttattccatcacagcacagtccacatttaatgatttacaagatctgagagaacagattcttcgagttaaagacactga tgatgttccaatgatcctggttggtaataagtgtgacttggaagatgaaagagttgtaggaaaggaacaaggtcaaaatctagcaagacaatggaacaactgtgcattcttagaatcc tctgcaaaatcaaaaataaatgttaatgagatcttttatgacttagtgcgacaaattaacagaaaaactccagtgcctgggaaggcccgcaaaaagtcatcatgtcaactgctttaa.

[0069] In a preferred embodiment, the key gene Rap1B regulates the GVBD application of oocytes in vitro by mediating the MEKK6 / p38MAPK liaison signaling pathway.

[0070] like Figure 1 As shown, a method for screening key genes in the use of the key genes in regulating oocyte GVBD in vitro is provided, comprising:

[0071] S1, by performing transcriptome sequencing analysis on oocytes at different developmental time periods, GV and GVBD stages, the transcriptional differences before and after GVBD in oocytes were determined, and differentially expressed genes were screened;

[0072] S2, construct molecular regulatory network and signaling pathway network;

[0073] S3, screened out RAP1B, a key factor regulating oocyte GVBD;

[0074] The embodiment of the present invention provides an in vitro overexpression vector constructed using the key gene in the use. DNA such as SEQ ID NO: 10:

[0075]

[0076] The present invention provides a method for constructing an overexpression vector, which comprises:

[0077] Step 1, Rap1B primer design and amplification, according to the gene sequence of pig Rap1B provided by NCBI website and the sequences on both sides of the SpeI restriction site in P-EASY-T3, the cloning primer sequences are designed, and the cloning primer sequences include SEQ ID NO: 1 and SEQ ID NO: 2;

[0078] Step 2, agarose gel electrophoresis and gel recovery;

[0079] Step 3, connection and transformation of pEASY-T3 vector and Rap1BRap1B; the DNA sequence of pEASY-T3 vector is SEQ ID NO: 11:

[0080]

[0081] Step 4, bacterial liquid PCR detection and sequencing;

[0082] Step 5, linearize Rap1B, use a plasmid extraction kit and a gel recovery kit to obtain the pEASY-T3 vector plasmid inserted with Rap1B, use the restriction endonuclease SpeI-HF, and set up the reaction system on ice;

[0083] The DNA sequence of the pEASY-T3 vector plasmid is SEQ ID NO: 12:

[0084]

[0085] Step 6, obtaining overexpressed Rap1B mRNA, using mMESSAGE T7 ULTRA transcription kit, reverse transcribe the pEASY-T3 vector plasmid DNA inserted with Rap1B, and perform Poly (A) tail modification to obtain overexpressed Rap1B mRNA.

[0086] The embodiment of the present invention provides an in vitro interference fragment constructed using the key gene in the use.

[0087] In a preferred embodiment, three different interference fragments are designed according to the Rap1B gene, corresponding to the starting points 15, 100, and 383, respectively, namely RAP1B-15, RAP1B-100, and RAP1B-383; the interference sequence of RAP1B-15 is SEQ ID NO: 5 and SEQ ID NO: 6, the interference sequence of RAP1B-100 is SEQ ID NO: 7 and SEQ ID NO: 8, and the interference sequence of RAP1B-383 is SEQ ID NO: 3 and SEQ ID NO: 4.

[0088] Example 1: Analysis of the mechanism of p38 phosphorylation regulating the occurrence of oocyte GVBD.

[0089] 1. With the continuous deepening of the invention of assisted reproductive technology and cloning technology and the development of emerging biotechnology, the requirements for the quality of in vitro oocyte maturation in the field of animal reproduction and development invention are increasing (Zhang et al., 2022). Compared with other cells, oocytes have unique and complex differentiation characteristics. The invention of in vitro maturation of pig oocytes has become a key link in the in vitro production of pig embryos and the production of cloned pigs using pig somatic cell nuclear transplantation technology (Chen et al., 2021). It is generally believed that GVBD, as a sign of the initiation of oocyte maturation, regulates the subsequent maturation of oocytes. At present, the invention of in vitro maturation technology of oocytes has made great progress, but there is still a lack of understanding of the molecular events in the GVBD process, resulting in little success in efforts to improve the quality of in vitro matured oocytes (Tiwari et al., 2018). Therefore, it is necessary to conduct in-depth research on the molecular mechanism of oocyte GVBD to improve the quality of oocyte maturation.

[0090] The main characteristics of GVBD are highly condensed chromatin, disappearance of nucleoli, and rupture of nuclear membranes, which indicates that oocytes must accumulate appropriate information before chromosome condensation in order to resume meiosis, fertilization, and embryonic development. In the early embryonic development, primordial germ cells proliferate to a certain number through mitosis and then stop proliferating (Whelan et al., 2012). Under the action of retinoic acid, they enter the first prophase of meiosis and become primary oocytes. Subsequently, they develop to the diplotene stage through the leptotene, zygotene, and pachytene stages. During this period, chromatin is in a highly decondensed state and the nuclear membrane is re-formed by the outer layer. The oocytes in this period are called GV stage oocytes (Endo et al., 2019). Existing technologies have shown that MAPK terminates the gap junctions between granulosa cells and oocytes after the GV stage, and causes GVBD in oocytes when phosphorylated protein signals are activated. Existing technologies have confirmed that phosphorylated p38 MAPK signal transduction changes the transcription of genes related to oocyte maturation and cumulus diffusion to a certain extent (Yoone et al., 2017), thereby causing the oocyte to enter the GVBD stage from the GV stage.

[0091] Due to the lack of understanding of the molecular events of oocyte GVBD, the regulation of oocyte maturation time cannot be reasonably controlled, resulting in poor results in further improving the quality of oocyte maturation. Therefore, by clarifying the regulatory mechanism of oocyte GVBD, effective methods to block the occurrence of GVBD can be implemented to provide more sufficient development time for the cytoplasmic maturation of oocytes and ensure oocyte maturation.

[0092] 2 Experimental reagents and consumables: 2.2 Main reagents, see Table 1.

[0093] Table 1 Main reagents

[0094]

[0095]

[0096] 2.3 Main instruments and equipment: 2.4 Preparation of main solutions, egg washing solution: Add the drug mass as shown in Table 2 to every 1000mL of distilled water, and finally use a pH meter to adjust the pH to 7.0-7.2.

[0097] Table 2 Egg washing solution

[0098]

[0099]

[0100] Preparation of maturation solution: TCM199 is the mother solution of maturation solution. After adding double antibody and sodium pyruvate, it is prepared according to the 10mL system and 0.5ug / mL LH, 0.5ug / mL FSH and 10ug / mL EGF are added.

[0101] Preparation of operating solution: Add 0.1001 g of Sodium pyruvate, 0.050 g of PG, and 0.060 g of SM to 1 L TCM-199, and add 0.1500 g of BSA per 50 mL of operating solution.

[0102] Immunofluorescence staining related reagents:

[0103] DPVBS-PVA: Dissolve 0.1000 g PVA in 90 mL deionized water, then add 10 mL DPBS (10X);

[0104] Washing solution: add 1uL 10% TritenX-100 and 1uTween to 1mL DPBS-PVA;

[0105] 1% blocking solution: Take 9 mL PBS, add 1 mL 0.1% TritionX-100, and add 0.1000 g BSA;

[0106] Permeabilization solution: add 1 mL 10% TritionX-100 to 9 mL DPBS-PVA;

[0107] Fixative solution: add 1g paraformaldehyde to 22.5mL deionized water, place in a 65℃ water bath for 40min, stir for 10min, add a drop of 1mol / LNaOH, continue stirring until all the powder at the bottom is dissolved, cool to room temperature, add a drop of 1mol / L HCl, add 2.5mL 10x DPBS, adjust the pH to 7.2, filter and set aside.

[0108] Preparation of WesternBolt related reagents:

[0109] 10X electrophoresis buffer: 144 g glycine, 30.3 g Tris, dissolved in 800 mL ultrapure water, dilute to 1000 mL;

[0110] 1X electrophoresis buffer: 100 mL 10X electrophoresis buffer, 900 mL ultrapure water, 10 mL 10% SDS;

[0111] 1X transfer buffer: 100mL 10X electrophoresis buffer, 700mL ultrapure water, 200mL methanol;

[0112] 10XTBST: 80g NaCl, 24.2g Tris dissolved in 800mL ultrapure water, adjust pH to 7.6, and make up to 1000mL;

[0113] 1XTBST: 100mL10XTBST, 900mL ultrapure water, 1mL Tween20;

[0114] Dilution of primary and secondary antibodies: Use 1XTBST at a concentration of 1:2000 before use.

