Diagnostic and therapeutic markers for diabetic peripheral neuropathy and their applications

Knocking out eIF6 through CRISPR/Cas9 technology or inhibiting eIF6 expression using eIF6 inhibitors has solved the treatment difficulties of diabetic peripheral neuropathy, and achieved the delay of disease course and improvement of pain sensation.

CN116650652BActive Publication Date: 2025-09-09TIANJIN MEDICAL UNIVERSITY GENERAL HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310886788.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-07-19
Publication Date
2025-09-09
Estimated Expiration
2043-07-19

AI Technical Summary

Technical Problem

The existing technology lacks effective drugs to delay the course of diabetic peripheral neuropathy, resulting in a rapid increase in incidence and seriously affecting the quality of life of patients.

Method used

CRISPR/Cas9 technology is used to knock out the eIF6 gene or use eIF6 functional inhibitors, such as small interfering RNA molecules or small hairpin RNA, to prepare a pharmaceutical composition for treatment by inhibiting the expression and activity of eIF6.

Benefits of technology

Effectively inhibit the progression of diabetic peripheral neuropathy, relieve pain hyposensitivity, and improve patients' quality of life.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116650652B_ABST
    Figure CN116650652B_ABST
Patent Text Reader

Abstract

The present invention discloses diagnostic and therapeutic markers for diabetic peripheral neuropathy and their applications. The diagnostic and therapeutic marker is eIF6. This invention, for the first time, discovers that upregulation of eIF6 in Schwann cells is closely associated with diabetic peripheral neuropathy. Targeted inhibition of eIF6 can effectively inhibit the progression of neuropathy, which is of great significance for the early diagnosis and treatment of diabetic peripheral neuropathy and for reversing the course of the disease. This invention develops a new method for diagnosing diabetic peripheral neuropathy and a new drug target for treating the disease.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of clinical diagnosis and treatment, and relates to diagnostic and treatment markers for diabetic peripheral neuropathy and applications thereof. Background Art

[0002] Diabetic peripheral neuropathy (DPN) is the most common complication of diabetes, affecting up to 50% of diabetic patients and contributing to the high disability, cardiovascular risk, and mortality rates associated with diabetes. DPN manifests as persistent pain, numbness, and sensory impairment symmetrically distributed in the distal extremities. Long-term DPN can lead to psychological problems such as depression, anxiety, and sleep disturbances, and in advanced stages, can even lead to foot ulcers and lower limb amputations, severely impacting patients' quality of life. According to statistics, in 2021, approximately 6.7 million adults worldwide died from diabetes and its complications, accounting for 12.2% of all deaths worldwide. This translates to approximately one death every five seconds and one person facing amputation due to diabetic foot disease every 30 seconds. However, due to the incomplete understanding of the pathogenic mechanism, DPN currently lacks a specific FDA-approved medication. Clinical treatment is limited to glucose control and analgesia, which are ineffective in slowing the progression of the disease. Consequently, the incidence of DPN continues to rise rapidly and uncontrollably, imposing a significant economic and social burden. Therefore, it is imperative to clarify the exact pathogenic mechanism of DPN as soon as possible and develop drugs that can effectively delay the progression of the disease. Summary of the Invention

[0003] The first aspect of the present invention discloses the use of the eIF6 gene for preparing a pharmaceutical composition for preventing or treating diabetic peripheral neuropathy.

[0004] Furthermore, the prevention or treatment of diabetic peripheral neuropathy refers to the prevention or treatment of hypoalgesia in diabetic peripheral neuropathy.

[0005] Preferably, the pain sensation includes mechanical pain sensation and thermal pain sensation.

[0006] Furthermore, the pharmaceutical composition comprises an inhibitor of functional expression of eIF6.

[0007] Furthermore, the inhibitor is a reagent for knocking out eIF6 through CRISPR / Cas9 technology.

[0008] The second aspect of the present invention discloses a pharmaceutical composition for preventing or treating diabetic peripheral neuropathy, wherein the pharmaceutical composition comprises an inhibitor of the functional expression of eIF6.

[0009] The inhibitors include but are not limited to antagonists, blockers, inhibitors, nucleic acid inhibitors and the like.

[0010] An inhibitor refers to any substance that can reduce the activity of eIF6 protein, reduce the stability of eIF6 gene or protein, downregulate the expression of eIF6 protein, reduce the effective action time of eIF6 protein, or inhibit the transcription and translation of eIF6 gene. These substances can be used in the present invention as substances useful for downregulating eIF6, and thus can be used to prevent or treat diabetic peripheral neuropathy.

[0011] The inhibitor of the eIF6 gene or protein is any substance that can reduce the activity of the eIF6 protein, reduce the stability of the eIF6 gene or protein, downregulate the expression of the eIF6 protein, reduce the effective duration of the eIF6 protein, or inhibit the transcription and translation of the eIF6 gene. These substances can be used in the present invention as substances useful for downregulating eIF6, thereby being used to prevent or treat diabetic peripheral neuropathy. For example, the inhibitor is a nucleic acid inhibitor, a protein inhibitor, an antibody, a ligand, a proteolytic enzyme, or a protein-binding molecule, as long as it can downregulate the expression of the eIF6 protein or its encoding gene at the protein or gene level.

[0012] As a preferred embodiment of the present invention, the eIF6 inhibitor is a small interfering RNA molecule specific for eIF6. As used herein, the "small interfering RNA" refers to a short double-stranded RNA molecule that can target and degrade specific mRNA with a homologous complementary sequence. This process is the RNA interference process. Small interfering RNA can be prepared in the form of a double-stranded nucleic acid, which contains a sense chain and an antisense chain, and these two chains form a double chain only under hybridization conditions. A double-stranded RNA complex can be prepared by separating the sense chain and the antisense chain from each other. Therefore, for example, the complementary sense chain and antisense chain are chemically synthesized, and then can be hybridized by annealing to produce a synthetic double-stranded RNA complex.

[0013] As an optional method of the present invention, the eIF6 inhibitor can also be a "small hairpin RNA (shRNA)", which is a non-coding small RNA molecule that can form a hairpin structure. Small hairpin RNA can inhibit gene expression through the RNA interference pathway. As mentioned above, shRNA can be expressed from a double-stranded DNA template. The double-stranded DNA template is inserted into a vector, such as a plasmid or a viral vector, and then connected to a promoter for expression in vitro or in vivo. Under the action of the DICER enzyme in eukaryotic cells, shRNA can be cut into small interfering RNA molecules, thereby entering the RNAi pathway. "shRNA expression vector" refers to some plasmids commonly used in the art to construct shRNA structures. Usually, the plasmid has a "spacer sequence" and multiple cloning sites or replacement sequences on both sides of the "spacer sequence", so that people can insert the corresponding DNA sequence of shRNA (or analogue) into the multiple cloning site or replace the replacement sequence thereon in a forward and reverse manner. The RNA transcribed from the DNA sequence can form an shRNA (Short Hairpin) structure. The “shRNA expression vector” is currently available through commercial channels, such as some viral vectors.

[0014] Nucleic acid inhibitors of the present invention, such as siRNA, can be chemically synthesized or prepared by transcribing an expression cassette within a recombinant nucleic acid construct into single-stranded RNA. Nucleic acid inhibitors such as siRNA can be delivered into cells using appropriate transfection reagents or various other techniques known in the art.

[0015] In a specific embodiment of the present invention, the inhibitor is an agent for knocking out eIF6 by CRISPR / Cas9 technology.

[0016] Furthermore, the pharmaceutical composition also includes a pharmaceutically acceptable carrier.

[0017] The "pharmaceutically acceptable carrier" refers to a carrier used for the administration of therapeutic agents, including various excipients and diluents. This term refers to pharmaceutical carriers that are not necessary active ingredients themselves and are not overly toxic after administration. Suitable carriers are well known to those of ordinary skill in the art. In the composition, the pharmaceutically acceptable carrier may contain a liquid such as water, saline, or a buffer. In addition, auxiliary substances such as fillers, lubricants, glidants, wetting agents or emulsifiers, pH buffer substances, etc. may also be present in these carriers. The carrier may also contain a cell (host cell) transfection reagent.

[0018] The present invention can administer the inhibitor, its encoding gene, or its pharmaceutical composition to a mammal using a variety of methods well known in the art, including but not limited to subcutaneous injection, intramuscular injection, transdermal administration, topical administration, implantation, and sustained-release administration. Preferably, the administration is parenteral.