[0115] 3. Test methods:

[0116] 3.1 Obtaining and processing porcine oocytes. The method for obtaining oocytes is as follows: collect porcine ovaries that have been out of the body for a short time and have not been cooled at the local slaughterhouse. After collection, quickly put them into a 36-39℃ saline thermos cup with double antibodies added, and bring them back to the laboratory;

[0117] Egg extraction: Use a 10mL syringe to pierce the 3-8mm follicle at a 30° angle to the ovary, gently aspirate the follicular fluid, and gently inject the follicular fluid into a 50mL 37℃ warm centrifuge tube for later use;

[0118] Egg washing: put the collected follicular fluid into a 37℃ incubator to settle for 5-10 minutes, use a 20mL syringe to remove the supernatant, pour 35mL of the prepared HEPES buffer into the oocyte contents, and settle for another 5-10 minutes. Repeat three times, and do not discard the supernatant for the third time and pour it into the cell culture dish;

[0119] Picking eggs: Select cumulus-oocyte complexes (COCs) with uniform cytoplasm and more than three layers of granulosa cells under a stereomicroscope, and wash them four times with the prepared maturation culture medium;

[0120] Egg culture: Oocytes were drawn from the washing chamber and placed into the pre-prepared oocyte maturation culture medium, 50 oocytes per well, cultured at 38.5°C and 5% carbon dioxide concentration.

[0121] 3.2 To remove the cumulus from porcine oocytes, use a 200mL pipette to absorb the porcine oocytes in the mature culture medium, add them to the 1mg / mL pre-prepared 37℃ hyaluronidase, blow gently with the pipette or use a vortex shaker to shake for 3 minutes, use a 1000mL pipette to absorb the oocyte hyaluronidase mixture into a 5mL cell culture dish, place it under a stereomicroscope and pick up the oocytes that have been treated with the cumulus removal, put the oocytes into the pre-prepared operating solution, and terminate the digestion. Pick up the oocytes with intact oocyte plasma membrane and no granulosa cells outside the zona pellucida.

[0122] 3.3 Immunofluorescence staining: fix the oocytes after removing the granulosa cells, wash the oocytes with PBS for 30 seconds, add 4% paraformaldehyde to the oocytes and fix them at 4°C overnight or at room temperature for 30 minutes; wash away the paraformaldehyde with cleaning solution, add the oocytes to the membrane permeabilization solution, and permeabilize on a shaker for 30 minutes; wash with cleaning solution 3 times, 5 minutes each time to wash away the membrane permeabilization solution, add blocking solution and shake for 60 minutes; wash with cleaning solution 3 times, 5 minutes each time, and then add α-tubulin-FITC fluorescent antibody or p-p38MAPK antibody and incubate at 4°C overnight; wash with cleaning solution 3 times, 5 minutes each time, and add Hoechst33342 dye at an appropriate concentration; wash with DPBS-PVA 3 times, 5 minutes each time; add 10μL of anti-fluorescence quencher on the slide, put the oocyte in the anti-fluorescence quencher, cover and seal, and observe under a fluorescence microscope.

[0123] 3.4qRT-PCR fluorescence quantitative analysis: 3.4.1 Extraction and reverse transcription of RNA from porcine oocytes. The total RNA of porcine oocytes was extracted using the RNeasy Mini Kit (Qiagen) RNA extraction kit. The specific RNA extraction steps were as follows: 50 oocytes were transferred to a 1.5 mL centrifuge tube, 350 μL RLT was added, and the mixture was mixed by pipetting; 3.5 μL β-mercaptoethanol was added to protect DNA from oxidation; 350 μL 70% anhydrous ethanol was added, and the mixture was mixed by pipetting; the liquid was transferred to 1. 5mL adsorption column, centrifuge at 12000r for 1min; pour out the lower layer liquid, add 700μL BufferRW, centrifuge at 12000r for 1min; pour out the lower layer liquid, add 500μL BufferRPE, centrifuge at 12000r for 1min; pour out the lower layer liquid, repeat adding 500μL BufferRPE, centrifuge at 12000r for 1min; replace the base, add 50μL RNase-free water, centrifuge at 12000r for 1min; transfer to a 100μL centrifuge tube to obtain RNA eluate. Reverse transcription was performed using the PrimeScriptRT kit (Takara). The specific transcription steps are as follows: take out the -20℃ kit, add 20μL Max, 30μL RNase-free water, 50μL RNA eluate, put it into the PCR instrument, and the reverse transcription conditions are: 37℃, 15min; 85℃, 5s; 4℃, and the obtained cDNA is stored at -20℃.

[0124] 3.4.2 Fluorescence quantitative reaction system and steps, using DNAMAN primer design software and Rap1B queried on the NCBI website, primers were designed and screened by the NCBI-Blast website, and the primers were synthesized by Shanghai Bioengineering Company. The primer sequences are shown in Table 1.5. The reaction was carried out in a 96-well optical reaction plate using SYBR PreMix Ex Taq II (Takara) and 480 real-time PCR system (Roche system). The reaction system: 2×SYBR Green PCR Master Mix 10 μL, PCR primer mixture (10 μM) 2 μL, template cDNA 2 μL, ddH2O 6 μL; qRT-PCR reaction conditions are as follows: 95°C, 30 s; 95°C, 5 s; 60°C, 34 s of 40 two-step cycles, and finally a dissociation stage consisting of 95°C, 15 s, 60°C, 1 min and 95°C, 15 s. For each sample, the CT value was obtained by three replicates, and the mRNA expression pattern was analyzed using the 2-ΔΔct method.

[0125] 3.5 Western Bolt protein blot analysis: pig oocytes at different developmental stages were de-cumulused to obtain 120 pig oocytes at different stages. After washing the oocytes with PBS, aspirate as little liquid as possible into RNase-free EP tubes, add 20 μL RAPI cell lysis solution and 1% PMSF, freeze rapidly with liquid nitrogen, freeze and thaw repeatedly three times to extract protein or for subsequent use, and store at -80°C; add 5 μL Loading Dye 5X Buffer to the oocytes in the EP tube and mix well, place on a 95°C constant temperature heating table for 7-8 minutes to obtain denatured protein lysate; polyacrylamide gel preparation: clean the comb and glass plate, rinse with distilled water, put them together to dry (1mm glass plate), prepare 10% separation gel and add distilled water to flatten and solidify, pour out the upper liquid, and absorb the water; prepare 5% concentrated gel, insert the comb teeth, and let it stand to completely solidify; carefully load the sample After that, first run the gel at 80V for 40min; then run it at 120V for 100min; transfer: cut the PVDF membrane in advance, soak it in methanol for a few minutes and then soak it in transbuffers, open the thick filter paper and soak it in Transbuffers; peel the gel from the offset plate, mark it at the marker, put it on the negative electrode plate, cover it with PVDF membrane, ice bath at 300mA, and transfer it for 60-90min; blocking: prepare 5% skim milk powder blocking solution, block the gel at room temperature for 1-2h, 50-60rpm; primary antibody binding: dilute the primary antibody with TBST (1:1000), incubate the primary antibody at 4℃ overnight; secondary antibody binding: prepare secondary antibody (1:5000), dilute with TBST, incubate at room temperature for 1h, 40-50rpm, wash the membrane with TBST, wash for 5, 10, and 15min respectively; development: prepare luminescent solution (A:B=1:1), and use a developer to detect the target band according to the appropriate exposure time.

[0126] 4 Results: 4.1 Nuclear state of oocytes at different time periods. During the in vitro maturation and culture process, porcine oocytes went through the GV to GVBD stage and subsequently completed the meiotic process. The results showed that most of the oocytes at the beginning of culture were in the GV stage, which was mainly characterized by the scattered distribution of chromatin and obvious nuclear membrane after immunofluorescence staining. When the oocytes entered the GVBD stage, the nuclear membrane ruptured and the chromatin condensed.

[0127] The present invention detects the state diagram of the nucleus of the oocyte GV-GVBD-MI stage. At 0h, the oocyte is covered with a nuclear membrane and is in the GV stage, and the nucleus is in a ring state; as the oocyte develops, the nuclear membrane gradually ruptures, and the chromatin is scattered in the cytoplasm after rupture; when entering the GVBD stage, the oocyte chromatin condenses and presents a flower cluster. For example, when the porcine oocyte is cultured in vitro and develops to different time points, the proportion of each stage is: at 19h, the oocyte has GVBD, the incidence rate is 63.46%, and at 16h, the incidence rate of oocyte GVBD is 16.66%. It can be seen that the porcine oocyte has GVBD at 19h under in vitro culture.