[0019] Preferably, gene therapy can be used. For example, an eIF6 inhibitor can be directly administered to a subject by injection or other methods. Alternatively, an expression unit carrying an eIF6 inhibitor (such as an expression vector or virus, or siRNA or shRNA) can be delivered to the target site via a specific route to allow expression of an active eIF6 inhibitor. The specific method will depend on the type of inhibitor, and these are all well known to those skilled in the art.

[0020] The pharmaceutical composition of the present invention can also be used in combination with other drugs for treating diabetic peripheral neuropathy. Other therapeutic compounds can be administered simultaneously with the main active ingredient, or even administered simultaneously in the same composition.

[0021] The pharmaceutical compositions of the present invention may also be administered separately with other therapeutic compounds in separate compositions or dosage forms different from the primary active ingredient. Partial doses of the primary ingredient may be administered simultaneously with the other therapeutic compound, while other doses may be administered alone. During treatment, the dosage of the pharmaceutical compositions of the present invention may be adjusted based on the severity of symptoms, the frequency of recurrence, and the physiological response to the treatment regimen.

[0022] The third aspect of the present invention discloses the use of the eIF6 gene for screening candidate compounds for preventing or treating diabetic peripheral neuropathy.

[0023] Furthermore, the step of screening candidate compounds for preventing or treating diabetic peripheral neuropathy comprises:

[0024] In the test group, a test compound is added to the cell culture system, and the expression level and / or activity of eIF6 in the cells of the test group is observed; in the control group, no test compound is added to the same cell culture system, and the expression level and / or activity of eIF6 in the cells of the control group is observed; wherein, if the expression level and / or activity of eIF6 in the cells of the test group is lower than that of the control group, it indicates that the test compound is a candidate compound for treating diabetic peripheral neuropathy that has an inhibitory effect on the expression and / or activity of eIF6.

[0025] In the present invention, the step further includes: conducting further cell experiments and / or animal experiments on the obtained candidate compounds to further select and determine substances useful for preventing, alleviating or treating diabetic peripheral neuropathy from the candidate compounds.

[0026] In the present invention, the system for screening candidate compounds for preventing or treating diabetic peripheral neuropathy is not limited to the cell system, but also includes a cell system, a subcellular system, a solution system, a tissue system, an organ system or an animal system, etc. The system is not limited to the above forms, as long as the system can detect whether the test compound can reduce the expression and / or activity of eIF6.

[0027] The fourth aspect of the present invention discloses the use of a reagent for detecting the expression level of the eIF6 gene in the preparation of a product for diagnosing diabetic peripheral neuropathy.

[0028] The present invention can utilize any method known in the art to measure gene expression. It will be understood by those skilled in the art that the means for measuring gene expression is not an important aspect of the present invention. Exemplary methods for quantitative RNA expression in samples known in the art include, but are not limited to, Southern blotting, Northern blotting, microarray, polymerase chain reaction (PCR), NASBA, and TMA.

[0029] Furthermore, the reagent is selected from: a probe that specifically recognizes eIF6; or a primer that specifically amplifies eIF6; or an antibody or ligand that specifically binds to a protein encoded by eIF6.

[0030] Furthermore, the product includes a chip or a kit.

[0031] The chip may be a gene chip. The gene chip of the present invention comprises: a solid phase carrier; and oligonucleotide probes sequentially fixed on the solid phase carrier, wherein the oligonucleotide probes specifically correspond to part or all of the sequence shown in eIF6.

[0032] Specifically, suitable probes can be designed based on the genes described herein and immobilized on a solid support to form an "oligonucleotide array." The term "oligonucleotide array" refers to an array having addressable locations (i.e., locations characterized by distinct, accessible addresses), each containing a characteristic oligonucleotide associated therewith. As needed, the oligonucleotide array can be divided into multiple subarrays.

[0033] "Probe" is intended to include a nucleic acid oligomer or aptamer that specifically hybridizes to a target sequence in a nucleic acid or its complement under conditions that promote hybridization, thereby allowing detection of the target sequence or an amplified nucleic acid thereof. Detection can be direct (i.e., by the probe hybridizing directly to the target or amplified sequence) or indirect (i.e., by the probe hybridizing to an intermediate molecular structure that connects the probe and the target or amplified sequence). The "target" of a probe generally refers to a sequence in an amplified nucleic acid sequence that specifically hybridizes to at least a portion of the probe sequence through standard hydrogen bonding or "base pairing." A "sufficiently complementary" sequence allows for stable hybridization of the probe sequence to the target sequence even if the two sequences are not completely complementary. The probe may be labeled or unlabeled. The probe may be produced by molecular cloning of a specific DNA sequence or may be synthesized. One skilled in the art to which the present invention pertains can readily identify a variety of primers and probes that can be designed and used in the context of the present invention.

[0034] The solid phase carrier described in the present invention can be made of various commonly used materials in the field of gene chips, including but not limited to plastic products, microparticles, and membrane carriers. The plastic products can bind to antibodies or protein antigens through non-covalent or physical adsorption mechanisms. The most commonly used plastic products are small test tubes, beads, and microplates made of polystyrene. The microparticles are microspheres or particles polymerized from polymer monomers, mostly in micrometers in diameter. Because they carry functional groups that can bind to proteins, they easily form chemical couplings with antibodies (antigens) and have a large binding capacity. The membrane carriers include microporous filter membranes such as nitrocellulose membranes, glass cellulose membranes, and nylon membranes.

[0035] Advantages and beneficial effects of the present invention:

[0036] 1) This study discovered for the first time that upregulation of eIF6 in Schwann cells is closely related to diabetic peripheral neuropathy. Targeted inhibition of eIF6 will effectively inhibit the progression of neuropathy, which is of great significance for the early diagnosis and treatment of DPN and reversal of the disease course.

[0037] 2) The present invention provides a method for preventing or treating diabetic peripheral neuropathy, comprising administering to a subject an effective amount of an agent that inhibits eIF6. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 Figures showing the expression results of eIF6 in DPN at the animal level, where A: immunoblotting; B: bar graph; C: RT-qPCR graph; n = 8; ***p < 0.001, compared with the db / m group;

[0039] Figure 2 Figures showing the expression of eIF6 at the cellular level in DPN, where A: immunoblotting; B: bar graph; C: RT-qPCR; ***p < 0.001, compared with the Control group;

[0040] Figure 3 Graphs showing the effects of eIF6 treatment on DPN, A: mechanical paw withdrawal threshold (PWT); B: thermal paw withdrawal latency (TWL); n=8; *p<0.05, **p<0.01, ***p<0.001, compared with the db / m group; ##p<0.01, ###p<0.001, compared with the db / db group; two-way ANOVA. DETAILED DESCRIPTION

[0041] The present invention will be further described in detail below with reference to the accompanying drawings and examples. The following examples are intended to illustrate the present invention only and are not intended to limit the scope of the invention. Experimental procedures where specific conditions are not specified in the examples are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer.

[0042] Example Study on the Correlation between eIF6 Expression and DPN

[0043] 1. Experimental methods

[0044] (1) Animal Experiment Grouping: 16-week-old C57 BSK db / db healthy male mice (classic model of type II diabetes) were used as the animal model of diabetic peripheral neuropathy. db / m mice of the same litter served as the normal control group. 16 mice of each type were provided by Changzhou Cavens Laboratory Animal Co., Ltd. After the model was confirmed by fasting blood glucose and glucose tolerance tests, the mice were randomly divided into 4 groups (n = 8):

[0045] ① Control plasmid + db / m group (db / m): The needle was inserted between the tibialis anterior and gastrocnemius muscles, and the CRISPR / Cas9 control plasmid (SANTA CRUZ, sc-418922, USA) was injected into the sciatic nerve using a microsyringe. 1 μl was injected into each sciatic nerve. Further experiments were performed after 2 weeks of feeding.

[0046] ② Control plasmid + db / db group (db / db): CRISPR / Cas9 control plasmid (SANTA CRUZ, sc-418922, USA) was injected next to the sciatic nerve using a microsyringe, with 1 μl injected next to each sciatic nerve. Further experiments were performed after 2 weeks of feeding.

[0047] ③eIF6 KO+db / m group (E+db / m): eIF6CRISPR / Cas9 KO plasmid (SANTACRUZ, sc-421176, USA) was injected next to the sciatic nerve using a microsyringe, with 1 μl injected next to each sciatic nerve to knock down eIF6 expression in the sciatic nerve. Further experiments were performed after 2 weeks of feeding.

[0048] ④eIF6 KO+db / db group (E+db / db): Use a microsyringe to inject eIF6CRISPR / Cas9 KO plasmid (SANTA CRUZ, sc-421176, USA) next to the sciatic nerve, and inject 1 μl next to each sciatic nerve to knock down eIF6 expression in the sciatic nerve. Further experiments were performed after 2 weeks of feeding.