[0128] 4.2 Changes in spindle morphology during the GVBD process of porcine oocytes. The morphological structure of the spindle of porcine oocytes presents different states as the oocytes mature. In the GV stage, the spindle of oocytes is located in the oocyte cytoplasm, the chromatin is scattered, and the spindle does not appear; in the GVBD stage, the chromatin is highly condensed into chromosomes, and obvious spindle fibers appear, and their positioning gradually moves inward from the periphery of the cell nucleus.

[0129] 4.3 p38 mRNA and protein levels during GVBD: 4.3.1 Pig oocyte RNA test. This experiment required RNA extraction from oocytes at different developmental stages. 5 μL was taken from each stage and the bands were detected by agarose gel electrophoresis. The standard was used to compare 18s and 28s. The bands were clear, indicating that the RNA used in the experiment met the test standards.

[0130] 4.3.2 qRT-PCR analysis of p38 (MAPK14) gene in oocytes at different stages. Real-time fluorescence quantitative PCR was used to detect the expression of p38 mRNA in pig oocytes at 0h and 19h. Compared with 0h, the mRNA expression of p38 in pig oocytes at 19h was significantly upregulated (p<0.05).

[0131] 4.3.3 Cellular localization of p-p38 protein. Immunofluorescence staining and analysis of oocytes in the GV and GVBD stages revealed that p-p38 in oocytes during GVBD was mainly concentrated around the condensed chromatin of oocytes, and the fluorescence intensity showed a significant upward trend compared with the GV stage (P < 0.05), indicating that p-p38 is involved in the regulation of oocyte GVBD.

[0132] 4.3.4 Changes in the expression levels of p38 and p-p38 proteins. Western blot was used to detect and analyze the changes in p38 and p-p38 in oocytes at 0h and 19h. The grayscale values ​​were detected and analyzed for homogenization. The results showed that at 19h, the expression level of p38 protein was significantly upregulated (p=0.0012<0.05), and the expression level of phosphorylated p38 protein was even more significantly increased (p=0.0002<0.05).

[0133] 4.4 Effect of adding p38MAPK signaling pathway inhibitor on the GVBD process of porcine oocytes. In order to further clarify the regulation of p38MAPK signaling pathway on porcine oocyte GVBD, various indicators were further tested after adding p38MAPK signaling pathway inhibitor SB203580 to further clarify the mechanism of p-p38 regulating oocyte GVBD.

[0134] 4.4.1 Effect of inhibitor SB203580 on the occurrence of GVBD in oocytes. The p38MAPK signaling pathway inhibitor SB203580 was added to the maturation culture medium to observe the chromatin morphology. The results showed that the inhibitor SB20358 significantly downregulated the incidence of GVBD in porcine oocytes.

[0135] 4.4.2 When the inhibitor SB203580 was added and cultured for 19 hours in pig oocytes, the chromatin was still in a diffuse state and did not reach an obvious GVBD state.

[0136] 4.4.3 Relative expression levels of the p38MAPK gene under different culture systems. RNA was extracted from GV stage oocytes cultured under the normal system, GVBD stage oocytes under the normal system, and oocytes cultured to the GVBD stage with the addition of inhibitors, and qRT-PCR detection was performed. The results showed that the expression level of p38MAPK in the oocytes of the inhibitor group was reduced and was significantly lower than that of the oocytes in the GV and GVBD stages (p < 0.001).

[0137] 4.4.4 Expression of p38MAPK signaling pathway protein and localization in cells after inhibitor culture. Immunofluorescence staining of oocytes in different culture systems showed that the chromatin of oocytes cultured normally to 0h was flocculent and aggregated around the nucleus, and the activation of p38 was not obvious; immunofluorescence of oocytes cultured normally to 19h showed that the chromatin of oocytes was condensed, and the activation of phosphorylated p38 increased significantly, and was mainly concentrated around the nucleus of oocytes; the inhibitor cultured to 19h, the results showed that the activation of phosphorylated p38 was significantly inhibited, and the chromatin showed a condensation trend, but no condensation. Western Bolt detection results showed that the phosphorylated p38 protein was significantly upregulated (p < 0.05) in normal culture to 19h, and the total p38 showed an upward trend; the expression of phosphorylated p38 protein in the inhibitor group showed a low expression trend.

[0138] 4.4.5 Localization of lamins after inhibitor culture, lamin immunofluorescence results, normal culture 0h, lamins concentrated in the nucleus; GVBD occurred at 19h, the nuclear membrane ruptured, and lamins dispersed into the cytoplasm; in the inhibitor group, no obvious GVBD was observed, but obvious lamins were still visible and concentrated in the nucleus. The above experimental results show that the p38MAPK signaling pathway regulates the occurrence of GVBD in porcine oocytes by affecting the phosphorylation of lamins to cause the nuclear membrane to cleave.

[0139] 5. The maturation of porcine oocytes has received extensive attention, and GVBD determines the maturation of oocytes. The prior art shows that the occurrence of oocyte GVBD is mainly concentrated between 18 and 20 hours of in vitro culture. The invention results of the present invention found that most porcine oocytes are in the GV stage from 0 to 16 hours, and the chromatin state and nuclear membrane morphology of the oocytes begin to change from 16 hours, and the proportion of GVBD is the largest at 19 hours. Of course, there are many inventions on porcine oocytes, and some experimental results also show that the time when porcine oocytes complete GVBD is mostly before 22 hours. Due to the different focuses of the inventions, the time point for defining GVBD is not clear. The present invention finally confirmed the time point of GVBD occurrence through multiple in vitro maturation cultures. At 19 hours of maturation culture, the understanding of the event of oocyte GVBD has been deepened to a certain extent.

[0140] After determining the GVBD time point, the present invention detected the expression of p38MAPK mRNA and protein in oocytes, and the results showed that during the GVBD process, the gene expression of p38 was significantly increased, and the phosphorylation of p38 protein also showed a positive correlation with gene expression, and a significant increase occurred at the same time. This result is consistent with the hypothesis that GVBD is related to the activation of the p38MAPK signaling pathway, and there is a lot of evidence that the activated MAPK signaling pathway accompanies the development of the entire oocyte, which to a certain extent supplements the relevant mechanism of regulating the occurrence of GVBD in pig oocytes. In order to further verify that oocyte GVBD is related to the p38MAPK signaling pathway, the present invention uses SB203580, a p38MAPK signaling pathway inhibitor, which effectively weakens the activation of the p38MAPK signaling pathway and inhibits the phosphorylation of p38. In this experiment, normally cultured oocytes were set as a control group, and those cultured with inhibitor addition were set as an experimental group. Through a series of tests, the occurrence of GVBD in 19h oocytes was significantly inhibited, the GVBD rate was less than 15%, and the expression level of p38MAPKmRNA was significantly downregulated. Western Blot results showed that phosphorylated p38 was significantly inhibited, and the activation of lamin A / C, a protein related to the composition of the oocyte nuclear membrane, was significantly inhibited. Lamin A / C is related to the formation of the spindle and the assembly of microfilaments and microtubules. Therefore, the present invention not only clarifies that oocyte GVBD is related to the p38MAPK signaling pathway, but also, according to the phosphorylation degree of lamin A / C, it is obtained that the occurrence of oocyte GVBD is related to the activation of the p38MAPK signaling pathway, and phosphorylated p38 regulates the rupture of the nuclear membrane by activating Lamin A / C.

[0141] Recently, it has been shown that phosphorylated p38MAPK plays an important role during early oocyte maturation and mitosis. By injecting the same subtype of protein kinase of p38 into immature oocytes, the occurrence of oocyte GVBD can be induced). Combined with the results of the present invention on the determination of phosphorylated p38 protein, phosphorylated p38 protein is significantly upregulated during GVBD, which indicates that there is a special mechanism to further regulate the GVBD of oocytes by inducing the phosphorylation of p38. There is evidence that lower levels of activated p38MAPK can induce the blockage of gap junctions between cumulus cells and oocytes, thereby inhibiting the meiotic resumption of oocytes. The present invention predicts that the effect of activated p38MAPK on oocyte GVBD presents a peak trend, that is, too low or too high expression will have a negative regulation on the occurrence of GVBD, but the mechanism of how p38MAPK is controlled within a reasonable range is still unclear. Recently, it has been shown that dephosphorylation of MEKK6 can effectively reduce the activity of p38MAPK phosphorylation. Related information shows that MEKK6, as a p38MAPK cascade kinase, can effectively activate p38MAPK, and p38MAPK has an important regulatory effect on oocyte GVBD. This shows that there is a key factor that regulates oocyte GVBD by mediating the MEKK6 / p38MAPK liaison signaling pathway, which needs further analysis.

[0142] Example 2: Screening and identifying regulatory genes that mediate the p38MAPK signaling pathway in pig oocytes.

[0143] 1. In vitro maturation of oocytes is a basic technology for animal embryo engineering, and obtaining high-quality, mature and healthy oocytes is the guarantee for the development of animal embryo engineering. Pigs are not only the main economic animals, but also the model animals for biomedical applications. Therefore, it is very important to explore the maturation of pig oocytes for the development of reproductive development. Although an in vitro maturation system for oocytes has been established, the quality of oocytes matured in vitro cannot be compared with that of oocytes in vivo, and the quality of the embryos produced is worse. The invention shows that the maturation of pig oocytes is regulated by a variety of complex mechanisms, and the nucleus and nuclear cytoplasm of oocytes obtained in vitro are not synchronized, and the subsequent developmental capacity is poor. Therefore, it is urgent to clarify the regulation mechanism of oocyte maturation and improve the oocyte maturation rate. The prior art shows that oocytes in vivo are regulated by various signals mediated by follicular fluid and granulosa cells, and oocytes are in the GV stage for a long time, which is crucial for the activation of oocyte nuclear maturation by the cAMP-dependent MAPK signaling pathway of oocytes. Various existing technologies currently show that in vivo mature oocytes are inhibited by GVBD inhibitors in the follicular fluid during the GV stage. After the oocytes accumulate sufficient cytoplasmic maturation proteins during the GV stage, they are induced to undergo GVBD by maturation-inducing hormones, enter the meiotic stage, and are expelled from the oocytes. P38 stress-activated protein kinase (p38MAPK) is a member of the mitogen-activated protein kinase (MAPK) family pathway and is a serine / threonine protein kinase that is expressed when GVBD is induced in oocytes. After the maturation-inducing signal is initiated, the maternal c-mos mRNA begins to be translated into another germ cell-specific serine / threonine kinase MOS protein, namely MEKK. More and more data show that the activation of p38MPAK is the main mechanism leading to rapid cell proliferation. MEKK is a specific kinase that activates p38MAPK. In oocytes, MOS protein activates p38MAPK and activates p38MAPK activity through phosphorylation, thereby promoting CDC25-mediated MPF activation and entering the meiotic phase (Cha et al., 2007; Rime et al., 1994). Therefore, the MEKK / p38MAPK signal transduction pathway helps oocytes transition from the GV stage to the GVBD stage. However, in the entire cascade, the regulatory signal upstream of MEKK is still unclear, and the specific pathway through which the signal is transduced to p38MAPK needs further verification.

[0144] At present, with the widespread application of high-throughput transcriptome sequencing technology, it is possible to mine new regulatory genes (Guo et al., 2017). The present invention analyzes the transcriptome sequencing of oocytes in different developmental time periods, GV and GVBD, clarifies the transcriptional differences before and after GVBD in oocytes, screens out differentially expressed genes, constructs molecular regulatory networks and signal pathway networks, and screens out key factors that regulate GVBD in oocytes.

[0145] 2 Materials: 2.1 Experimental materials, porcine GV and GVBD stage oocytes acquisition: oocytes need to be de-cumulused at 0h and 19h of in vitro culture, oocytes are transferred from the maturation culture medium to hyaluronidase, shaken, and oocytes of standard quality are picked up, and the porcine oocytes are processed for de-cumulusing in the specific steps of Example 1, and the obtained porcine oocytes are frozen at -80°C for subsequent detection. The reagents used are shown in Table 3.

[0146] Table 3 Main reagents

[0147]

[0148] 3. Methods: 3.1 Transcriptome sequencing includes: 3.1.1 Experimental process, Total RNA sample detection: Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit) was used to detect the concentration, RIN value, 28S, 18S and fragment size of total RNA. Total RNA processing: After extracting the total RNA of the sample, mRNA was enriched with magnetic beads with Oligo (dT), and an appropriate amount of shearing reagent was added to fragment it under high temperature conditions. The sheared mRNA was used as a template to synthesize a single-strand cDNA, and then a two-strand synthesis reaction system was configured to synthesize a two-strand cDNA, and the kit was used to purify and recover, repair the sticky ends, add the base "A" to the 3 ends of the cDNA and connect the adapter, and then select the fragment size, and finally perform PCR amplification. The constructed library was quality inspected by Agilent 2100 Bioanalyzer and ABI Step OnePlus Real-Time PCR System, and sequencing was performed after passing the inspection.

[0149] 3.1.2 Information analysis process, the raw data obtained by sequencing is called rawreads. The present invention filters out reads with low quality, connector contamination, and high unknown base N content, and the filtered data is called cleanreads. The cleanreads are then aligned to the reference genome, followed by new transcript prediction, SNP & INDEL and differential splicing gene detection. After obtaining the new transcript, the new transcript with protein coding potential is added to the reference gene sequence to form a complete reference sequence, and then the gene expression level is calculated. 3.2 Transcriptome sequencing data analysis, detect differentially expressed genes between different samples as needed, and perform cluster analysis and functional enrichment analysis on the differentially expressed genes.

[0150] 3.2.1 Analysis of gene expression, using Bowtie2 to align cleanreads to the reference sequence to count the gene alignment rate, and then using RSEM to calculate the expression levels of genes and transcripts. RSEM is a convenient software for RNA-seqreads to calculate the expression of genes and transcripts. The Pearson correlation coefficient between each two samples was calculated with the help of the cor function in the R software, the hclust function in the R software was used for hierarchical clustering analysis, the princomp function in the R software was used for PCA analysis, and finally the analysis graph was drawn. RSEM: It is a software for calculating gene expression levels, which calculates the corresponding expression level based on the alignment results of reads and the corresponding annotation information. Bowtie2: It is a sequence alignment software that can quickly align sequencing reads to the corresponding reference sequence. 3.2.2 Differentially expressed gene detection, for oocytes at different stages, the present invention uses the DEseq2 algorithm to perform differential gene detection. The DEseq2 method is based on the principle of negative binomial distribution to perform differential gene detection between oocytes at different stages. Differential genes were screened when the difference was two-fold or more and the corrected P value was less than or equal to 0.05.

[0151] 3.2.3 GO functional analysis of differentially expressed genes. According to the GO annotation results and classification, the differentially expressed genes were functionally classified, and the phyper function in the R software was used for enrichment analysis. The p-value calculation method was as follows, and then the pvalue was FDR corrected. Usually, functions with FDR <= 0.01 were considered significantly enriched.

[0152] 3.2.4 Pathway functional analysis of differentially expressed genes. According to the KEGG annotation results and official classification, the present invention classifies the differentially expressed genes into biological pathways, and uses the phyper function in the R software for enrichment analysis. The p-value calculation method is as above, and then the p-value is corrected for FDR. Generally, pathways with FDR <= 0.01 are considered to be significantly enriched.

[0153] 3.3qRT-PCR analysis of differential gene expression patterns and subcellular localization of key proteins: 3.3.1 Extraction and reverse transcription of RNA from pig oocytes. The operation steps are similar to those in Example 1.

[0154] 3.3.2 Fluorescence quantitative reaction system and steps, according to the screening results of pig oocyte high-throughput sequencing, NCBI queried Rap1B sequence, and designed primer sequences according to homologous recombination requirements. The primers are shown in Table 4. The DNA sequences are SEQ ID NO: 13 to SEQ ID NO: 40.

[0155] 3.3.3 Key protein immunofluorescence staining, subcellular localization of key target proteins, the operation steps refer to the subcellular localization immunofluorescence staining method in Example 1.

[0156] 4 Results: 4.1 Gene alignment and expression, Bowtie2 was used to align cleanreads to the reference sequence, and then RSEM was used to calculate the expression levels of genes and transcripts. The alignment ratio of reads to genes is shown in Table 5, and the number of genes and transcripts in the samples is shown in Table 6.