[0049] (2) Behavioral experiments

[0050] Mice were observed continuously for 6 weeks starting at 16 weeks of age. Paw withdrawal threshold (PWT) and thermal withdrawal latency (TWL) were measured at 16, 18, 20, 22, and 24 weeks of age. Mice were acclimated to the environment in a 20 cm × 20 cm × 20 cm metal cage at room temperature (22–25°C) for at least 1 hour. Paw withdrawal threshold (PWT) was measured using calibrated von Frey filaments (Stoelting, USA) ranging from 0.02 to 1.4 g. The von Frey filament was slightly bent and applied perpendicularly to the plantar surface of the hind paw, with pressure increasing from small to large, according to a modified up-down method described by Chaplan et al., for 3 seconds. The response to each stimulus was recorded. A positive response was considered if the mouse exhibited paw shaking, paw withdrawal, or paw licking. Six measurements were performed with 15-min intervals between each test. The 50% PWT was calculated according to the following formula: 50% PWT = 10^(xf + kδ) / 10000.

[0051] Thermal withdrawal latency (TWL) was measured using an infrared plantar thermal analgesia meter (IITC Life Science, Woodland Hills, USA). Mice were placed in a transparent enclosure and acclimated for at least 20 min. The withdrawal latency induced by radiant heat (15% heating intensity) was recorded. At least 15 min elapsed between two measurements. Three consecutive measurements were performed, with an upper cutoff time set at 30 s to prevent burns.

[0052] (3) Sciatic nerve specimen collection

[0053] After the last behavioral measurement, 24-week-old mice were anesthetized with the inhaled anesthetic sevoflurane and then killed. The mice were fixed in a prone position, the skin of the left lower limb was prepared and disinfected with iodine, the skin was incised, the visual field was exposed, and the muscles were bluntly dissected to expose the sciatic nerve from the ischial tuberosity to the medial ankle. The nerve was freed and cut, and then quickly placed in liquid nitrogen and frozen and stored in a -80°C refrigerator.

[0054] (4) Cell culture

[0055] Rat Schwann cells (RSC96) were purchased from Shanghai Tongpai Biotechnology Co., Ltd. and cultured at 37°C in a 5% CO2 incubator. DMEM medium was supplemented with 10% FBS, and the culture medium was replaced every other day. Schwann cell growth was observed under an inverted microscope, and exponentially growing cells were used for subsequent experiments. Cells in the high-glucose group (HG group) were cultured in 25 mM glucose medium for 48 hours to simulate high-glucose injury. Cells in the control group (Control group) were cultured in low-glucose medium containing 5.5 mmol / L glucose for 48 hours, after which they were harvested for subsequent experiments.

[0056] (5) Real-time PCR (QPCR) reaction

[0057] Frozen sciatic nerve tissue or Schwann cells were removed and revived, and total mRNA was extracted using the operating procedures provided in the TRIzol kit (Invitrogen) instructions. Subsequently, cDNA was synthesized using specific reverse primers according to the instructions of the reverse transcription kit, and PCR detection was performed using an ABI 7500 real-time fluorescence quantitative polymerase chain reaction instrument using cDNA as a template. The QPCR sample loading sequence was designed according to the experimental grouping and the number of genes detected. Three replicate wells were set up for each experimental sample, and the required reagents for each well were prepared according to the instructions. The DNA template in the negative control well was replaced with DEPC water. After mixing, the mixture was centrifuged instantly and placed in the center of the QPCR instrument. The reaction procedure was: 95°C pre-denaturation for 10 minutes, 95°C for 15 seconds, 60°C for 120 seconds, and 72°C for 20 seconds, for a total of 30 cycles. The primer sequences of the target genes are as follows:

[0058] eIF6-F:GAGTTGTCCTCCCTTCTTCAGG (SEQ ID NO. 1);

[0059] eFI6-R:TCGTGTCCAGACCACAGAAAGC(SEQ ID NO.2)

[0060] (6)Western Blot

[0061] Protein expression was determined by Western blotting. Frozen sciatic nerve tissue or Schwann cells were removed and ground in pre-chilled tissue protein lysis buffer. The homogenate was centrifuged at 4°C for 15 minutes at 13,000 rpm. The supernatant was collected and centrifuged again three times. The resulting supernatant was the total Schwann cell protein sample. After preliminary quantification of sample protein concentration by BCA assay, eIF6 expression was determined using rabbit eIF6 antibodies (HUABIO, ER2001-54, USA) and rabbit GAPDH antibodies (Abcam, ab-181602, USA) according to the instructions specified in the manufacturer's instructions.