[0157] Table 4 qRT-PCR polymerase chain reaction primer sequences

[0158]

[0159]

[0160] Table 5 Gene alignment rate statistics

[0161]

[0162] Table 6 Statistics of the number of genes and transcripts

[0163] sample Total genes Known genes New genes Total transcripts KnownTranscript New transcript GD1 19739 19074 665 33526 23128 10398 GD2 19547 18893 654 32899 22623 10276 GD3 19599 18938 661 32973 22689 10284 GV1 20207 19533 674 34575 24026 10549 GV2 20059 19395 664 33829 23465 10364 GV3 19860 19184 676 33487 23158 10329

[0164] 4.2 Correlation between samples, in order to reflect the correlation of gene expression between samples, the present invention calculated the Pearson correlation coefficient of all gene expression between every two samples, and reflected these coefficients in the form of heat map. Figure 2 The heat map of correlation analysis between samples was used to perform hierarchical cluster analysis on all samples using the expression levels of all genes. The results are shown in Figure 3 Hierarchical cluster analysis diagram between samples, which can directly reflect the relationship between each sample. Figure 3 The closer the samples are to each other, the more similar their expression profiles are.

[0165] 4.3 Gene expression between samples and groups. For the expression data of multiple samples, the Venn diagram is used to show the expression of genes between different samples and groups. Figure 4 Venn diagram analysis between samples and groups. This Venn diagram can show the number of genes specifically expressed in one sample (group) and the number of genes expressed in multiple samples (groups).

[0166] 4.4 Differentially expressed gene detection: According to the gene expression level of each sample, the differentially expressed genes (DEGs) between samples (sample groups) are detected. The present invention uses the DEseq2 method for differential detection. The detection results are statistically shown as follows: Figure 5 Significantly differentially expressed genes (DGEs) were identified, and a heat map of expression was plotted for each group of DEGs. Figure 6, the X-axis represents each group of differential comparison schemes, and the Y-axis represents the corresponding number of DEGs. Dark black represents the number of upregulated DEGs, and light black represents the number of downregulated DEGs. The X-axis represents the samples of cluster analysis, and the Y-axis represents the differentially expressed genes. The color represents the foldchange value after taking the log. The darker the color, the greater the difference in expression, and the lighter the color, the smaller the difference in expression.

[0167] 4.5 Screening and gene expression pattern of key gene Rap1B:

[0168] According to the high-throughput sequencing results, the present invention screened out 12 genes with significant differential expression, namely MAPKAPK3, CCSAP, BAZ2A, KDM6B, RAP1B, AK6, CDT1, KLF2, ADGRA3, CEP57, CCSAP20, and WRNIP1. According to the gene sequence query on the NCBI website, primers were designed using Primer5 primer design software. GV stage oocytes were set as the control group and GVBD stage oocytes were set as the experimental group. qRT-PCR detection was performed on the two groups of oocytes, and the analysis results were as follows: Figure 7 Differential gene expression patterns of porcine oocytes at different developmental stages, where Control: porcine oocytes cultured in vitro for 0 hours; Treated: porcine oocytes cultured in vitro for 19 hours (**P<0.01, ***P<0.001), MAPKAPK5, KDM6B, Rap1B, and WRNIP1 showed a significant upward trend, while CCSAP, KLF2, ADGRE3, and CEP57 showed a significant downward trend, among which the upward trend of Rap1B was particularly significant (p<0.01). Then, the expression of the mRNA level of the Rap1B gene at different time points during oocyte development was detected, such as Figure 8 The expression pattern of Rap1B mRNA at different developmental stages (**P<0.01, ***P<0.001) showed that the expression level of Rap1B was the lowest at 0h and was significantly upregulated at 19h (p<0.001).

[0169] 4.6 Localization of Rap1B in oocytes at different stages. Combined with the expression of Rap1B mRNA, considering the changes in the nuclear state when oocyte GVBD occurs, Rap1B was immunofluorescently stained. The results showed that Rap1B was distributed in the cytoplasm around the nucleus during the GV stage. As the oocyte develops, Rap1B gathers towards the nucleus. Fig. 9 Immunofluorescence staining of Rap1B at different developmental stages. Hoechst33342 shows the nuclear status; A12925 shows the localization of Rap1B in oocytes.

[0170] 4.7 High-throughput sequencing predicted Rap1B signal transduction pathway model diagram. The prediction of high-throughput sequencing results showed that Rap1B plays a role in signal transduction as an upstream signal molecule that liaises with MEK6 / p38MAPK during the GVBD process. The Rap1B signal transduction model diagram is shown in Figure 10. Rap1B signal transduction pathway model diagram.

[0171] 5. The development of early mammalian oocytes is regulated by various genes, among which differentially expressed genes play an important regulatory role in the development of oocytes, especially oocyte maturation. During the oocyte maturation process, especially the first significant turning point GVBD, a large number of transcriptional genes change (Meneau et al., 2020a), among which the key genes regulating oocyte GVBD have not been confirmed. Based on the fact that the occurrence of GVBD has been proved to be related to the regulation of the MAPK signaling pathway in cells, clarifying the important transcription factors in the GVBD process can provide great help in understanding the mechanism of oocyte development.

[0172] GVBD is a sign of the initiation of oocyte maturation, and this process is accompanied by significant changes in gene expression. The current invention shows that mammalian specific mRNA can drive protein activation and promote oocyte development (Susor and Kubelka, 2017). When the expression level of a specific mRNA reaches a threshold level, it will promote the maturation of oocytes. Of course, in order to reach a threshold level for a specific transcription factor in a cell, the cytoplasm needs to provide sufficient raw materials and meet the time for key factors to activate transcription, which has been verified in African clawed frogs (Meneau et al., 2020b). In the present invention, high-throughput sequencing of porcine oocytes in the GV and GVBD stages was performed, and a total of 82 genes with significant differences were screened out, including PKA genes closely related to cAMP, Cdk genes related to cytoplasmic maturation polyadenylation, CCSAP genes related to apoptosis, etc. Among them, the Rap1B gene was found for the first time in the present invention to have significant changes in the GVBD process of porcine oocytes, and the mRNA level of the Rap1B gene in oocytes at different stages was detected. The results suggest that with the occurrence of GVBD, Rap1B It shows an upward trend, and when it reaches a certain threshold, it immediately decreases, which is contrary to the discovery that Rap1B inhibits GVBD in clawed frogs (Campa et al., 1991). In addition, as early as 1998, the analysis of Rap1B extracellular regulatory signals also showed that the activation of Rap1B would not lead to the cellular process related to ERK and cAMP synthesis caused by Ral activation (Zwartkruis et al., 1998). Therefore, the present invention shows that Rap1B exists in pig oocytes to regulate oocyte GVBD through a transduction pathway related to MAPK signals.

[0173] Through high-throughput sequencing and mapping of the Rap1B signal transduction pathway, it can be found that Rap1B is connected to the downstream MEK6 as a signaling pathway in pig oocytes, and MEK6 is an upstream cascade kinase of p38MAPK. Therefore, in the presence of a large amount of transcription, MEK6 is activated or inhibited to activate p38MAPK, inducing the occurrence of oocyte GVBD. By analyzing the gene expression patterns of pig oocytes in the GV and GVBD stages, and screening for differentially expressed genes, it is clear that the key gene regulating pig oocyte GVBD is Rap1B, which provides an important reference for enriching and improving the regulatory mechanism of early oocyte development and maturation.

[0174] Example 3: Analysis of the molecular mechanism of Rap1B regulating oocyte GVBD via the p38MAPK signaling pathway.

[0175] 1. Rap1B plays an important regulatory role in cell growth and differentiation (Zhou et al., 2020a). Ras-related protein Rap1B is activated through cAMP-related exchange factors cAMP-GEFs, and cooperates with cAMP to directly activate EPAC, and jointly participates in the development process of cells (Wang et al., 2018). Many existing technologies have shown that Rap1B protein has multiple regulatory mechanisms, among which the main signaling pathways include p38 and JNK in the downstream pathway of Rap1B. In melanoma, Rap1B expression changes, which in turn affects the expression of p38 and JNK / c-Jun, and greatly affects the migration and invasion of tumors (Zhou et al., 2020b). In addition, there is technology that shows that there is a MEK6 / p38 signal transduction pathway between Rap1B and the p38MAPK signaling pathway, and Rap1 overexpression will enhance p38 activity; in muscle cells, Rap1B behaves by transducing signals to the MEK6 / p38 pathway, but does not participate in MEK3 / JNK pathway transduction (Sawada and Nakamura et al., 2001). According to the relevant invention, Rap1B is a positive regulator for the p38MAPK signaling pathway, and by expressing Rap1B, p38MAPK is activated, thereby promoting cell development or death (Gutierrez-Uzquiza et al., 2010). This shows that Rap1B plays a unique role in different cells.

[0176] There are few discoveries about the p38MAPK signaling pathway mediated by Rap1B in oocytes. According to relevant discoveries, the activation of Rap1B in oocytes may play a role upstream of the activation of p38MAPK (Ahn et al., 2006). Interestingly, the activation of Rap1B is mediated by a variety of second messengers, among which the most important ones include calcium ions, diacylglycerol and cAMP (Zwartkruis and Bos, 1999). The decrease of cAMP will activate MAPK, which in turn induces changes in the configuration of the oocyte germinal vesicle (Sun et al., 2016). That is, the original diffuse state is transformed into an agglutinated state, which is also one of the important indicators of GVBD in oocytes.

[0177] In order to clarify that Rap1B regulates oocyte GVBD by mediating the p38MAPK signaling pathway, the present invention constructed an overexpression vector and interference siRNA in vitro, disrupted and overexpressed Rap1B by microinjection, detected the activation of p38 and the occurrence of GVBD in oocytes after the change of Rap1B expression, and finally clarified the regulation of Rap1B-mediated p38MAPK signaling pathway on oocyte GVBD.

[0178] 2 Materials: 2.1 Experimental materials include: 2.1.2 Experimental reagents. The reagents used in this experiment include kits for cloning genes, kits for in vitro transcription reactions, immunofluorescence staining antibodies, Western Blot protein detection antibodies and related reagents, see Table 7 for details.

[0179] Table 7 Main reagents

[0180]

[0181]

[0182] 3 Methods: 3.1 Construction of Rap1B overexpression vector includes: 3.1.1 Rap1B primer design and amplification, gene cloning PCR using Taq series DNA polymerase from Akre Company, primer sequences were designed based on the gene sequence of porcine Rap1B provided by the NCBI website and the sequences on both sides of the SpeI restriction site in P-EASY-T3, and primers were synthesized by Shanghai Bioengineering (Table 8).

[0183] Table 8 Rap1B cloning primer sequences

[0184]

[0185] The cloning reaction conditions were: 95°C, 10 s; 60°C, 15 s; 72°C, 20 s; 40 cycles, and stored at 4°C. The reaction system is shown in Table 9.

[0186] Table 9 Cloning reaction components

[0187] PCR amplification reaction components volume TaqDNA polymerase (2×) 10μL Primer F / R (10 μM) 1.6μL cDNA 2μL ddH2O 6.4μL

[0188] 3.1.2 Agarose gel electrophoresis and gel recovery, weigh 1g agarose and add it to 100mL TAE buffer, heat it in a microwave oven until it boils, wait for the liquid to cool to about 50°C, add 10μL Goldview Nuclciacid nucleic acid dye to the bottom of the conical flask. Pour the agarose into the prepared plate, and pull out the comb after it is fully solidified. Add 4μL 6xDNA loading buffer to 20μL sample, blow and mix, add the treated sample to the well, run electrophoresis for 30min at 120V voltage. After agarose gel electrophoresis, use ABclonal's multifunctional DNA recovery and purification kit for gel recovery, use an ultra-micro spectrophotometer to detect the concentration, and connect it for later use.

[0189] 3.1.3 Connection and transformation of T3 vector and Rap1BRap1B, Connection: Mix the PCR amplification product recovered from the gel with pEASY-T3CloningVector and react at room temperature for 10 minutes. After the reaction, place the centrifuge tube on ice. The reaction system is shown in Table 10:

[0190] Table 10 Connection transformation system

[0191] Transformation: Add the ligation product to 50μL Trans1-T1 competent cells, flick to mix, place on ice for 30 minutes, put in 42℃ hot water, heat shock for 30 seconds, and immediately place on ice for 2 minutes. Then add the competent cells to 250μL LB medium, culture at 200rpm and 37℃ for 1 hour to revive the bacteria. Centrifuge the bacterial solution, discard the supernatant, take 100uL of the concentrated bacterial solution, and spread it on an LB solid culture plate containing 50ug / mL ampicillin, invert at 37℃, and culture for 16-20 hours away from light.

[0192] 3.1.4 PCR detection and sequencing of bacterial liquid, PCR detection: add the colonies obtained by the present invention to LB liquid culture medium containing Amp, and culture at 37°C, 180rpm shaking for 12-16h; use the obtained bacterial liquid as a template, perform primer PCR amplification, and identify the inserted fragment. The reaction system is shown in Table 11:

[0193] Table 11 Reaction system

[0194] Reaction components volume TaqDNA polymerase (2×) 10μL Primer F / R (10 μM) 2μL Bacterial liquid 8μL

[0195] Reaction conditions: 95℃, 10s; 60℃, 15s; 72℃, 20s; 40 cycles, stored at 4℃. Then agarose gel electrophoresis was performed to detect PCR products and positive clones. The bacterial solution was sent to the sequencing department of Sangon Biotechnology Co., Ltd. for sequencing verification.

[0196] 3.1.5 Linearize Rap1B. Use plasmid extraction kit and gel recovery kit to obtain T3 vector plasmid inserted with Rap1B. Use restriction endonuclease SpeI-HF to set up the reaction system on ice as follows:

[0197] Reaction components: T3 vector plasmid DNA 1μg, 10xNEB buffer 5μL, Restriction Enzyme, 1μL, Nuclease-free water 50μ. Reaction conditions: 37℃, 15min; 80℃, 20min. Then agarose gel electrophoresis was performed to detect PCR products.

[0198] 3.1.6 To obtain overexpressed Rap1B mRNA, the plasmid DNA inserted with Rap1B was reverse transcribed using the mMESSAGET7ULTRA transcription kit, and a Poly(A) tailing procedure was performed. The obtained mRNA was purified and recovered using QIAGEN's RNeasyMiniKit, and the RNA concentration was detected using an ultramicrospectrophotometer and stored at -80°C for future use.

[0199] 3.6 Synthesis of Rap1B siRNA sequence. The Rap1B gene interference sequence was synthesized by Shanghai Sangon Biotechnology Co., Ltd. Three different interference fragments were designed for the Rap1B gene, corresponding to the starting points 15, 100, and 383, respectively. The interference fragment sequences are shown in Table 12.

[0200] Table 12 Rap1B interference fragment sites and interference sequences

[0201]

[0202]

[0203] 3.2 In vitro culture of porcine oocytes, same as in Example 1. 3.3 Immunofluorescence staining of oocytes, same as in Example 1. 3.4 Western Bolt protein blot analysis, same as in Example 1. 3.5 qRT-PCR fluorescence quantitative analysis, same as in Example 1. 3.6 Microinjection, before injection, preparation of oocyte fixation needle and configuration of micromanipulation are performed. Use Model P-97 needle puller to obtain glass needle, use Narishige needle breaking instrument to bake the fixed needle with an outer diameter of about 120 μm and an inner diameter of about 40 μm, and it can be used. Use a large plate as a container, add 7.5 μg / mL of CB to 200 μL MAN (operating solution + BSA), make the operating solution into a spindle shape and place it in the center of the plate, and cover it with liquid paraffin. Add the treated oocytes into the operating droplet and place it under an inverted microscope. Adjust the tip of the fixed needle to an angle of about 30° with the platform. After fixing the oocytes, use an RNase-free injection needle with an inner diameter of about 1 μm to insert it into the cell to a depth of about 70 μm. Then use the Eppendorf system to inject siRNA or mRNA into the oocyte by adjusting the injection pressure and injection time.

[0204] To ensure the success of the injection, the injection system was first tested using goat anti-mouse IgG with a fluorescent marker, and the injection was performed after ensuring the success of the injection under a fluorescent microscope. The injection conditions were: injection pressure 200hPa, compensation pressure 70hPa, injection time 0.5s, and injection volume 10pL.

[0205] 4 Results: 4.1 Construction of overexpression vector and in vitro transcription. Specific primers were designed based on the NCBIRap1B sequence. The sequence is:

[0206] F: TGATCCTGGTTGGTAATAAGTGTGA, SEQ ID NO: 41;

[0207] R:AGTTTTTCGTTAATTTGTCGCACT, SEQ ID NO: 42;

[0208] Using porcine oocyte cDNA as template, PCR amplification was performed with high-fidelity enzyme, and the size of Rap1BRap1B was 555 bp, SEQ ID NO: 9; agarose gel electrophoresis results showed that its band size was consistent with the target band size ( Fig.11 ); The target band was recovered and purified by gel electrophoresis, and the purification effect met the experimental requirements ( Fig.12 ); The purified Rap1B was connected to the T3 vector. After successful connection, PCR was performed on the bacterial solution, and the bacterial solution with the same band size as the Rap1B fragment was sequenced. The plasmid was extracted from the bacterial solution with correct sequencing and verified ( Fig.13), use restriction endonucleases to cut the circular plasmid and verify ( Fig.14 ), the length of the linearized plasmid is consistent with Rap1BRap1B and the vector is connected, and the Rap1B mRNA modified with a Poly(A) tail is obtained using a T7 reverse transcription kit. M: DL1000 marker; M1: DL5000 marker; M2: DL5000 marker; a: amplified Rap1B gene; b: gel recovery of Rap1BRap1B fragment; c: purification result verification; d: 1 and 2 are linearized plasmids of Rap1B-pEASY-T3 after single-cut enzyme Spel linearization treatment; Fig.15 This is the electrophoresis diagram of Rap1B-pEASY-T3: The results of bacterial sample gel electrophoresis of five bacterial samples 2, 3, 4, 6, and 7 verified by bacterial solution PCR showed that the Rap1B in vitro transcription vector was successfully constructed.