[0062] (7) Statistical analysis: SPSS 21.0 software or Graphpad Prism 6.0 was used to analyze the data. Normally distributed data were expressed as mean ± standard deviation. Each statistical data is the average of at least three parallel experiments. Two independent sample t-tests were used to compare data between two groups. One-way analysis of variance was used to determine p-values ​​for multiple groups, and the Turkey method was used for pairwise comparisons. Repeated measurements over multiple time periods were analyzed using repeated measures analysis of variance, combined with the Bonferroni method for pairwise comparisons between groups. A p < 0.05 was considered statistically significant.

[0063] 2. Experimental results

[0064] (1) Increased expression of eIF6 mRNA and protein in the sciatic nerve of db / db mice

[0065] 48 hours after the last behavioral measurement, the rats were killed and their sciatic nerves were removed. Western Blot results showed that the expression of eIF6 protein in the sciatic nerves of the db / db group mice was significantly increased compared with the db / m group (p < 0.001). RT-qPCR results also showed that the mRNA level of eIF6 in the sciatic nerves of the db / db group mice was significantly increased (p < 0.001) (see results). Figure 1 The above results indicate that the occurrence of diabetic peripheral neuropathy is related to the up-regulation of eIF6 expression at the in vivo level.

[0066] (2) Increased mRNA and protein expression of eIF6 in high-glucose Schwann cells

[0067] After RSC96 cells were cultured in low-glucose (Control group) or high-glucose (HG group) medium for 48 hours, Western Blot results showed that compared with the Control group, the expression of eIF6 protein in the HG group cells was significantly increased (p < 0.001). RT-qPCR results also showed that the mRNA level of eIF6 in the HG group cells was significantly increased (p < 0.001) (see the results). Figure 2 The above results indicate that the occurrence of diabetic peripheral neuropathy is related to the up-regulated expression of eIF6 at the in vitro level.

[0068] (3) eIF6 gene knockout suppresses mechanical allodynia and thermal hypoalgesia in db / db mice

[0069] The results are as follows Figure 3 As shown, between 16 and 24 weeks, the mechanical paw withdrawal threshold (PWT) (g) and thermal paw withdrawal latency (TWL) (s) of the db / db group were significantly increased compared to the db / m group (p < 0.001), indicating hypoalgesia, demonstrating the establishment of a diabetic peripheral neuropathy model. Compared to the db / m group, the PWT and TWL of the E+db / m group did not change significantly (p > 0.05), indicating that inhibition of eIF6 expression does not affect the mechanical and thermal pain thresholds of normal mice. Compared to the db / db group, the PWT and TWL of the E+db / db group were significantly decreased, indicating that eIF6 knockout can effectively alleviate hypoalgesia in mice with diabetic peripheral neuropathy.

Claims

1. Use of a CRISPR / Cas9 KO plasmid targeting the eIF6 gene in the preparation of a pharmaceutical composition for treating hypoalgesia in diabetic peripheral neuropathy. The CRISPR / Cas9 KO plasmid was purchased from SANTACRUZ with the catalog number sc-421176.

2. The use according to claim 1, characterized in that The pain sensation includes mechanical pain and thermal pain.

3. The use of the eIF6 gene, characterized in that Used to screen candidate compounds for treating hypoalgesia in diabetic peripheral neuropathy, wherein the candidate compounds inhibit eIF6 expression or activity.

4. The use according to claim 3, characterized in that The step of screening candidate compounds for treating hypoalgesia in diabetic peripheral neuropathy comprises: In the test group, a test compound is added to the cell culture system, and the expression level and / or activity of eIF6 in the cells of the test group is observed; in the control group, no test compound is added to the same cell culture system, and the expression level and / or activity of eIF6 in the cells of the control group is observed; wherein, if the expression level and / or activity of eIF6 in the cells of the test group is lower than that of the control group, it indicates that the test compound is a candidate compound for treating diabetic peripheral neuropathy that has an inhibitory effect on the expression and / or activity of eIF6.