[0209] 4.2 Determination of injection time point and detection of post-injection effect. Before microinjection, the cumulus cells surrounding the oocytes need to be removed. The experimental results of the present invention show that removal of cumulus cells at 6 h has almost no effect on oocyte GVBD, and the incidence of oocyte GVBD is maintained at more than 60%. After using the Eppendorf system to inject goat anti-mouse IgG with a fluorescent marker, obvious fluorescence can be seen under a fluorescence microscope ( Fig.16 Therefore, it is feasible to remove the cumulus when the oocytes are cultured in vitro for 6 hours, and the microinjection system can be used normally. Fig.16 In the experiment, 6-hour-old cumulus oocytes were microinjected with fluorescent marker goat anti-mouse IgG at a concentration of 1:200, injection pressure of 200 hPa, compensation pressure of 70 hPa, and injection time of 0.5 sec.

[0210] 4.3 Effects of knockdown and overexpression of Rap1B on gene expression in oocytes: 4.3.1 Determination of knockdown fragments of Rap1B. Three knockdown fragments of Rap1B were injected using the Eppendorf system, and RNA was extracted from oocytes for gene expression detection ( Fig.17 The effect of injection of different siRNA fragments on Rap1B gene expression (Figure 3) showed that Rap1B-10 had no obvious knockdown effect on the Rap1B gene, while Rap1B-100 and Rap1B-383 had significant knockdown effects on the Rap1B gene (p < 0.001), with Rap1B-100 being the most significant. Therefore, in subsequent experiments, it was determined that the Rap1B-100 knockdown fragment would be used for injection. Fig.17In the figure, control: blank control group, oocytes cultured for 19 hours; R1, R2, R3: oocytes injected with interference fragments Rap1B15, Rap1B100, and Rap1B383, respectively, and cultured for 19 hours; (**P<0.01, ***P<0.001).

[0211] 4.3.2 Changes in Rap1B gene expression and protein expression levels after knockdown and overexpression. Real-time fluorescence quantitative PCR analysis showed that the expression of Rap1B gene in oocytes of the knockdown group was significantly inhibited, while the expression of Rap1B in the overexpression group was significantly upregulated ( Fig.18 Rap1B mRNA expression pattern in oocytes after disturbance and overexpression, Control: control group; Disturbance: disturbance group; Overexpression: overexpression group (**P<0.01, ***P<0.001). In addition, the expression of Rap1B after microinjection was detected and verified by Western Blot. The WB bands showed that the Rap1B protein in the overexpression group was significantly upregulated compared with the control group, while the Rap1B protein in the disturbance group was inhibited compared with the control group ( Fig.19 Effect diagram of Rap1B protein expression after interference and overexpression. Fig. 20 The above experimental results show that the interference fragments and overexpressed mRNA injected into oocytes can effectively inhibit or promote the expression of Rap1B in oocytes.

[0212] 4.4 The effect of disturbing and overexpressing Rap1B gene on GVBD of oocytes. After immunofluorescence staining analysis of oocytes injected with siRNA and overexpressed mRNA, it was found that Rap1B gene was involved in the occurrence of GVBD of oocytes. In the early stage, it was found that Rap1B gene had a significant upward trend in the whole process from GV stage to GVBD stage of oocytes, and the expression of Rap1B began to decline after GVBD. Therefore, the present invention statistically analyzed the incidence of GVBD of oocytes after treatment by disturbing and overexpressing Rap1B gene. The results showed that the incidence of GVBD reached 71.7% after Rap1B was overexpressed, showing a significant promoting effect; after disturbing Rap1B, GVBD of oocytes was significantly inhibited, and the GVBD rate dropped to 26.2%. The development of oocytes cultured to 19h after microinjection is shown in Table 13.

[0213] Table 13 Statistical data of oocyte development after different treatments

[0214]

[0215] 4.5 Effects of knockdown and overexpression of Rap1B on the spindle and nuclear lamina of oocytes. The morphology of the spindle changes with the development of the oocyte. The positioning of the spindle gradually moves inward from the periphery of the nucleus to the inside of the nucleus as the oocyte develops. After knockdown and overexpression of Rap1B, it was found that in the knockdown group, the spindle fibers were scattered in the cytoplasm and lost the original trend of condensing from the periphery of the nucleus to the inside of the nucleus. In the overexpressed oocytes, the present invention clearly saw that the spindle was concentrated at the nucleus ( Fig.21 The obvious regular dynamic changes of the spindle are consistent with normal cell development, which indicates that the knockdown or overexpression of Rap1B has an impact on the nuclear maturation of oocytes, and Rap1B has a positive promoting effect on the GVBD of oocytes.

[0216] LaminA / C participates in the assembly of the nuclear membrane for the oocyte nucleus. When phosphorylated p38MAPK is activated, the nuclear lamin LaminA / C receives the stimulation signal from p38MAPK, which in turn causes the phosphorylation of LaminA / C, thereby regulating the disintegration of the oocyte nuclear membrane in an orderly manner, causing the molecular phenomenon of GVBD in the oocyte. The phosphorylated LaminA / C was also analyzed in the process of knockdown and overexpression, especially its localization and expression in the cell was determined by immunofluorescence staining ( Fig. 22 Immunofluorescence staining of p-LaminA / C in oocytes after knockdown and overexpression). In the overexpression group, phosphorylated LaminA / C was significantly activated, while in the knockdown group it was in an inactivated state.

[0217] 4.6 Effects of knockdown and overexpression of Rap1B on p-MEKK6 and p-p38 MAPK in oocytes. First, oocytes that were 6 hours old were microinjected with Rap1B overexpression mRNA and knockdown siRNA, respectively. Then, the oocytes were placed in an incubator and cultured for 19 hours. The 19-hour oocytes were treated and the expression levels of p-MEKK6 and p-p38 proteins were detected. Fig.23 Immunofluorescence staining of p-p38 in oocytes after knockdown and overexpression. Fig.24 Western blot detection of related proteins in oocytes after knockdown and overexpression. Figure 25-28 They are p-p38MAPK protein, p-MEKK6 protein, p38MAPK protein, and MEKK6 protein, respectively; the bar graphs are compared with β-actin after normalization (one-way ANOVA, **P<0.01, ***P<0.001, ****P<0.0001).

[0218] Compared with the control group, both MEKK6 and p38MAPK were phosphorylated in the overexpression group, and the WB bands indicated that the content of phosphorylated proteins showed a significant upward trend in oocytes; in the perturbation-low group, the total protein content of MEKK6 and p38 did not change significantly, but the phosphorylated MEKK6 and phosphorylated p38 protein contents in oocytes showed a significant downward trend compared with the control group; combined with the statistics of the incidence of GVBD in oocytes and the upstream and downstream relationship of Rap1B with MEKK6 and p38MAPK signaling pathways in high-throughput sequencing results, the GVBD rate in the overexpression group was significantly increased, while the GVBD incidence in the perturbation-low group was significantly inhibited. Therefore, it was finally concluded that during the development of pig oocytes, the activation and inhibition of Rap1B regulated the activation and inhibition of downstream MEKK6 proteins and then regulated the p38MAPK signaling pathway, ultimately affecting the development process of oocytes, that is, promoting or blocking the occurrence of oocyte GVBD.

[0219] 5. The occurrence of GVBD in porcine oocytes is related to many factors. After injection of overexpression and interference fragments of the Rap1B gene, the GVBD process of porcine oocytes changed significantly, and the spindle morphology of the oocytes and the phosphorylation degree of lamins related to nuclear membrane assembly also changed accordingly. Related inventions show that the functions of lamins A / C are mainly reflected in the nuclear envelope of early cells, changing the morphology of the nucleus, transmitting signals, participating in stress response, maintaining the stability of the intranuclear space, stabilizing the chromatin morphology, regulating gene expression, and promoting the cell cycle process (Murray-Nerger and Cristea, 2021). The present invention regulates the Rap1B gene of oocytes to make it show corresponding interference and overexpression, and detects MAPK signaling pathway proteins related to GVBD respectively. The experimental results show that after the injection of siRNARap1B interference fragment, the incidence of GVBD in oocytes is downregulated to 26.6%, which is significantly inhibited. The activation detection of p38 protein shows the result that the phosphorylated p38 level is significantly inhibited; and the conclusion opposite to this result is presented in oocytes treated with overexpression of Rap1B.

[0220] For this reason, the present invention further detected MEKK6 upstream of the oocyte p38 protein. Related inventions show that MAPK phosphatase can simultaneously dephosphorylate and activate the threonine and tyrosine phosphate groups on p38, so MEKK6 can play a role in regulating the activation of p38 protein (Owens and Keyse, 2007). This phenomenon shows a positive correlation between MEKK6 and p38 protein, which is also confirmed by the results of the present invention.

[0221] After knockdown and overexpression of Rap1B, the phosphorylation level of p38 in oocytes was positively correlated with oocyte GVBD. This phenomenon is not uncommon in previous discoveries. For example, the most in-depth ERK-specific phosphatase showed a dynamic expression pattern for the expression of fibroblast growth factor signaling sites conducted by MKP3 (Dickinson et al., 2002). The discovery of limb nerve tissue in chicken embryonic development showed that MKP-3 expression was mediated by FGF, and FGF played a role as a key mediator in regulating the level of activated ERK (Eblaghie et al., 2003). At present, Rap1B has also been confirmed as an upstream signal transduction factor of p38. The experimental results of the present invention also show that Rap1B affects the process of oocyte GVBD by regulating p38MAPK, but Rap1B does not directly act on downstream receptors. There is also a key protein MEKK6 in the p38MAPK signaling pathway. The detection results of MEKK6 by overexpression and knockdown of Rap1B gene indicate that MEKK6 plays a key role in signal transmission in the GVBD process.

[0222] After knockdown and overexpression of the Rap1B gene, a series of changes occurred in the activation of oocyte MKK6 protein, p38 protein, and lamin A / C, which in turn regulated the GVBD process of oocytes. This provides an important reference for the subsequent elucidation of the regulatory mechanism of early oocyte maturation.

[0223] In summary, the above examples show that the present invention aims to analyze the regulation mechanism of porcine oocyte maturation, focusing on the invention of the GVBD regulation mechanism of porcine oocytes. The present invention uses porcine oocytes as experimental materials, screens on the basis of high-throughput sequencing, constructs in vitro transcription vectors and interference sequences of key genes, regulates the expression of key genes by microinjection technology, and analyzes the oocyte maturation mechanism, and obtains the following conclusions:

[0224] (1) Before the in vitro maturation of porcine oocytes, there are two important stages: the GV stage and the GVBD stage. The GV stage lasts for a long time. Most oocytes are in the GV stage during the 0-16h in vitro maturation culture. When the oocytes are cultured for 19h, GVBD occurs in the oocytes.

[0225] (2) It was confirmed that p38MAPK was activated before oocyte GVBD, and p38MAPK mRNA and protein expression levels were significantly upregulated when GVBD occurred. After treatment with the p38MAPK signaling pathway inhibitor SB203580, oocyte GVBD was significantly inhibited, further demonstrating that the p38MAPK signaling pathway regulates oocyte GVBD.

[0226] (3) High-throughput sequencing of oocytes at the GV and GVBD stages was performed, and fluorescence quantitative detection and analysis were used to screen out the key factor Rap1B that regulates GVBD. Rap1B showed a significant upregulation trend during the GVBD process of porcine oocytes.

[0227] (4) Rap1B was knocked down and overexpressed, and qRT-PCR and Western Blot analysis revealed a positive regulatory relationship between Rap1B and p38 activation in oocytes. The occurrence of GVBD was regulated by the MEKK6-p38 signaling pathway mediated by Rap1B in oocytes.

[0228] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any modifications, equivalent substitutions and improvements made by any technician familiar with the technical field within the technical scope disclosed by the present invention and within the spirit and principles of the present invention should be covered within the protection scope of the present invention.

Claims

1. A method for promoting GVBD of pig oocytes in vitro by overexpressing key genes, characterized in that: The key gene is pig Rap1B, the DNA of which is shown in SEQ ID NO: 9, and is cloned and synthesized from pig oocytes.

2. The use according to claim 1, characterized in that The key gene Rap1B mRNA was overexpressed by constructing an in vitro overexpression vector.

3. The use according to claim 2, characterized in that: The method for constructing the in vitro overexpression vector comprises: Step 1, Rap1B primer design and amplification, according to the gene sequence of pig Rap1B provided by NCBI website and the sequences on both sides of the SpeI restriction site in P-EASY-T3, the cloning primer sequences are designed, and the cloning primer sequences include SEQ ID NO: 1 and SEQ ID NO: 2; Step 2, agarose gel electrophoresis and gel recovery; Step 3, connection and transformation of pEASY-T3 vector and Rap1B; the DNA sequence of pEASY-T3 vector is SEQ ID NO: 11; Step 4, bacterial liquid PCR detection and sequencing; Step 5, linearize Rap1B, use a plasmid extraction kit, a gel recovery kit to obtain a pEASY-T3 vector plasmid inserted with Rap1B, use a restriction endonuclease SpeI-HF, and set up a reaction system on ice; the DNA sequence of the pEASY-T3 vector plasmid inserted with the Rap1B gene is SEQ ID NO: 12; Step 6, obtaining overexpressed Rap1B mRNA, using mMESSAGE T7 ULTRA transcription kit, reverse transcribe the pEASY-T3 vector plasmid DNA inserted with Rap1B, and perform Poly (A) tail modification to obtain overexpressed Rap1B mRNA.

4. The use according to claim 3, characterized in that In step 1, the cloning reaction conditions were: 95°C, 10 s; 60°C, 15 s; 72°C, 20 s; 40 cycles, stored at 4°C; the reaction system included: 2x Taq DNA polymerase 10 μL, 10 μM Primer F / R 1.6 μL, cDNA 2 μL, ddH2O 6.4 μL.

5. The use according to claim 3, characterized in that: In step 3, connect: mix the PCR amplification product recovered from the gel with pEASY-T3CloningVector, react at room temperature for 10 minutes, and place the centrifuge tube on ice after the reaction. The reaction system includes: PCRProduct 0.5-4μL, pEASY-T3CloningVector 1μL; The transformation includes: adding the ligation product to 50 μL Trans1-T1 competent cells, mixing, ice bathing for 30 minutes, placing in 42°C hot water, heat shock for 30 seconds, and placing on ice for 2 minutes; then adding the competent cells to 250 μL LB culture medium, culturing at 200 rpm and 37°C for 1 hour to revive the bacteria; centrifuging the bacterial solution, discarding the supernatant, taking 100 μL of the concentrated bacterial solution, and applying it to an LB solid culture plate containing 50 ug / mL ampicillin, inverting at 37°C, and culturing in the dark for 16-20 hours; In step 4, PCR detection: add the obtained colonies to LB liquid culture medium containing Amp, and culture at 37°C, 180rpm shaking for 12-16h; use the obtained bacterial liquid as a template to perform primer PCR amplification to identify the inserted fragment; the reaction system includes: 2x TaqDNA polymerase 10μL, 10μM PrimerF / R 2μL; Reaction conditions: 95°C, 10s; 60°C, 15s; 72°C, 20s; 40 cycles, stored at 4°C; then agarose gel electrophoresis was performed to detect PCR products and positive clones; In step 5, setting up a reaction system on ice includes: Reaction components: pEASY-T3 vector plasmid DNA 1 μg, 10xNEB buffer 5 μL, Restriction Enzyme, 1 μL, Nuclease-free water 50 μL; reaction conditions: 37°C, 15 min; 80°C, 20 min; then agarose gel electrophoresis was performed to detect the PCR product.

6. An in vitro interference fragment constructed using the key gene in the use according to claim 1, characterized in that: According to the Rap1B gene, a RAP1B-100 interference fragment with a starting point at site 100 or a RAP1B-365 interference fragment with a starting point at site 365 was designed; the interference sequences of RAP1B-100 were SEQ ID NO: 7 and SEQ ID NO: 8, and the interference sequences of RAP1B-365 were SEQ ID NO: 3 and SEQ ID NO: 4.

Images